Journal List > J Bacteriol Virol > v.54(2) > 1516087787

TOOLS
Kim, Rana, Kim, Kim, Kim, Lee, and Lee: Prevalence, Antimicrobial Susceptibility, and Carbapenem Resistance of Non-baumannii Acinetobacter Species in Three Korean Hospitals
Original Article

J Bacteriol Virol. 2024;54(2):134-142.

DOI: https://doi.org/10.4167/jbv.2024.54.2.134

Prevalence, Antimicrobial Susceptibility, and Carbapenem Resistance of Non-baumannii Acinetobacter Species in Three Korean Hospitals

Shukho Kim1, 3, Md Shohel Rana1, Bokyung Kim1, Seong-Yeob Kim1, Nayeong Kim1, Da Eun Lee2, Je Chul Lee1, 2, 3, *

1 Department of Microbiology, School of Medicine, Kyungpook National University, Daegu 41944, Republic of Korea Republic of Korea

2 Kyungpook National University Hospital National Culture Collection for Pathogens (KNUH-NCCP), Kyungpook National University Hospital, Daegu 41944, Republic of Korea Republic of Korea

3 Untreatable Infectious Disease Institute, Kyungpook National University, Daegu 41944, Republic of Korea Republic of Korea

*leejc@knu.ac.kr

Received 1 May 2024       Revised 23 May 2024       Accepted 27 May 2024

Copyright © 2024 Journal of Bacteriology and Virology

Journal of Bacteriology and Virology

(open-access, https://creativecommons.org/licenses/by-nc/4.0/):

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (https://creativecommons.org/licenses/by-nc/4.0/).

Abstract

Non-baumannii Acinetobacter species are increasingly prevalent as opportunistic pathogens in the hospitals worldwide. However, the current information of epidemiology and antimicrobial susceptibility of non-baumannii Acinetobacter species is limited in Korea. This study investigated the species distribution, antimicrobial susceptibility, and carbapenem resistance mechanisms of 65 non- baumannii Acinetobacter isolates from three Korean hospitals during 2017 to 2020. Sixteen different Acinetobacter species were identified. Among them, A. ursingii (n = 16), A. junii (n = 11), and A. nosocomialis (n = 9) were prevalent, accounting for 55.4% of the isolates. A half (50.8%) of non-baumannii Acinetobacter isolates were susceptible to all antimicrobial agents tested. Non-baumannii Acinetobacter isolates exhibited the highest resistance rate to piperacillin (26.2%), whereas no isolates were resistant to minocycline and tigecycline. Seven isolates were resistant to carbapenems by the production of carbapenemases. Ambler class B (blaNDM-1 and blaVIM-2) and class D carbapenemase genes (blaOXA-23, blaOXA-58, blaOXA-211, and blaOXA-213) were detected. Three isolates carried two or more carbapenemase genes. One A. calcoaceticus isolate co-carried blaVOXA-58, blaOXA-213, and blaNDM-1. In conclusion, this study provides new insights into antimicrobial susceptibility and carbapenem resistance mechanisms of Korean non-baumannii Acinetobacter species. The spread of carbapenem resistance genes should be carefully monitored among non-baumannii Acinetobacter species.

Keywords: Non-baumannii Acinetobacter, Antimicrobial susceptibility, Carbapenem resistance, Metallo-β-lactamase

