Animal experiment.

The present study was conducted at Central Experimental Laboratory of first affiliated hospital of Jiamusi University, China from April 2013 to August 2013.

A total of 80 female and 10 male Wister rats of specific pathogen free grade, aged 10-12 weeks, weighing 180-220 gm were provided by the animal experimental center of Jilin University, Changchun, China (SCXK-2011-004). The study was approved by the animal research ethic committee of Jiamusi University. All experimental procedures were performed in accordance with the guidance and suggestions for care and use of laboratory animals, published by the Ministry of Science and Technology of People's Republic of China34). Rats were maintained in temperature controlled room (21+/-2℃) on 12 hours light/dark cycle with rodent standard chow and water available ad libitum. Rats were acclimatized to their environment for 1 week before any experimental procedure.

Rats were divided into three groups : Sham surgery group (n= 15) : Rats with only laminectomy but without any SCI; Experiment control group (n=30) : Rats with acute transection SCI and treated with phosphate buffer solution (PBS) and Experimental group (n=35) : Rats with acute transection SCI and treated with BMMNCs.

Male rats were selected for isolation of BMMNCs as it has been reported that bone marrow of male rats contain more BMMNCs in comparison to female rats. Rats were anaesthetized with 10% chloral hydrate (300 mg/kg body weight) injected intraperitoneally. All the procedures were performed under strict aseptic technique. Both the femurs and tibias were extracted and epiphyses were removed. A 20 G needle was inserted intramedullary on the proximal end of each bone and flushed with 2 mL of Normal Saline mixed with 0.1% ethylenediaminetetraacetic acid (EDTA). Each bone was turned upside down and flushed again from distal end too. The collected suspension was centrifuged @1500 rpm for 10 minutes at 4℃. Supernatant was discarded and retained pellets were rinsed with 5 mL of 0.1 M PBS. The diluted PBS suspension was gently overlayed on 5 mL of Histopaque solution (Beijing Hao Yang Biological Engineering Company, Beijing, China), then subjected to density gradient centrifugation for isolation of BMMNCs, centrifuged @2000 rpm for 20 minutes at 4℃. BMMNCs layer seen as a distinct cloudy layer in about middle of solution was collected and rinsed with 5 mL of 0.1 M PBS and centrifuged again at 1000 rpm for 10 minutes at 4℃. Thus collected pellet cells were kept in Dulbecco's modified eagle medium (DMEM). Cell concentration was adjusted to 6×10⁷/dL and stored in refrigerator until transplantation (up to 3 hours). The viability of BMMNCs was assessed using tryphan blue solution and found to be more than 90%.

Rats were anaesthetized by intra-peritoneal injection of 10% Chloral hydrate (300 mg/g body weight). Under all aseptic precautions and draping, approximately 15 mm long longitudinal mid-line incision was made over T9-T11 vertebral region exposing paravertebral muscles. These muscles were dissected away bilaterally. Laminectomy at T10 was done, spinal cord exposed and transected. 15 µL cell suspension was infused in the vertebral canal at rostral and caudal segment, 1 cm from injured site, via 0.20 mm epidural catheter and Hamilton syringe for experimental group; whereas 0.1 M PBS was used instead of cell suspension for experimental control group. Catheter was left in position for 5 minutes following the completion of infusion to prevent cell leakage through the catheter track. For Sham surgery group, only laminectomy at T10 without any SCI was performed. Paravertebral muscles and skin was sutured in layers. 1 mL of Normal saline (NS) with 0.1 mL crystalline penicillin (160000 units diluted in 2 mL NS) was injected subcutaneously following surgery in order to replace the body fluid loss during surgery and as prophylaxis for any post-operative infection. During recovery from anesthesia, rats were placed on warm pad and covered with warm towel until re-establishment of thermoregulation and righting reflex. After appearance of symptoms such as tail wagging reflex and paralysis of both hind limbs, the models were considered successful. Rats were nursed and housed in a cage with water and softened rodent chow provided ad libitum. During the experiment period, rats' bladder and bowel were evacuated manually twice a day until voluntary control over function was acquired. Antibiotic was injected subcutaneously for 7 days to prevent any infection.

