Tumor tissues and the corresponding cancer-adjacent normal tissues of 100 bladder cancer patients were collected during surgery and stored in liquid nitrogen. All of these patients were diagnosed with bladder cancer for the first time in our hospital from April 2017 to January 2020. All patients had no previous history of cancer-related treatment. The range of patients' age was 45–75 years old with an average age of (58.3 ± 11.7) years old. Among the 100 bladder cancer cases, 43 cases were female and 57 cases were male. Tumor tissues were obtained from the center of the lesion, while the corresponding cancer-adjacent normal tissues were collected from tissues about 10 mm away from the lesion tissues.

This study received written informed consent by all patients and was approved by the Ethics Committee of Bengbu Medical College (approval No. 2017-008).

Immortalized bladder epithelium cells (SV-HUC-1, Cat. No.C1241) and bladder cancer cells (T24, Cat. No. HZ-H024) were obtained from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences. Both cells lines were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) containing 10% fetal bovine serum (FBS) with penicillin/streptomycin and incubated in 5% CO₂ at 37°C.

T24 cells were collected after reaching 80% confluency, dispersed in FBS-free DMEM and seeded in 6-well plates (5 × 10⁴ cells per well). The siRNAs targeting CENPU (si-CENPU) and MRPS28 (si-MRPS28), siRNA negative control targeting CENPU and MRPS28 (si-NC), pcDNA-CENPU and pcDNA-MRPS28 overexpression vector, and the pcDNA-CENPU and pcDNA-MRPS28 empty vectors, were obtained from GenePharma (Shanghai, China). The full maps of the pcDNA-CENPU and pcDNA-MRPS28 overexpression vectors were shown in Supplementary Fig. 1. After the cells reached 50% confluency, they were transfected with the aforementioned molecular transfectants using Lipofectamine 2000 (Thermo Fisher, Waltham, MA, USA). Co-transfections with the CENPU siRNA and pcDNA-MRPS28 overexpression vector and the MRPS28 siRNA and pcDNA-CENPU overexpression vector were also performed using Lipofectamine 2000 according to the manufacturer’s instructions. After 6 h, the liquid in each well was exchanged for fresh normal culture media. Cells were harvested after 48 h incubation for the subsequent studies.

Cell viability was determined using the cell counting kit-8 (CCK-8) assay. Cells dispersed in DMEM (10% FBS) were added to 96-well plates and incubated for 72 h. Each well contained 1 × 10³ cells and 100 µl DMEM (10% FBS). CCK-8 volume of 10 µl was subsequently added into each well and plates were incubated for 2 h at 37°C. The absorbance (450 nm) of each well was measured with a microplate reader (BioTek Instruments Inc., Winooski, VT, USA), using the absorbance value of 10 µl of CCK-8 without cells as a blank. Cell viability was defined as follows: (experimental group absorbance – blank absorbance) / blank absorbance value × 100%.

Cells in the logarithmic growth phase were seeded into 6-well plates by adding 1 ml of DMEM (10% FBS) cell suspension (1 × 10⁵ cells/ml). When cells reached a confluency of 80%, a scratch was made at the bottom of the wells with a sterile 200 µl pipette. The liquid in each well was removed and the remaining cells were washed twice with phosphate-buffered saline (PBS). The original scratch width was measured and marked as the scratch width at 0 h. Fresh DMEM (10% FBS) at a volume of 1 ml was subsequently added and plates were incubated at 37°C. Plates were removed from the incubator after 48 and 72 h to measure the width of the scratch using a light microscope (Olympus, Tokyo, Japan).

The Transwell migration assay was used to study the migration and invasion of cells using Transwell chambers (with or without Matrigel) (BD Biosciences, San Jose, CA, USA). Serum-free media cell suspension (1 × 10⁵ cells/ml) was added to the upper chambers (200 µl) and the lower chambers contained DMEM with 10% FBS (600 µl). After 24 h incubation, the upper layer cells were removed with a cotton swab. Lower layer cells were fixed for 20 min in 95% ethanol and stained for 10 min in crystal violet (0.1%). After washing with PBS, cells were observed by light microscopy (Olympus) and counted using 5 random, unique fields of view.