INTRODUCTION

Acinetobacter is a genus of gram-negative non-fermenting bacteria that are widely distributed in nature. The genus Acinetobacter is currently classified into more than 80 species (https://lpsn.dsmz.de/genus/acinetobacter). Acinetobacter species are a key source of infection in severely ill patients in the hospitals (1). Among the Acinetobacter species, A. baumannii is the most prevalent in clinical setting (2). In addition, non-baumannii Acinetobacter species that are ubiquitous in the environment have evolved as important opportunistic pathogens for humans (3). In the prevalence of Acinetobacter species from 2022 to 2023 at long-term care facilities and general hospitals in 16 regions of Korea, 81% isolates were identified to A. baumannii, whereas the remaining isolates were non-baumannii species (4). Several non-baumannii Acinetobacter species, including A. bereziniae, A. johnsonii, A. junii, A. lwoffii, A. nosocomialis, A. pitii, A. soli, and A. ursingii, are commonly isolated in clinical specimens (5, 6, 7).
A. baumannii is notorious for its ability to acquire resistance to antimicrobial agents, including cephalosporins, fluoroquinolones, and carbapenems, by intrinsic resistance and acquisition of resistance determinants (8). Carbapenem-resistant A. baumannii (CRAB) places top priority in the urgency of new antibiotic development by the World Health Organization (9). Although non-baumannii Acinetobacter species are considered to be less resistant to antimicrobial agents than A. baumannii, multi-drug resistance (MDR), including carbapenem resistance, in non-baumannii Acinetobacter species raises concern in clinical setting (3, 10, 11). Several Acinetobacter species intrinsically possess chromosomal carbapenem- hydrolyzing oxacillinases (CHDLs) such as blaOXA-51 for A. baumannii, blaOXA-23 for A. radioresistens, blaOXA-134 for A. lwoffii, blaOXA-211 for A. johnsonii, blaOXA-213 for A. calcoaceticus, and blaOXA-214 for A. haemolyticus (12). These species-specific oxacillinases have spread into other Acinetobacter species, for example exclusively existence of blaOXA-23 in Korean CRAB isolates (13). Ambler class B metallo-β-lactamases (MBLs), such as blaVIM and blaNDM, have been identified in non-baumannii Acinetobacter species worldwide (11, 14, 15). Furthermore, coexistence of MBL and CHDL genes by transfer of MBL-carrying plasmids has been reported in non-baumannii Acinetobacter species (14).
In Korea, non-baumannii Acinetobacter species are increasingly prevalent in recent years. Three species, A. nosocomialis, A. seifertii, and A. pittii, are the most prevalent, although species distribution is different among the hospitals (10, 16). Clinical isolates of non-baumannii Acinetobacter species are highly susceptible (>85%) to commonly used antimicrobial agents, including cephalosporins, β-lactams/β-lactamase inhibitors, fluoroquinolones, carbapenems, aminoglycosides, and colistin (17). However, resistance to these antimicrobial agents is gradually increasing in non-baumannii Acinetobacter species from Korean hospitals (18). The present study investigated the species distribution, antimicrobial susceptibility, and carbapenem resistance mechanisms of non-baumannii Acinetobacter species from three Korean hospitals.

MATERIALS AND METHODS

Bacterial strains and species identification

A total of 65 non-baumannii Acinetobacter isolates collected in the Kyungpook National University Hospital-National Culture Collection for Pathogens (KNUH-NCCP), Gyeongsang National University Hospital-NCCP (GNUH-NCCP), and Jeonbuk National University Hospital-NCCP (JNUH-NCCP) between 2017 and 2020 were used in this study. Species was initially identified by the VITEK 2 system (bioMérieux, Marcy-l’Étoile, France), and then identified to each Acinetobacter species by the matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectrometry analysis (Bruker Daltonics, Bremen, Germany) and sequencing of the 16S rDNA and rpoB genes (19).

Antimicrobial susceptibility testing

The minimum inhibitory concentrations (MICs) of non-baumannii Acinetobacter isolates was determined using the broth microdilution method according to the guidelines of the Clinical and Laboratory Standards Institute (20). Fifteen antimicrobial agents were used in this study: aminoglycosides (amikacin, gentamicin, and tobramycin), antipseudomonal penicillins (piperacillin), penicillins/β-lactamase inhibitors (ampicillin/sulbactam, piperacillin/tazobactam, ticarcillin/clavulanic acid), carbapenems (imipenem and meropenem), cephalosporins (ceftazidime), folic acid pathway inhibitors (trimethoprim/ sulfamethoxazole), fluoroquinolones (ciprofloxacin), tetracycline derivatives (minocycline and tigecycline), and polymyxins (colistin). Escherichia coli ATCC 25922 and Pseudomonas aeruginosa ATCC 27853 were used as quality control strains. The susceptibility to tigecycline was determined by the criteria of the US Food and Drug Administration for Enterobacteriaceae (21). The MDR or extensively-drug resistant (XDR) phenotypes were determined according to the criteria proposed by Magiorakos et al (22).

Screening of carbapenemase production and amplification of resistance genes

The production of carbapenemases in carbapenem resistant non-baumannii Acinetobacter isolates was determined using the Rapidec Carba NP test (bioMérieux) (23). Polymerase chain reaction was conducted to detect carbapenem resistance determinants. DNA templates were prepared by boiling of bacteria for 10 min after bacteria were grown in lysogeny broth (LB) overnight. To detect carbapenemase genes in the Rapidec Carba NP test-positive bacterial isolates, primers specific for blaIMP, blaNDM, blaVIM, blaOXA-23-like, blaOXA-58, blaOXA-211, and blaOXA-213 were used (Table 1) (24, 25, 26, 27, 28, 29). The full lengths of blaOXA, blaNDM, and blaVIM genes were amplified and sequenced to identify the subtypes of genes.
Table 1.