After a respective allotted time (i.e., 6 hours, 1 day, 3 days, 7 days, and 14 days) after SCI, rats were euthanized with a lethal dose of 10% chloral hydrate (600 mg/kg body weight) injected intra-peritoneally. For rats undergoing reverse transcription polymerase chain reaction (RT-PCR) analysis, no cardiac perfusion was done. -20 mm long spinal cord with injured/laminectomy site as an epicenter was dissected out from the body and flash frozen at -80℃. For rats undergoing immunohistochemical analysis, intra-cardiac perfusion was performed using 200 mL Normal saline to wash the blood out of the circulatory system followed by 300 mL of 4% paraformaldehyde in 0.1 M PBS (pH 7.4). About 20 mm long spinal cord segment with injured/laminectomy site as a epicenter was then dissected out and post-fixed in 0.1 M PBS containing 4% paraformaldehyde for 24 hours at 4℃ and then embedded in paraffin. Paraffin embedded spinal cord samples were cut longitudinally with a microtome, at 4 µm thick sections through full dorso-ventral dimension of cord.

All the procedures were performed at room temperature unless otherwise specified. The cut free floating sections were mounted on poly-L-amino coated slides. After deparaffinization, sections were rehydrated in a microwave oven at 85℃ for 20 minutes, then xylene I, II, 100% ethanol I, II were used for 15 minutes each respectively to clean sections. 3% H₂O₂ was used for 10 minutes to quench endogenous peroxidase. Descending concentrations (95%, 90%, 80%, and 70%) of ethanol were used for 10 minutes respectively for dehydration. Sections were then rinsed two times in distilled water for 5 minutes each, 0.01 mol/L citrate buffer solution (pH 6.0) was added and microwaved in 'medium high' heat for 5 minutes and 'medium low' heat for 15 minutes, allowed to cool to room temperature and again rinsed 3 times in 0.1 M PBS for 5 minutes each. Incubation with 5% bovine serum albumin (BSA) blocking solution was done for 20 minutes to block non-specific binding. Sections were incubated overnight at 4℃ refrigerator after adding primary antibody mouse-anti-rat NF-κB P65 monoclonal antibody (1 : 100; Boster, Wuhan, China). Activated P65 in a NF-κB dimer is exclusively identified by this antibody. Sections were again rinsed 3 times in 0.1 M PBS for 5 minutes each, incubated with secondary antibody anti-mouse IgM (Boster, Wuhan, China) for 15-20 minutes, rinsed 3 times in 0.1 M PBS for 5 minutes each, strept avidin biotin complex added and incubated at 37℃ for 30 minutes, rinsed 4 times in 0.1 M PBS for 5 minutes each. Diaminobenzidine was applied for 3-5 minutes until brown colored reaction product was observed. After rinsing sections in distilled water 3 more times, they were counterstained with hematoxylin for 10 seconds, rinsed 3 times in distilled water, dehydrated with ascending concentration (i.e., 70%, 80%, 90%, 95%, and 100%) of ethanol for 10 minutes each, cleaned, mounted and then cover-slipped for immunohistochemical study. Analysis of equivalent regions for each section was done to analyze immunohistochemical marker qualitatively and quantitatively.

Each section was first examined under 100× magnifications to detect the highest positively expressed cells within the sections. Then 5 highly positive expressed visual fields were selected and observed under 400× magnifications. Analysis of the images was done using Image-Pro-Plus 6.0 software (Media Cybernetics, Bethesda, MD, USA). Total number of positive cells in each slide was calculated.

