Succinic acid from Sigma (St. Louis, MO, USA); phloretin was supplied by Tokyo Chemical Industry Co. Ltd. (Tokyo, Japan).

LX-2 cells are known as human immortalized HSCs. LX-2 cells were maintained in a humidified 37°C incubator with 5% carbon dioxide (CO₂) and were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with fetal bovine serum (FBS; 10%) and penicillin/streptomycin (1%).

The animal research protocol was approved by the Institutional Animal Care and Use Committee of Kangwon University (KW-160601-1). Male C57BJ6 mice weighing 22 to 25 g (6 to 8 weeks old) were provided by Doo Yeol Biotech (Seoul, Korea). All mice were housed at a temperature of 22°C±1°C, with free access to water and food, on a cycle of 12/12-hour light/dark. The mice were randomly divided into three groups and treated for 16 weeks; these groups included a control group (chow diet-fed mice+intraperitoneal injection with vehicle dimethyl sulfoxide [DMSO], n=7), a sodium succinate group (2% sodium succinate mixed with chow diet+intraperitoneal injection with vehicle DMSO, n=7), and a sodium succinate+phloretin group (2% sodium succinate mixed with chow diet+intraperitoneal injection of 10 mg/kg phloretin every other day, n=5). The dose of phloretin was used in this research based on previous mice model of obesity, liver cancer, lung fibrosis, asthma [21,23-25]. After 16 weeks, mice were euthanized with CO₂ and tissue was collected and lysed for analysis.

RNeasy Plus Micro Kit (REF 74234, Qiagen, Hilden, Germany) was used to isolate total ribonucleic acid (RNA) in LX-2 cells, which was then transcribed to coding deoxyribonucleic acid (cDNA) using oligo dT (REF C110A, Promega, Madison, WI, USA) and hypescript RT master mix 601-710 (contain hyperscript reverse transcriptase, mixture deoxynucleotide triphosphates (dNTPs), reaction buffer, stabilizer, RNase inhibitor provided by GeneAll, Singapore). Subsequently, the mRNA copy number of several markers was determined using a real-time polymerase chain reaction (PCR) Quant Studio 6 Flex (Life Technologies, Carlsbad, CA, USA) system with SYBR Green. After PCR, a melting curve analysis was performed to assess the specificity of the PCR product as a single peak. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used for the normalization as a reference gene. The difference in the quantification cycle values for GAPDH and the respective gene was used to calculate the level of α-SMA, collagen 1, transforming growth factor β1 (TGFβ1), glucose transporter 1 (GLUT-1), and lactate dehydrogenase A (LDHA). Primers had the following 5’-3’ sequences: human α-SMA (forward: TTATGTAGCTCTG GACTT, reverse: CAACTCGTAACTCTTCTC), human collagen 1 (forward: AGAAGAACTGGTACATCA, reverse: CAT ACTCGAACTGGAATC), human TGFβ1 (forward: GCACTGTTGAAGTGCCTTAC, reverse: AGGAACTCCCCTTAACCT), human GLUT-1 (forward: TATGTGGAGCAACTGTGT, reverse: TGAAGTAGGTGAAGATGAAGA), human LDHA (forward: GATGATGTCTTCCTTAGTGTT, reverse: AGTCAGAGTCACCTTCAC).

Cells and liver tissues were lysed by WSE-7420 EzRIPA lysis kit (ATTA, Tokyo, Japan) containing radioimmunoprecipitation assay (RIPA) buffer, protease inhibitor and phosphatase inhibitor. Samples were run on sodium dodecyl sulfate-polyacrylamide gel electrophoresis and then use polyvinylidene difluoride membranes for electro-transferred. Samples were blocked for 1 hour in nonfat dry milk (5%) (BD, Sparks Glencoe, MD, USA) at room temperature and were subsequently immunoblotted with respective antibodies over night at 4℃. The membranes were incubated with secondary antibodies conjugated to horseradish peroxidase for 1 hour at room temperature, then use Westsave Star Detection Reagent System (Abfrontier, Seoul, Korea) to detect protein bands. The image of protein bands was taken by chemidoc imaging system (Bio Rad, Hercules, CA, USA). GAPDH was used as control for densitometric analysis of the respective bands, which was performed using image J software (National Institutes of Health, Bethesda, MD, USA). Primary antibodies included those specific for GAPDH (GTX627408, GeneTex, Irvine, CA, USA; dilution factor 1:5,000), α-SMA (ab5694, Abcam, Cambridge, UK; dilution factor 1:500), collagen type 1 (SAB 1402151, Sigma Aldrich, St. Louis, MO, USA; dilution factor 1:500), tissue inhibitor of metalloproteases 1 (TIMP-1; sc-5538, Santa Cruz Biotechnology, Santa Cruz, CA, USA; dilution factor 1:250), GLUT-1 (ab15309, Abcam; dilution factor 1:500), phosphorylated adenosine monophosphate protein kinase α (p-AMPKα; Thr172 #2535, dilution factor 1:1,000), AMPK (#2532, dilution factor 1:1,000), LDHA (C4B5 #3582, dilution factor 1:2,000), hexokinase II (HK II; C64G5 #2867, dilution factor 1:1,000), phosphorylated myosin light chain 2 (p-MLC2 T18/S19 #3674, dilution factor 1:1,000), MLC2 (D18E2 #8505, dilution factor 1:1,000), cleaved poly-adenosine diphosphate-ribose polymerase (PARP #9541, dilution factor 1:1,000), and PARP (#9542, dilution factor 1:1,000) were all obtained from Cell Signaling Technology, Danvers, MA, USA.