Primers used in this study

Primers Sequence (5' to 3') Genes Use References
blaIMP-F GAATAGRRTGGCTTAAYTCTC blaIMP Detection (24)
blaIMP-R CCAAACYACTASGTTATC
blaNDM-F TTGGCCTTGCTGTCCTTG blaNDM Detection (25)
blaNDM-R ACACCAGTGACAATATCACCG
blaSPM-F CTGCTTGGATTCATGGGCGC blaSPM Detection (26)
blaSPM-R CCTTTTCCGCGACCTTGATC
blaVIM-F GTTTGGTCGCATATCGCAAC blaVIM Detection (26)
blaVIM-R AATGCGCAGCACCAGGATAG
blaoxa-48-F TTGGTGGCATCGATTATCGG blaoxa-48 Detection (26)
blaoxa-48-R GAGCACTTCTTTTGTGATGGC
blaoxa-58-F CGATCAGAATGTTCAAGCGC blaoxa-58 Detection (26)
blaoxa58-R ACGATTCTCCCCTCTGCGC
blaoxa-23-F ATGAATAAATATTTTACTTGCTATG blaoxa-23-like Detection This study
blaoxa-23-R TTAAATAATATTCAGCTGTT
blaoxa-211-F ATGAAAAATTTACAGTTGGGCC blaoxa-211-like Detection This study
blaoxa-211-R TTAAATTATCCCCAGTGCTG
blaoxa-213-F ATGACTAAAAAAGCTCTTTTCTTTGC blaoxa-213-like Detection This study
blaoxa-213-R TTATAAAATACCTAGCTGCTCTAATCC
ISAba1-F AAGCACTTGATGGGCAAGGC ISAba1 Detection (27)
blaOXA-23 r CGGGATCCCGTTAAATAATATTCAGGTC
ISAba3-F CAATCAAATGTCCAACCTGC ISAba3 Amplification This study
blaOXA-58 r TTATAAATAATGAAAAACACC
blaNDM-Full-F GTTTTCCCAGTCACGACGTTATGGAATTGCCCAATATTATGCACCCGGTCG blaNDM-1 Amplification and sequencing (28)
blaNDM-Full-R CAGGAAACAGCTATGACCATGATCAGCGCAGCTTGTCGGCCATG
blaVIM-Full-F GTTTTCCCAGTCACGACGTTATGTTCAAACTTTTGAGTAAG blaVIM Amplification and sequencing (28, 29)
blaVIM-Full-R CAGGAAACAGCTATGACCATGACTACTCAACGACTGAGCGAT

*Underlined sequences indicate regions of universal primer that are not complementary to the templates.

RESULTS

Isolation of non-baumannii Acinetobacter isolates

Non-baumannii Acinetobacter isolates (n = 65) were collected from KNUH-NCCP (n = 19), GNUH-NCCP (n = 23), and JNUH-NCCP (n = 23) between 2017 and 2020. The isolates were from 2017 (n = 8), 2018 (n = 12), 2019 (n = 12), and 2020 (n = 33). Non-baumannii Acinetobacter isolates were obtained from sputum and respiratory tract (n = 17), urine (n = 17), blood (n = 15), pus (n = 9), body fluids (n = 4), vaginal discharge (n = 2), and skin tissue (n = 1).

Species distribution of non-baumannii Acinetobacter isolates

A total of 16 different species were identified among the 65 non-baumannii Acinetobacter isolates using the MALDI-TOF mass spectrometry and 16S rDNA and rpoB sequencing (Fig. 1). Four species, including A. ursingii (n = 16), A. junii (n = 11), A. nosocomialis (n = 9), and A. radioresistens (n = 7), were prevalent, accounting for 66% of the isolates. These four species were detected in three hospitals. Seven species, including A. calcoaceticus, Acinetobacter genomosp. 13BJ, A. indicus, A. lwoffii, A. seifertii, A. soli, and A. variabilis, were detected in each isolate.
Fig. 1

Distribution of non-baumannii Acinetobacter species in three hospitals. Sixty-five isolates were obtained from Gyeongsang National University Hospital (GNUH) (n = 23), Jeonbuk National University Hospital (JNUH) (n = 23), and Kyungpook National University Hospital (KNUH) (n = 19).