The level of NF-κB messenger RNA expression was determined by RT-PCR. Total RNA from rat's spinal cord was extracted using RNAiso plus (TaKaRa, Dalian, China) according to manufacturer's instructions. All the samples were treated with RNase free DNase-I (TaKaRa, Dalian, China) to confirm that all RNA samples were DNA free. RNA samples were quantified spectrophotometrically by measuring the absorbance at 260 nm and 280 nm. Following manufacturer's instruction, first strand of complentary DNA (cDNA) was synthesized by reverse transcribing 1 µL of total RNA into each 20 µL reaction volume using oligo DT-Adaptor primer and AMV Reverse Transcriptase (TaKaRa, Dalian, China). First strand cDNA (1 µL) was amplified in 10 µL PCR reaction volume containing 0.05 µL TaKaRa Ex Taq™ HS (Takara, Dalian, China), and 0.1 µL NF-κB primers, Forward 5' GGCAGCACTCCTTATCAA 3' Reverse 5' TGTCGTCCCAT CGTAGGT 3', GADPH primers, Forward 5' ACAGCAACAGG GTGGTGGAC 3' Reverse 5' TTTGAGGGTGCAGCGAACTT 3'. Samples were subjected to 104℃ for 5 minutes, 40 cycles each of 30 seconds at 94℃, 30 seconds at 54℃ and 30 seconds at 72℃ and 1 cycle of 10 minutes at 72℃ thermo cycler. PCR reactions lacking primers or reverse transcriptase were taken as negative controls. The specificity of the amplified RT-PCR product was confirmed on agarose gel electrophoresis. Each RT-PCR product was observed on 2% agarose gel containing 0.5 µg/mL ethidium bromide under ultraviolet light. Image J program (National Institute of Health, Bethesda, MD, USA) was used for quantification of band intensities.

Statistical analysis was performed using statistical program SPSS 20.0 software (SPSS, Chicago, IL, USA). All the data are presented as mean±SD values. For statistical analysis of results of behavioral analysis, immunohistochemical and RT-PCR analysis Kruskal-Wallis analysis of variance followed by Mann-Whitney U test for comparing multiple data from different groups were used. A p value <0.05 is considered to be significant statistically.

Diaminobenzidine immunohistochemistry was used for investigating cells positive for activated NF-κB in spinal cord at various time points (6 hours, 1 day, 3 days, 7 days, and 14 days) after SCI. Total NF-κB P65 positive cells were calculated. Few NF-κB P65 positive cells were detected in sham-surgery group at various time point after SCI. Significant increase in number of NF-κB P65 positive cells was exhibited in rats' spinal cord of experimental control group in comparison to that of sham surgery group (p<0.05), Significant reduction in the number of activated NF-κB P65 positively expressed cells were exhibited in rats' spinal cord of experimental group when compared to experimental control group (p<0.05). NF-κB P65 positive cells were detected in the control group at 6 hours and its expression was highest at 1 day after SCI and then kept on decreasing till 14 days after SCI (Fig. 1). At 6 hours after SCI, immunoreactivity of NF-κB was seen primarily within and adjacent to the transected margin, with almost negligible or little beyond this region. At 1 day and 3 days after SCI, immunoreactivity of NF-κB was seen through-out whole length of the spinal cord section (Fig. 2).

Confirmation of results of immunohistochemical examination and analysis of NF-κB expression at mRNA level at various time points after SCI in each group was done by RT-PCR. A basal level of NF-κB mRNA was detected in spinal cord from sham surgery group, where as NF-κB level was significantly increased in control group. BMMNCs transplanted model had less NF-κB mRNA expression in comparison to control group (p value<0.05) (Fig. 3). The amplified bands showed their predicted sizes : NF-κB 247 bp (Fig. 4A) and GADPH 252 bp (Fig. 4B).

All rats had normal limb function and obtained a BBB score of 21 before SCI. There was no locomotor dysfunction in rats from sham surgery group and obtained a score of 21 through-out the study. Serious hind limb locomotor dysfunction (complete paralysis) was detected in rats from experiment group and experiment control group in comparison to sham surgery group (p<0.05) at 1 day, 1 week, and 2 weeks post SCI. Rats from experimental group showed movement of 3 joints of hind limbs at 5th week after SCI (Fig. 5). This shows that BMMNCs treatment has a significant role in locomotor function recovery in comparison to vehicle treatment.

All the rats before SCI had normal bladder function. All rats from sham surgery group showed normal urinary bladder function through-out the study period. All rats from both group (experiment and experiment control) had severe urinary bladder dysfunction till 1 week after SCI. Earliest improvement in urinary bladder function was detected at 10th day after SCI in rats from experiment group. Rats from experiment group have significantly higher urinary bladder function in comparison to experiment control group (p<0.05). This signifies the role of BMMNCs in the recovery of urinary bladder function in comparison to vehicle treatment (Fig. 6).