Sheep kidney cells (SKCs) were isolated from Chinese Merino fetuses (∼45 d) that were derived from a livestock slaughterhouse in Shihezi City (China) and cultured in Dulbecco’s modified Eagle medium (DMEM; Gibco) supplemented with 10% fetal bovine serum (FBS; Gibco), 1% non-essential amino acids (NEAA; Gibco), penicillin-streptomycin (100×, Coolaber, China), and 100 μg/ml Primocin (Invitrogen). ICR mouse embryonic fibroblasts (MEFs; Cyagen, China) were treated with mitomycin C (Sigma) as feeder layers and cultured in SKC medium without Primocin. Sheep iPSCs were cultured on inactivated ICR MEFs in DMEM/F12 medium (Gibco) supplemented with 20% KnockOut Serum Replacement (Gibco), 1% NEAA, 1% GlutaMAX (Gibco), 0.1 mM β-mercaptoethanol (Sigma), 4 ng/ml basic fibroblast growth factor (bFGF; Peprotech), 1 μg/ml doxycycline hyclate (DOX; Sigma), 50 μg/ml vitamin C (Vc; Sigma), and 1 mM valproic acid (VPA; Sigma). Embryoid body (EB) formation medium (Cyagen, China) was composed of 440 ml basal medium, 50 ml fetal bovine serum, 5 ml NEAA, 500 μl 2-mercaptoethanol, 5 ml L-glutamine, and 5 ml penicillin-streptomycin.

Eight lentiviral vectors containing human defined transcription factors (lv-ef1a-egfp-tre-Oct4/Sox2/Klf4/c-Myc/Nanog/Lin28/hTERT/SV40LT), Tet-on vector lv-EF1a-rtTA-IRES-GFP, and two helper plasmids (pVSVG and Δ8.91) were kindly provided by Prof. Lei Xiao (4). The lentiviral vector plenti 4.1 Ex miR200c-141 (#35534) and helper plasmids pSPAX2 (#12260) and pMD2.G (#12259) were provided by addgene. Ten lentiviruses were packaged in HEK293FT cells (Cell Bank, Chinese Academy of Sciences) using the calcium phosphate method according to the high efficiency transfection kit instructions (Biowit, China). The dosage of plasmids was 12 μg of the transcription factor/or Tet-on vector, plus 4 μg pVSVG and 8 μg Δ8.91 per 10-cm culture plate, and 12 μg plenti 4.1 Ex miR200c-141, 9 μg pSPAX2, and 3.5 μg pMD2.G. All lentiviruses were concentrated with 100 NMWL Amicon Ultra-15 (Millipore, USA; 6,000 g, 30 min) and titrated with a series of dilutions by infecting HET293FT cells.

We plated 50,000 SKCs (P3) per well into a six-well plate and infected these with lentivirus at 10 multiplicity of infections (MOI=10) in the presence of polybrene (final concentration 8 μg/ml) (6). The reprogramming process was divided into two groups: group A with 8 factors (Oct4/Sox2/Klf4/c-Myc/Nanog/Lin28/hTERT/SV40LT) and group B with 8 factors＋miR200c-141. Fresh SKC medium was replaced 24 h post-infection. The infection effect was evaluated under inverted fluorescence microscope 48 h post-infection. SKCs were digested with TryPLE (Gibco, USA) and inoculated into 6-well plates coated with MEF feeder layer cells for further culture after 48 h post-infection. Reprogrammed cells were digested by TrypLE and were passaged in a 6-well plate with feeder layer cells in a ratio of 1：8 for further culture on D10 post-infection. On D16 post-infection, the typical colonies with clear boundaries and protrusions were picked out with glass needles, sub-cultured into 96-well plates, and then expanded in culture. The remaining positive colonies were counted using alkaline phosphatase (AP) staining. Reprogramming efficiency=(Number of alkaline phosphatase (AP)-positive colonies/Number of initially infected cells)×100%.