JBV_2024_v54n2_134_f001.tif

Antimicrobial susceptibility of non-baumannii Acinetobacter isolates

Sixty-five non-baumannii Acinetobacter isolates exhibited less than 30% resistance rates to all tested antimicrobial agents. Resistance to piperacillin (26.2%), ciprofloxacin (23.1%), gentamicin (23.1%), and ceftazidime (21.5%) was a relatively high, whereas no isolates were resistant to minocycline and tigecycline (Table 2). Resistance rates to the remaining nine antimicrobial agents were ranged from 6.2% (amikacin) ~ 18.5% (tobramycin and piperacillin/tazobactam). Thirty-three (50.8%) isolates were susceptible to all tested antimicrobial agents. The MDR and XDR phenotypes were identified in 11 non-baumannii Acinetobacter isolates and one A. bereziniae isolate, respectively. Twenty (30.8%) isolates were resistant to one or two antimicrobial classes.
Table 2.

Antimicrobial susceptibility of non-baumannii Acinetobacter isolates

No. of resistant isolates
Species AMK GEN TOB PIP SAM TZP TCC IPM MEM CAZ SXT CIP CL MIN TGC
A. bereziniae (n=4) 3 3 3 3 1 2 2 1 1 3 2 3 2 0 0
A. calcoaceticus (n =1) 0 1 0 1 1 1 1 1 1 1 1 1 0 0 0
Acinetobacter genomosp. 13BJ (n=1) 1 1 1 1 1 0 0 0 0 0 0 0 0 0 0
A. haemolyticus (n=3) 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0
A. indicus (n=1) 0 0 0 1 1 1 0 0 0 1 0 0 0 0 0
A. johnsonii (n=3) 0 2 2 1 0 0 0 1 1 0 0 1 1 0 0
A. junii (n=11) 0 2 1 3 1 2 2 2 2 3 1 1 2 0 0
A. lwoffii (n=1) 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
A. nosocomialis (n=9) 0 2 2 2 1 2 1 1 1 1 1 4 0 0 0
A. oleivorans (n=2) 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0
A. pitii (n=3) 0 1 1 1 0 1 1 1 1 1 0 1 0 0 0
A. radioresistens (n=7) 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
A. soli (n=1) 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0
A. seifertii (n=1) 0 1 0 1 1 1 0 0 0 0 0 0 0 0 0
A. ursingii (n=16) 0 2 1 3 1 2 2 0 0 4 1 3 0 0 0
A. variabilis (n=1) 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
Total (n=65) 4 (6.2) 15 (23.1) 12 (18.5) 17 (26.2) 8 (12.3) 12 (18.5) 9 (13.8) 7 (10.8) 7 (10.8) 14 (21.5) 8 (12.3) 15 (23.1) 6 (9.2) 0 (0) 0 (0)

Abbreviations. AMK, amikacin; GEN, gentamicin; TOB, tobramycin; PIP, piperacillin; SAM, ampicillin/sulbactam; TZP, piperacillin/Tazobactam; TCC, ticarcillin/clavulanic acid; IPM, imipenem; MEM, meropenem; FEP, cefepime; CAZ, ceftazidime; SXT, trimethoprim/sulfamethoxazole; CIP, ciprofloxacin; CL, colistin; MIN, minocycline; TGC, tigecycline.

Carbapenem resistance of non-baumannii Acinetobacter isolates

Seven non-baumannii Acinetobacter isolates, including A. bereziniae (n = 1), A. calcoaceticus (n = 1), A. johnsonii (n = 1), A. junii (n = 2), A. nosocomialis (n = 1), and A. pittii (n = 1), were resistant to imipenem and meropenem. The Rapidec Carba NP test revealed that all seven isolates produced carbapenemases. A total of six different carbapenemase genes were detected in seven non-baumannii Acinetobacter isolates: blaOXA-23, blaOXA-58, blaOXA-211, and blaOXA-213 for class D oxacillinases genes and blaNDM-1 and blaVIM-2 for class B MBL genes (Table 3). A. calcoaceticus isolate carried three different carbapenemase genes, blaOXA-58, blaOXA-213, and blaNDM-1. A. pittii isolate carried two different carbapenemase genes, blaOXA-23, and blaOXA-213. One A. junii isolate carried two MBL genes, blaVIM-2 and blaNDM-1. blaOXA-23 and blaOXA-58 genes carried ISAba1 and ISAba3 promoters, respectively. However, A. johnsonii isolate did not carry any carbapenemase genes tested.
Table 3.