Liver samples of mouse were fixed in phosphate buffered formalin (10% wt/vol) for 18 to 20 hours. The tissues were embedded in paraffin wax and serial frontal sections were cut on microtome (5 μm of thickness). Paraffin sections were deparaffinized twice for 30 minutes each by xylene, hydrated by alcohol (twice for 5 minutes each with 100% ethanol and 5 minutes each with 95%, 85%, and 75% ethanol) and rinsed for 1 minute in distilled water and then stained with Masson’s trichrome or hematoxylin and eosin (H&E), then checked at 20× magnification by Olympus microscopy (Model TH4-200, Olympus, Tokyo, Japan).

Cell viability was assessed using 3-(4,5-dimethylthiazol-2-yl) -2,5-diphenyltetrazolium bromide (MTT). LX-2 cells were plated in 24-well plates (25,000 cells/well) and treated with succinate (1,600 μM) with or without phloretin (100 μM) for 24 hours. MTT (1 mg/mL) in DMEM without phenol red (Welgene, Gyeongsan, Korea) was added to each well. The plates were incubated for 4 hours at 37℃ to form formazan, which was dissolve in isopropanol before measure absorbance at 570 nm using a spectrophotometer (Spectra Max 190, Molecular Devices, San Jose, CA, USA). The number of calculated cells before treatment are used as value 100% of cell proliferation.

LX-2 cells were seeded in six-well plates at a density of 5×10⁵ cells/well in DMEM for the wound migration assay. LX-2 cells were incubated in mitomycin C (1 mg/L) for 1 hour to allow cells to reach 90% confluence. A pipette tip (200 μL, Axygen, Union City, CA, USA) was then used to scratch the injury line and the monolayers of the LX-2 cells were rinsed twice with phosphate buffered saline (1X, pH 7.4±0.1) for 10 seconds, then treated with succinate (1,600 μM) for 16 hours in the presence or absence of phloretin (100 μM) in DMEM containing 100 mL/L FBS. The image of injury lines in six-well plates was taken by Olympus microscopy (Model TH4-200, Olympus) at 0 hour, 16 hours after treatment. The widths of injury line were measure by software (cell sense standard, Olympus) and plotted against distance moved to infer cell migration.

The assay kit of collagen gel contraction was provided by Cell Biolabs Inc. (San Diego, CA, USA). The collagen gel was prepared in 24-well plates. The mixed solution of LX-2 cells (density of 1×10⁵ cells/well) and collagen working solution (500 µL) were added to respective plate, then plates were incubated at 37℃ for 1 hour to allow gelatinization. A 1,000 µL of medium was seeded on the gel and incubated overnight at 4℃. Cells were treated with succinate (1,600 μM), with or without phloretin (100 μM) for 24 hours at 37℃. A spatula was used to gently detach the gel from the plates, then the areas of the gels were measured by software (cell sense standard, Olympus).

L-lactate concentrations were quantified using a commercially available assay kit (colorimetric, ab65331, Abcam), which uses an assay protocol where lactate is oxidized by lactate dehydrogenase to form a product that produces a colored product when it interacts with a probe molecule. In particular, samples were incubated with reaction mix (lactate assay buffer, lactate enzyme mix, lactate substrate mix) for 30minutes at room temperature and then read absorbance at the wavelength 450nm by microplate reader (Spectra Max 190).

A commercially available assay kit was used to quantify triglyceride levels (AM 157S-K, Asan Pharmaceutical, Seoul, Korea). In this assay, triglycerides are converted to free fatty acids and glycerol, which is then oxidized to form a product that reacts with a probe to produce a colored product whose concentration can be determined by spectrophotometry. In particular, samples were incubated with enzyme mix at 37℃ for 10 minutes before measured absorbance at a wavelength of 550 nm using microplate reader (Spectra Max 190).

Alanine transaminase (ALT) activity was assayed using a commercially available kit (AM 102, Asan Pharmaceutical). ALT catalyzes the reaction between alanine and α-ketoglutaric acid to produce pyruvic acid and glutamate. Pyruvic acid levels were detected by a reaction that converts a nearly colorless probe to a colored product, and ALT activity was inferred by measuring absorbances at 505 nm using a spectrophotometer (Spectra Max 190).