An AP kit (Beyotime, China) was used for preliminary identification of siPSCs by AP staining. The steps were as follows: the cells were fixed with 4% paraformaldehyde (PFA) for 10 min, followed by the addition of BCIP/NBT staining solution (400 μl per well). The cells were stained at room temperature for 1 h or longer in the dark, and staining intensity was assessed under an inverted microscope.

The siPSCs were identified after typical colony formation. The differentiation ability of EB was measured on the 7th day in a 24-well cell culture plate. Cells were fixed with 4% paraformaldehyde for 20 min, permeabilized with 0.2% Triton X-100 for 10 min, and then blocked with 2% BSA for 30 min at room temperature. The primary antibodies against Sox2 (1：200, Abcam), Oct-3/4 (1：100, Santa Cruz), Nanog (1：100, Santa Cruz), Rex-1 (1：100, Santa Cruz), SSEA-1 (1：20, Developmental Studies Hybridoma Bank), E-cadherin (1：100, BD), Tra-1-60 (1：200, Millipore), Tra-1-81 (1：200, Millipore), smooth muscle actin (SMA, 1：200, Santa Cruz), β-tubulin (Tuj-1, 1：100, Santa Cruz), and human Sox17 (Sox17, 1：100, R&D) were added and incubated overnight at 4℃. Cy3-labeled anti-mouse IgG (1：500, Beyotime, China) and anti-mouse IgM (1：500, Bioss, China) secondary antibodies were added for 1 h at 37℃ for detection of target proteins. Nuclei were stained with DAPI (1：1,000, Sigma) for 5 min.

The cells were lysed with TRlzol reagent (Life, USA). Total RNA was extracted using an Ultrapure RNA Kit (Cwbio, China), and RNA concentration was determined using a Nano-Drop 200c system (Thermo, USA). RNA was reverse-transcribed into a cDNA using PrimeScript^TM RT reagent kit (Takara, China). Finally, the cDNA was amplified using a 2×SYBR Green I Master Kit (Roche, Switzerland) on a Roche LightCycler 480 instrument. Relative mRNA expression levels were analyzed by the 2^−ΔΔCt method; −ΔΔCt (Treatment−Control)=(Ct_{Target gene}−Ct_Gapdh) _Treatment−(Ct_{Target gene}−Ct_Gapdh) _Control (19). The PCR primers and profile used to analyze the pluripotent gene of siPSCs were as previously reported (4). Primary SKCs were used as negative control, and GAPDH was employed as internal reference gene. The relative expression levels of zinc finger E-box-binding homeobox 1 (ZEB1) and E-cadherin mRNA were also determined by quantitative real-time PCR (qRT-PCR). The primer sequences were as follows: ZEB1-F 5’-ACTGCAGTCATCTACCCCG A-3’, ZEB1-R 5’-CGCTCAAGC TGGGTTCTGTA-3’; E-Cadherin-F 5’-T GGAACTCAGACGGAAGTGC-3’, E-Cadherin-R 5’-TCT GGACCAGCGACTTAGGA-3’; and GAPDH-F 5’-ACGGG AAGCTCACTGGCATGG-3’, GAPDH-R 5’-GCCAGCCC CAGCATCGAAG-3’. Briefly, SKC cells were passaged into 12-well plates. When cell confluency was about 70%, oar-miR-200c mimics/or inhibitor/or NC (20 nM) at 2.5 μl/well was transfected into cells using Lipofectamine 2000 (Thermo, USA). At 48 h after transfection, RNA was extracted for analysis. The PCR reaction was performed at 95℃ for 5 min; followed by 40 cycles of 95℃ for 30 s, 62℃ for 30 s, and 72℃ for 30 s; and a final elongation at 72℃ for 5 min. SKCs without miRNA transfection were used as negative control. miRNA mimics/inhibitors/NC was synthesized (GenePharma, China). The sequences of the oar-miR-200c mimics were as follows: 5’-UAAUAC UGCCGGGUAAUGAUGG-3’ (sense), 5’-AUCAUUACCC GGCAGUAUUAU U-3’ (antisense); oar-miR-200c inhibitors: CCAUCAUUACCCGGCAGUAUUA; and negative control (NC): 5’-UUCUCCGAACGUG UCACGUTT-3’ (sense), 5’-ACGUGACACG UUCGGAGAATT-3’ (antisense).