Carbapenem resistance genes identified in non-baumannii Acinetobacter isolates

Isolates blaNDM-1 blaVIM-2 blaOXA-23 blaOXA-58 blaOXA-211 blaOXA-213
A. junii KBN12P06268 + + - - - -
A. junii KBN12P06751 + - - - - -
A. nosocomialis KBN10P05825 - - + - - -
A. bereziniae KBN10P06542 - - - - + -
A. Johnsonii KBN12P06833 - - - - - -
A. pittii KBN12P06770 - - + - - +
A. calcoaceticus KBN12P07083 + - - + - +

DISCUSSION

This study characterized 65 clinical non-baumannii Acinetobacter isolates collected from the patients admitted to three hospitals located in southern part of South Korea over four years. These isolates were identified to 16 different non-baumannii Acinetobacter species using the MALDI-TOF mass spectrometry and 16S rDNA and rpoB sequencing. Of the identified non-baumannii Acinetobacter species, A. ursingii (24.6%) was the most prevalent, followed by A. junii (16.9%), A. nosocomialis (13.8%), and A. radioresistens (10.8%). These prevalent species were detected in three study hospitals and the high risk group of patients, such as patients admitted to intensive care units, might be exposed to non-baumannii Acinetobacter. A. pittii and A. nosocomialis that belonged to A. calcoaceticus-A. baumannii complex have been known to the most prevalent among non-baumannii Acinetobacter species (30, 31), but only three A. pittii isolates were detected in two hospitals. A. baumannii is the most frequently isolated from sputum or respiratory tract, but rarely isolated from urinary tract (8, (13). However, in this study, 17 of 65 non-baumannii Acinetobacter isolates were obtained from urine sample. These results suggest that non-baumannii Acinetobacter species commonly infect urinary tract as well as respiratory tract.
A half of non-baumannii Acinetobacter isolates were susceptible to all tested antimicrobial agents. Of the 32 drug-resistant isolates, 20 were resistant to one or two antimicrobial agents and 11 exhibited the MDR phenotype, which was resistant to three antimicrobial classes. Only one A. bereziniae isolate exhibited XDR phenotype, which was susceptible to minocycline and tigecycline. Resistance rates to tested antimicrobial agents did not exceed 25%. Antimicrobial resistance in non-baumannii Acinetobacter isolates from KNUH is significantly lower than A. baumannii isolates from the same hospital during the study period (13). More than 95% of A. baumannii isolates exhibited MDR and XDR phenotypes (32). These results suggest that most clinical non-baumannii Acinetobacter isolates are susceptible to commonly used antimicrobial agents, unlike clinical A. baumannii isolates.
Of the 65 non-baumannii Acinetobacter isolates, seven (10.8%) were resistant to carbapenems. blaOXA-211 and blaOXA-213 are species-specific intrinsic CHDLs for A. johnsonii and A. calcoaceticus, respectively (12). In addition, blaOXA-23 identified in A. nosocomialis and A. pittii, blaOXA-58 in A. calcoaceticus, blaVIM-2 in A. junii, and blaNDM-1 in A. junii and A. calcoaceticus were acquired carbapenemase genes. CRAB isolates from Korean hospitals exclusively carried blaOXA-23 regardless of clonal linages (13, 18), suggesting the transfer of blaOXA-23 from CRAB to A. nosocomialis and A. pittii. blaOXA-58 was not detected in Korean CRAB isolates in recent years, but this gene was detected in non-baumannii Acinetobacter species, including A. bereziniae, A. junii, A. nosocomialis, and A. pittii from other countries (33, 34, 35, 36). MBL genes such as blaIMP-1 and blaNDM-1 were also detected in non-baumannii Acinetobacter species, often in combination with class D carbapenemase genes worldwide (34, 36, 37, 38). In Korea, three MBL genes, blaIMP-1, blaNDM-1, and blaSIM-1, were detected in non-baumannii Acinetobacter isolates (10, 11, 16). blaIMP-1 was the most prevalent, followed by blaVIM-2 and blaSIM-1 in non-baumannii Acinetobacter species from 2005 to 2012 (9). However, blaIMP-1 and blaSIM-1 were not detected in this study. blaNDM-1 was detected in A. pittii isolates from Korean hospitals located in Seoul and Daejeon (10, 16). In this study, blaNDM-1 was detected in one A. calcoaceticus and two A. junii isolates. Moreover, A. junii isolate co-carried tow MBL genes, blaVIM-2 and blaNDM-1. The genetic background of carbapenem resistance in non-baumannii Acinetobacter species should be further analyzed. Because non-baumannii Acinetobacter species play a role in potential reservoir of carbapenem resistance genes (39), the spread of carbapenem resistance genes should be carefully monitored among Acinetobacter species.