LX-2 cells were seeded into XF24 cell culture microplates (Seahorse Bioscience, North Billerica, MA, USA) and treated with succinate 1,600 or 400 μM with or without phloretin (50 and 100 μM), and 24 hours later, extracellular acidification rates (ECARs) were quantified using Agilent Seahorse XF analyzer according to the manufacturer’s protocol. For glycolysis assessments, the XF Glycolysis Stress Test Kit was used according to the manufacturer’s protocol.

All data were collected from at least three independent experiments. Results are expressed as means±standard error of the mean. Statistical significance in between the experiments was determined by comparing two groups using two-tailed Student’s t test. Statistical analyses were performed using Microsoft Excel (Microsoft, Redmond, WA, USA) and P values <0.05 were deemed statistically significant.

The mRNA data showed that phloretin 100 μM ameliorated significantly succinate-induced increase of fibrogenic markers compared to control (Fig. 1A). However, phloretin 50 μM didn’t show significant decrease of mRNA expression of α-SMA, collagen type I, and TGFβ1 compared to control. Succinate stimulation led to a significant increase in LX-2 cell activation, as indicated by higher levels of TGFβ1, α-SMA, and collagen type I proteins (Fig. 1B). However, when phloretin 100 μM was co-treated with succinate, it resulted in the inhibition of fibrotic protein expression more significantly compared to control (Fig. 1B).

Furthermore, succinate treatment markedly increased the viability of HSCs after 24 hours, while reducing the levels of cleaved PARP, an apoptotic marker, in treated groups (Fig. 1C, D). On the other hand, phloretin was found to decrease the number of activated HSCs by increasing apoptosis of HSCs (Fig. 1D). These findings suggest that phloretin may have the potential to block HSC activation.

Co-treatment with phloretin inhibited cell migration caused by succinate in LX-2 cells for 16 hours (Fig. 2A), suggesting that phloretin can inhibit cell migration processes in activated HSCs. After 24 hours of incubation, treatment of succinate reduced the collagen gel area compared to untreated LX-2 cells, whereas co-treatment with phloretin attenuated this reduction in collagen gel area (Fig. 2B). Moreover, Western blot results showed that TIMP-1 and p-MLC2 expression increased following succinate (Fig. 2C), which was attenuated by co-treatment with phloretin. Altogether, these results suggest that phloretin might inhibit the migration and contractility of activated HSCs.

In Fig. 3A, it was observed that the treatment of LX-2 cells with succinate resulted in an increase in mRNA expression of GLUT-1 and LDHA. However, co-treatment with phloretin showed that only phloretin at 100 μM inhibited the increased mRNA expression of GLUT-1 and LDHA proteins induced by succinate treatment. Phloretin at 100 μM inhibited the increased protein expression of GLUT1, HK II, and LDHA (Fig. 3B). In addition, treatment of LX-2 cells with succinate led to a downregulation of p-AMPK, but this effect was reduced in cells co-treated with phloretin (Fig. 3C). The ECAR data indicated that treatment with 1,600 μM succinate did not significantly increase glycolysis but treatment with phloretin reduced glycolysis in LX-2 cells (data was not shown). To validate these results, the experiment was repeated using succinate at a concentration of 400 μM, which induced glycolysis in LX-2 cells, while phloretin co-treatment reduced this effect, as indicated by the ECAR data (Fig. 3D).

Mice were fed a sodium succinate diet demonstrated an increase in serum ALT and hepatic triglyceride levels, which was reduced in animals receiving intraperitoneal injections of phloretin (Fig. 4A). In addition, mice treated with phloretin showed improved hepatic steatosis, as assessed by H&E staining, and hepatic fibrosis, as assessed by Masson’s trichrome staining, when compared to mice fed a sodium succinate diet without treatment (Fig. 4B). Fig. 4C also revealed that phloretin administration reduced the expression of α-SMA and collagen type 1, which had increased after 16 weeks of sodium succinate administration. These findings suggest that phloretin administration may protect against liver damage and inhibit the development of liver fibrosis in this animal model of sodium succinate-induced liver fibrosis.

We checked the product of glycolysis, lactate, in serum and liver tissue. The results in Fig. 5A demonstrated that phloretin reduced the lactate in serum and liver. Results of Western blots of the livers of mice fed a sodium succinate diet for 16 weeks showed increased levels of GLUT-1, and LDHA compared to control mice fed normal chow; this upregulation in protein levels of GLUT-1, LDHA was attenuated by administration of phloretin for 16 weeks (Fig. 5B). These results suggest that phloretin administration might inhibit the glycolytic pathway associated with the development of liver fibrosis.