Embryoid body (EB) formation: 50,000 siPSC/ml was cultured using the pendant drops method for 2 d, then transferred to a bacterial culture dish for further suspension culture for 7 d (4). Specific gene transcription markers in the endoderm (Foxa2), mesoderm (Actc1), and ectoderm (Neurod) were analyzed by PCR (4). EBs were transferred into a 24-well cell culture plate coated with 0.1% gelatin and further cultured for 7 d, and the specific gene markers of differentiation of endoderm (SOX17), mesoderm (SMA), and ectoderm (TUJ-1) were analyzed by immunofluorescence.

Total DNA was extracted using the genomic DNA extraction kit (Tiangen, China) and then methylated using an EZ DNA Methylation Gold Kit (Zymo Research, USA). After PCR amplification, DNA fragments were linked to pMD18-T (TaKaRa, China), and the methylation level of CpG islands in the Nanog promoter region was analyzed by sequencing as previously described (4).

Briefly, the siPSCs after 10 generations were treated with 0.2 μg/ml colchicine (Sigma, USA) for 2 h. After TryPLE digestion, 0.075 M KCl solution was added and kept at 37℃ for 20 min, then the siPSCs were collected by centrifugation and fixed in methanol：glacial acetic acid (3：1). Fixation was repeated, then the cells were placed in an ice bath for 20 min. The cells were collected by centrifugation, dropped onto the precooled slides, and then stained with Giemsa for 15 min. Chromosome karyotype images were observed under a microscope.

The 3’UTR of ZEB1 was PCR-amplified from cDNA derived from SKC. PCR primers used to amplify the Zeb1 3’UTR included 5’-CGAGCTCTTGATTAGATGAGCACC TGAC-3’ (forward) and 5’-CCCTCGAG TGTTCTACAGT CCAAGGCAAG-3’ (reverse), with restriction sites SacI and XhoI on both ends. The PCR conditions were as follows: 94℃ for 5 min; followed by 35 cycles of 94℃ for 40 s, 55℃ for 30 s, and 72℃ 1 min; and a final extension at 72℃ for 10 min. Six binding sites between oar-miR-200c and ZEB1 3’UTR were mutated to contain SacI and XhoI restriction sites at both ends, which was synthesized (Sangon Biotech, China). The amplified 3’UTR and 3’UTR mutation were cloned into the double-luciferase reporter gene vector pmirGLO (Promega, USA). HEK293FT cells were seeded into 96-well plates. And when the cells reached 70% confluency, 100 ng pmiRGLO-ZEB1-3’UTR/or mutation plasmid and 0.3 μl miR-200c mimics/or inhibitor/or NC (20 nM) were co-transfected using Lipofec-tamine 2000. The experiment was divided into six groups and performed in triplicate in each group. At 48 h after transfection, the cells were treated according to the Dual-Luciferase^Ⓡ Reporter Assay Kit (Promega, USA), and luciferase activity was measured using a BioTek instrument. Relative fluorescence activity was calculated as follows: Relative fluorescence activity=(Firefly luciferase activity/Renilla luciferase activity)_EG/(Firefly luciferase activity/Renilla luciferase activity)_CG.

SKCs were transfected with oar-miR-200c mimics (or inhibitor) and collected 48 h later. After treating with protein lysate (RIPA：PMSF=100：1), the supernatant was collected by centrifugation at 12,000 g for 5 min at 4℃. Total protein content was determined by a BCA protein assay kit (Beyotime, China). Approximately 30 μg of extracted protein with loading buffer was loaded into wells of a 12% sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE) for electrophoresis and then transferred to a nitrocellulose (NC) membrane (Millipore, USA). After blocking, the membranes were treated with anti-ZEB1 (1：3,000, Abcam), anti-β-actin (1：5,000, Abcam), and anti-E-cadherin (1：2,500, BD Biosciences) antibodies and incubated overnight at 4℃. Then, the membranes were treated with horseradish peroxidase-conjugated secondary antibody (Bioworld, China) for 1 h at 37℃. The protein bands were visualized using a gel imager (Bio-Rad, USA).