AUTHOR CONTRIBUTIONS

Conceptualization, J.C.L. and S.K.; Data curation; J.C.L. and S.K.; Formal analysis, J.C.L. and S.K.; Funding acquisition, S.K.; Investigation, S.K. and M.S.R.; Methodology, S.K., M.S.R., B.K., S.-Y.K., and N.K.; Project administration, S.K. and J.C.L.; Resources, J.C.L. and D.E.L.; Supervision, J.C.L.; Visualization, S.K. and J.C.L.; Roles/Writing - original draft, S.K. and J.C.L.; and Writing - review & editing, J.C.L.

ACKNOWLEDGMENTS

This research was supported by Kyungpook National University Research Fund, 2022.

References

1. Wong D, Nielsen TB, Bonomo RA, Pantapalangkoor P, Luna B, Spellberg B. Clinical and pathophysiological overview of Acinetobacter infections: A century of challenges. Clin Microbiol Rev. 2017;30(1):409-447.DOI: 10.1128/CMR.00058-16. PMID: 27974412. PMCID: PMC5217799.
2. Antunes LC, Visca P, Towner KJ. Acinetobacter baumannii: Evolution of a global pathogen. Pathog Dis. 2014;71(3):292-301. DOI: 10.1111/2049-632X.12125. PMID: 24376225.
3. Sheck E, Romanov A, Shapovalova V, Shaidullina E, Martinovich A, Ivanchik N, et al. Acinetobacter non-baumannii species: occurrence in infections in hospitalized patients, identification, and antibiotic resistance. Antibiotics. 2023;12(8):1301.DOI: 10.3390/antibiotics12081301. PMID: 37627721. PMCID: PMC10451542.
4. Bae IK, Hong JS. The distribution of carbapenem-resistant Acinetobacter species and high prevalence of CC92 OXA-23-producing Acinetobacter baumannii in community hospitals in South Korea. Infect Drug Resist. 2024;17:1633-1641.DOI: 10.2147/IDR.S459739. PMID: 38707988. PMCID: PMC11068040.
5. Turton JF, Shah J, Ozongwu C, Pike R. Incidence of Acinetobacter species other than A. baumannii among clinical isolates of Acinetobacter: Evidence for emerging species. J Clin Microbiol. 2010;48(4):1445-1449.DOI: 10.1128/JCM.02467-09. PMID: 20181894. PMCID: PMC2849580.
6. Fitzpatrick MA, Ozer E, Bolon MK, Hauser AR. Influence of ACB complex genospecies on clinical outcomes in a U.S. hospital with high rates of multidrug resistance. J Infect. 2015;70(2):144-152.DOI: 10.1016/j.jinf.2014.09.004. PMID: 25246361. PMCID: PMC4302009.
7. Al Atrouni A, Joly-Guillou ML, Hamze M, Kempf M. Reservoirs of non-baumannii Acinetobacter species. Front Microbiol. 2016;7:49.DOI: 10.3389/fmicb.2016.00049. PMID: 26870013. PMCID: PMC4740782.
8. Lee CR, Lee JH, Park M, Park KS, Bae IK, Kim YB, et al. Biology of Acinetobacter baumannii: pathogenesis, antibiotic resistance mechanisms, and prospective treatment options. Front Cell Infect Microbiol. 2017;7:55.DOI: 10.3389/fcimb.2017.00055.
9. Tacconelli E, Carrara E, Savoldi A, Harbarth S, Mendelson M, Monnet DL, et al. Discovery, research, and development of new antibiotics: the WHO priority list of antibiotic-resistant bacteria and tuberculosis. Lancet Infect Dis. 2018; 18(3):318-327.
10. Lee Y, Kim CK, Chung HS, Yong D, Jeong SH, Lee K, et al. Increasing carbapenem-resistant Gram-negative bacilli and decreasing metallo-β-lactamase producers over eight years from Korea. Yonsei Med J. 2015;56(2):572-577.DOI: 10.3349/ymj.2015.56.2.572. PMID: 25684011. PMCID: PMC4329374.
11. Na IY, Kwon KT, Ko KS. Plasmids carrying blaVIM-2 in Acinetobacter nosocomialis and A. seifertii isolates from South Korea. Microb Drug Resist. 2021;27(9):1186-1189.DOI: 10.1089/mdr.2020.0442. PMID: 33544029.
12. Figueiredo S, Bonnin RA, Poirel L, Duranteau J, Nordmann P. Identification of the naturally occurring genes encoding carbapenem-hydrolysing oxacillinases from Acinetobacter haemolyticus, Acinetobacter johnsonii, and Acinetobacter calcoaceticus. Clin Microbiol Infect. 2012;18(9):907-913.DOI: 10.1111/j.1469-0691.2011.03708.x. PMID: 22128805.
13. Jun SH, Lee DE, Hwang HR, Kim N, Kwon KT, Kim YK, et al. Clonal evolution and antimicrobial resistance of Acinetobacter baumannii isolates from Korean hospitals over the last decade. Infect Genet Evol. 2023;108:105404.DOI: 10.1016/j.meegid.2023.105404. PMID: 36638876.
14. Jiang N, Zhang X, Zhou Y, Zhang Z, Zheng X. Whole-genome sequencing of an NDM-1- and OXA-58-producing Acinetobacter towneri isolate from hospital sewage in Sichuan Province, China. J Glob Antimicrob Resist. 2019;16:4-5.DOI: 10.1016/j.jgar.2018.11.015. PMID: 30472400.
15. Hu H, Hu Y, Pan Y, Liang H, Wang H, Wang X, et al. Novel plasmid and its variant harboring both a bla(NDM-1) gene and type IV secretion system in clinical isolates of Acinetobacter lwoffii. Antimicrob Agents Chemother. 2012;56(4):1698-1702.DOI: 10.1128/AAC.06199-11. PMID: 22290961. PMCID: PMC3318331.
16. Sung JY, Koo SH, Kim S, Kwon GC. Emergence of Acinetobacter pittii harboring New Delhi metallo-β-lactamase genes in Daejeon, Korea. Ann Lab Med. 2015;35(5):531-534.DOI: 10.3343/alm.2015.35.5.531. PMID: 26206691. PMCID: PMC4510507.
17. Park YK, Jung SI, Park KH, Kim SH, Ko KS. Characteristics of carbapenem-resistant Acinetobacter spp. other than Acinetobacter baumannii in South Korea. Int J Antimicrob Agents. 2012;39(1):81-85.DOI: 10.1016/j.ijantimicag.2011.08.006. PMID: 21996405.
18. Kang HM, Yun KW, Choi EH. Molecular epidemiology of Acinetobacter baumannii complex causing invasive infections in Korean children during 2001-2020. Ann Clin Microbiol Antimicrob. 2023;22(1):32.DOI: 10.1186/s12941-023-00581-3. PMID: 37138308. PMCID: PMC10158003.
19. Almuzara M, Barberis C, Traglia G, Famiglietti A, Ramirez MS, Vay C. Evaluation of matrix-assisted laser desorption ionization-time-of-flight mass spectrometry for species identification of Nonfermenting Gram-Negative Bacilli. J Microbiol Methods. 2015;112:24-27.DOI: 10.1016/j.mimet.2015.03.004. PMID: 25765149.
20. CLSI. Performance Standards for Antimicrobial Susceptibility Testing. 32nd ed. CLSI M100. Wayne, PA: Clinical and Laboratory Standards Institute, 2022.
21. Pfizer Inc. (Wyeth Pharmaceuticals Inc.) (2024). Tygacil® (Tigecycline). Pfizer Inc., Philadelphia, PA. Available at https://labeling.pfizer.com/ShowLabeling.aspx?id=12275 [accessed on 27 May 2024].
22. Magiorakos AP, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect. 2012;18(3):268-281.DOI: 10.1111/j.1469-0691.2011.03570.x. PMID: 21793988.
23. Poirel L, Nordmann P. Rapidec Carba NP test for rapid detection of carbapenemase producers. J Clin Microbiol. 2015;53(9):3003-3008.DOI: 10.1128/JCM.00977-15. PMID: 26085619. PMCID: PMC4540946.
24. Mendes RE, Kiyota KA, Monteiro J, Castanheira M, Andrade SS, Gales AC, et al. Rapid detection and identification of metallo-β-lactamase-encoding genes by multiplex real-time PCR assay and melt curve analysis. J Clin Microbiol. 2007;45(2):544-547.DOI: 10.1128/JCM.01728-06. PMID: 17093019. PMCID: PMC1829038.
25. Monteiro J, Widen RH, Pignatari AC, Kubasek C, Silbert S. Rapid detection of carbapenemase genes by multiplex real-time PCR. J Antimicrob Chemother. 2012;67(4):906-909.DOI: 10.1093/jac/dkr563. PMID: 22232516.
26. Rodríguez-Martínez JM, Poirel L, Nordmann P. Molecular epidemiology and mechanisms of carbapenem resistance in Pseudomonas aeruginosa. Antimicrob Agents Chemother. 2009;53(11):4783-4788.DOI: 10.1128/AAC.00574-09. PMID: 19738025. PMCID: PMC2772299.