Statistical analysis was performed using GraphPad Prism8. Paired sample t-tests were used to compare differences between and among groups. Values of *p<0.05 and **p<0.01 were considered significant and highly significant, respectively.

SKCs were infected with 8 defined factors and miR-200c-141 lentivirus at an MOI=10 in the presence of polybrene, then were digested by TryPLE at 2 d and 10 d post-infection and passaged in a feed-coated six-well plate for further culture using siPSC medium (Fig. 1A). The experiment showed that the lentivirus system driven by Tet-on carrying Oct4, Sox2, c-Myc, Klf4, Nanog, Lin28, hTERT and SV40LT could reprogram sheep somatic cells into pluripotent cells (Fig. 1B and 1E). Lentivirus-infected cells expressed high levels of green fluorescent protein (GFP) at 48 h post-infection in group B (Fig. 2A). Numerous circular protrusion colonies with large nucleocytoplasmic ratio and clear boundaries were observed at 16 d post-infection (Fig. 2B and 2C). Typical colonies were picked and placed into 96-well plates for 5 min with TrypLE. Then, the cells were transferred to a new 96-well plate coated with MEF feeder for further expansion at D16.

AP staining was performed on the remaining colonies in 6-well plate to count the number and calculate the reprogramming efficiency of sheep somatic cells. AP-positive siPSC colonies were dark purple (Fig. 1B∼D). Approximately 476 AP-positive colonies were derived from 50,000 SKCs infected with a cocktail of lentiviruses (8 defined factors and miR-200c-141 lentivirus), which was 16-fold more than the 8 defined factors in the lentiviral treatment group (Fig. 1B, 1C, and 1E). In addition, the reprogramming efficiency of miR-200c-141 with defined factors was about 0.95% (476/50,000), which highly significantly (p<0.01) improved the generation efficiency of siPSCs compared to the single defined factors group (Fig. 1E).

The transcription and expression of pluripotency factors in sheep iPSCs derived from miR-200c-141 and 8 factors were detected. Sheep iPSC colonies were stained with AP, and most of these were purplish black under a microscope after 0.5∼1 h (Fig. 1D). The experiment results showed that the sheep iPSCs had high-expressed AP, which preliminarily verified the ESC-like characterization of siPSCs. Immunofluorescence revealed that sheep iPSCs expressed pluripotent protein markers similar to ESCs, including OCT4, NANOG, SOX2, REX1, E-cadherin, SSEA-1, TRA1-60, and TRA1-81 (Fig. 2D). Two siPSCs were selected, and the mRNA relative expression levels of endogenous specific pluripotent factors were detected by qRT-PCR. The results showed that the ESC-like endogenous marker genes, including Tdgf1, Eras, Dax1, Dnmt3b, Dppa4, Gdf3, Oct4, Sox2, and Nanog, were all activated in siPSCs, and the mRNA relative expression of these genes was highly significant compared with the primary SKCs (p<0.01) (Fig. 3).

To examine whether siPSCs could differentiate into cell types of the three germ layers in vitro, the siPSCs were cultured with the pendant drops method for 2 d, then transferred to bacterial culture dish for further suspension culture. After 7∼8 days, spherical suspended EB was formed, which was bright and compact, and some EB showed aggregation and adhesion (Fig. 4A). Total RNA of the EBs was extracted and reverse-transcribed into cDNA. Expression of specific genes in the ectodermal (Neurod, 220 bp), mesodermal (Actc1, 237 bp), and endodermal (Foxa2, 254 bp) was detected by PCR. The results showed that all three germ layer markers were transcribed in the EB derived from miR-200c-141 siPSCs (Fig. 4B). Next, the ability of siPSCs to differentiate into three germ layers was assessed at the protein level by immuno-fluorescence. The results showed that the specific protein markers that were expressed in the ectoderm (TUJ-1), mesoderm (SMA), and endoderm (SOX17) were expressed after EB differentiation (Fig. 4C). These results indicated that siPSCs had the ability to differentiate into three germ layers in vitro.