27. Wang D, Yan D, Hou W, Zeng X, Qi Y, Chen J. Characterization of bla(OxA-23) gene regions in isolates of Acinetobacter baumannii. J Microbiol Immunol Infect. 2015;48(3):284-290.DOI: 10.1016/j.jmii.2014.01.007. PMID: 24675065.
28. Kawahara R, Watahiki M, Matsumoto Y, Uchida K, Noda M, Masuda K, et al. Subtype screening of blaIMP genes using bipartite primers for DNA sequencing. Jpn J Infect Dis. 2021;74(6):592-599.DOI: 10.7883/yoken.JJID.2020.926. PMID: 33790070.
29. Fiett J, Baraniak A, Mrówka A, Fleischer M, Drulis-Kawa Z, Naumiuk Ł, et al. Molecular epidemiology of acquired-metallo-β-lactamase-producing bacteria in Poland. Antimicrob Agents Chemother. 2006;50(3):880-886.DOI: 10.1128/AAC.50.3.880-886.2006. PMID: 16495246. PMCID: PMC1426447.
30. Al Atrouni A, Joly-Guillou ML, Hamze M, Kempf M. Reservoirs of non-baumannii Acinetobacter species. Front Microbiol. 2016;7:49.DOI: 10.3389/fmicb.2016.00049. PMID: 26870013. PMCID: PMC4740782.
31. Wisplinghoff H, Paulus T, Lugenheim M, Stefanik D, Higgins PG, Edmond MB, et al. Nosocomial bloodstream infections due to Acinetobacter baumannii, Acinetobacter pittii and Acinetobacter nosocomialis in the United States. J Infect. 2012;64(3):282-290.DOI: 10.1016/j.jinf.2011.12.008. PMID: 22209744.
32. Havenga B, Reyneke B, Ndlovu T, Khan W. Genotypic and phenotypic comparison of clinical and environmental Acinetobacter baumannii strains. Microb Pathog. 2022;172:105749.DOI: 10.1016/j.micpath.2022.105749. PMID: 36087691.
33. Fávaro LDS, de Paula-Petroli SB, Romanin P, Tavares EDR, Ribeiro RA, Hungria M, et al. Detection of OXA-58-producing Acinetobacter bereziniae in Brazil. J Glob Antimicrob Resist. 2019;19:53-55.DOI: 10.1016/j.jgar.2019.08.011. PMID: 31449966.
34. Peleg AY, Franklin C, Walters LJ, Bell JM, Spelman DW. OXA-58 and IMP-4 carbapenem-hydrolyzing beta-lactamases in an Acinetobacter junii blood culture isolate from Australia. Antimicrob Agents Chemother. 2006;50(1):399-400.DOI: 10.1128/AAC.50.1.399-400.2006. PMID: 16377723. PMCID: PMC1346810.
35. Strateva T, Sirakov I, Savov E, Mitov I. First detection of an OXA-58 carbapenemase-producing Acinetobacter nosocomialis clinical isolate in the Balkan states. J Glob Antimicrob Resist. 2018;13:123-124.DOI: 10.1016/j.jgar.2018.04.006. PMID: 29665422.
36. Ang GY, Yu CY, Cheong YM, Yin WF, Chan KG. Emergence of ST119 Acinetobacter pittii co-harbouring NDM-1 and OXA-58 in Malaysia. Int J Antimicrob Agents. 2016;47(2):168-169.DOI: 10.1016/j.ijantimicag.2015.11.008. PMID: 26742728.
37. Lee K, Kim CK, Hong SG, Choi J, Song S, Koh E, et al. Characteristics of clinical isolates of Acinetobacter genomospecies 10 carrying two different metallo-beta-lactamases. Int J Antimicrob Agents. 2010;36(3):259-263.DOI: 10.1016/j.ijantimicag.2010.05.018. PMID: 20599361.
38. Yang J, Chen Y, Jia X, Luo Y, Song Q, Zhao W, et al. Dissemination and characterization of NDM-1-producing Acinetobacter pittii in an intensive care unit in China. Clin Microbiol Infect. 2012;18(12):E506-513.DOI: 10.1111/1469-0691.12035. PMID: 23036089.
39. Lee YT, Kuo SC, Chiang MC, Yang SP, Chen CP, Chen TL, et al. Emergence of carbapenem-resistant non-baumannii species of Acinetobacter harboring a blaOXA-51-like gene that is intrinsic to A. baumannii. Antimicrob Agents Chemother 2012;56(2):1124-1127.DOI: 10.1128/AAC.00622-11. PMID: 22083478. PMCID: PMC3264228.
TOOLS
Similar articles