The methylation of CpG islands in the Nanog-specific promoter region (5,000-bp before the initial expression of ATG) in sheep iPSCs was assessed by bisulfite genomic sequencing (BSP) (4). The results showed that many sites of CpG in the Nanog promoter of siPSC were demethylated compared with the initial SKCs (Fig. 4E), indicating that the Nanog gene was in an open and active state and indirectly indicating that SKC was effectively reprogra-mmed. In addition, siPSCs with more than 10 generations were selected for karyotype analysis. The results showed that the karyotypes of 34 siPSCs were analyzed, and 28 were normal with 54 chromosomes, indicating that the cell karyotypes could be maintained continuously during induction (Fig. 4D).

Cluster miR-200c-141 contains two miRNAs, namely, miR-200c and miR-141. The seed sequences of miR-200c and miR-141 in sheep were AAUACUG and AACACUG, respectively, with only one base difference, and its target sites may be the same. Therefore, this study focused on the target genes of oar-miR-200c to elucidate the mechanism of miR-200c-141 promoting SKC reprogramming efficiency. The target genes of oar-miR-200c were predicted by the miRbase (www.mirbase.org) and Target Scan (www.targetscan.org) bioinformatics platforms. According to the sequence matching and score of miR-200c and target genes, as well as the signal pathway analysis of target genes, the ZEB1 gene was finally determined and verified.

Total RNA of the SKCs was extracted and reverse-transcribed into cDNA. There are six binding sites between miR-200c and ZEB1 3’UTR. The interaction sequence between miR-200c and ZEB1 3’UTR was amplified by PCR. Mutation interaction sites were designed to form ZEB1 3’UTR mutation sequence (Fig. 5A). ZEB1-3’UTR and ZEB1-3’UTR mutation were linked to dual-luciferase reporter plasmids pmiRGLO, and the sequences were correct as determined by enzyme digestion and sequencing (data not shown). Relative luciferase activity significantly decreased after co-transfection of oar-miR-200c mimics and pmiRGLO-ZEB1-3’UTR plasmids (p<0.01), while it was not significantly changed after co-transfection of oar-miR-200c mimics and pmiRGLO-ZEB1-3’UTR-mutation plasmids (Fig. 5B), indicating that oar-miR-200c mimics directly targeted the 3’UTR of MET-related gene ZEB1.

To further verify whether miR-200c targeted ZEB1 gene, we transfected oar-miR-200c mimics, oar-miR-200c inhibitor, and NC into SKCs. Then the expression level of ZEB1 was detected by qRT-PCR and western blotting. qRT-PCR results showed that oar-miR-200c mimics significantly decreased the mRNA relative level of ZEB1 (p< 0.01), whereas oar-miR-200c inhibitor transfection significantly increased the mRNA relative level of ZEB1 (p< 0.01) (Fig. 5C). Western blotting showed that oar-miR-200c mimics-transfected SKCs significantly reduced the protein expression of ZEB1, whereas oar-miR-200c inhibitor transfection significantly increased the protein expression of ZEB1 (Fig. 5D). These results confirmed that oar-miR-200c could down-regulate the expression of ZEB1 gene.

Epithelial-mesenchymal transformation (EMT) requires the upregulation of Smad-dependent critical transcription factors (including ZEB1, Snail, and Twist) in the TGF-β signaling pathway, which typically activates EMT by binding to the promoter of E-cadherin to inhibit its expression. However, overexpression of E-cadherin can promote mesenchymal-epithelial transformation (MET). Moreover, MET is an important event and marker of cell reprogramming at the initial stage. Therefore, we inferred that the decrease of ZEB1 could increase the expression of E-cadherin, and thus promoted the sheep somatic reprogramming process. Results showed that mRNA relative level (p< 0.01) and protein expression of E-cadherin were signifi-cantly increased after oar-miR-200c mimic transfection, whereas oar-miR-200c inhibitor significantly decreased the expression of E-cadherin (Fig. 5C and 5D).