Animal experiments in this study have been approved by the Animal Ethics Committee of Bengbu Medical College (approval No. 2017-021). Seventy-two nude mice (4–5 weeks old, 20–25 g) with body masses ranging from 11–13 g were purchased from the Beijing Vital River Laboratory Animal Technology Co., Ltd., China. T24 cells for the pcDNA-NC group, pcDNA-CENPU group, and pcDNA-CENPU + si-MRPS28 group were harvested and resuspended in PBS (3 × 10⁷ cells/ml). Mice were given free access to food and water. After 2 weeks, mice were injected subcutaneously with 100 µl of cell suspension in the back. Notably, every three days, mice of each group were injected subcutaneously with 30 µg of Lipofectamine 2000-encapsulated pcDNA-CENPU empty vector, or pcDNA-CENPU overexpression vector, or pcDNA-CENPU overexpression vector and MRPS28 siRNA [18]. At 1, 2, 3, and 4 weeks after injection, 6 nude mice per group were randomly selected and sacrificed to collect tumors. The tumor volume was then measured. It should be noted that, after injection, the health and behavior of mice were monitored every 24 h. The health and behavior of mice were monitored by observing the daily diet weight, behavior, mental state, stool and urine weight and body weight.

The anesthesia and euthanasia of mice were as follows: Briefly, a total of 72 nude mice were used in this research. Before being sacrificed by cervical dislocation, mice were deeply anesthetized with an intraperitoneal injection of 60 mg/kg pentobarbital. The standard for deep anesthesia was that mice had no response to limb and head stimulation. Then mice were euthanized in about 10 s by cervical dislocation. Mice were judged to be dead if they met the following criteria: 10 s after cervical dislocation, mice were stopped breathing and did not respond to systemic stimuli. The duration of the experiment was about 10 min. The health and behavior of nude mice was observed every 3 min. During the research, no accidental death of nude mice was occurred.

Immunohistochemical staining for CENPU and MRPS28 was performed on paraffin-embedded tumors that were fixed in a 10% formaldehyde solution. After dewaxing, hydration, and antigen retrieval, the endogenous peroxidase activity was quenched using H₂O₂ (3%) and goat serum was used to block tumor tissue sections for 30 min at 4°C. After three PBS washes, Triton X-100 (0.5%) was added onto the tissue sections, followed by a 2 min incubation on ice. Sections were washed three times in PBS. A rabbit anti-mouse CENPU antibody or MRPS28 antibody (1:100 dilution, Wuhan Boster Bio-Engineering Co., Ltd., Wuhan, China) was added and the sections were incubated for 12 h incubation at 4°C. After incubation with the primary antibodies, sections were probed using biotinylated secondary antibodies for 2 h followed by three times washing with PBS. Sections were stained using 3,3’-diaminobenzidine color reaction and counterstained with hematoxylin. Following ethanol dehydration, sections were sealed with neutral resin and the integrated optical density (IOD) was analyzed using the Gel-Pro Analyzer V4.0 image analysis software system (Media Cybernetics, Rockville, MD, USA). Large IOD/Area value indicated more protein expression level.

Total RNA was extracted from cells or tissues using Trizol (Thermo Fisher Scientific). cDNA was synthesized by reverse transcription of isolated RNA using the PrimeScript miRNA cDNA Synthesis Kit (Applied Biosystems, Carlsbad, CA, USA). Expression of the target genes was quantified using the ABI 7500 Fast Real-Time PCR instrument (Applied Biosystems) with the following cycling conditions: pre-denaturation at 95°C, 5 min, then 40 cycles of 95°C, 15 s and 60°C, 1 min. Gene expression was calculated according to the 2^–ΔΔCt method with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal reference. The following primer sequences were used: CENPU, F, 5'-ATGAACTGCTTCGGTTAGAGC-3', R, 5'-TATTTCGCAGATGGCTTTCGG-3'. GAPDH, F, GTCGATGGCTAGTCGTAGCATCGAT, R, TGCTAGCTGGCATGCCCGATCGATC.

Total protein was extracted from tissues and cells in a radioimmunoprecipitation assay (RIPA) buffer (Sigma-Aldrich, St. Louis, MO, USA) containing aprotease inhibitor. A BCA protein assay kit (Pierce, Rockford, IL, USA) was used to measure protein concentration. Quantified proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on a 10% gel and transferred onto a polyvinylidenefluoride (PVDF) membrane. Membranes were blocked in 5% skimmed milk for 1 h and incubated in a primary antibody (mouse anti-rabbit CENPU, MRPS28, N-cadherin, Slug, and Snail antibodies, 1:1,000 dilution; Cell Signaling Technology, Beverly, MA, USA) for 12 h at 4°C. After three times washing with TBST, membranes were incubated for 1 h with a goat anti-mouse IgG secondary antibody (Wuhan Boster Bio-Engineering Co., Ltd.). Membranes were washed three times with TBST and viewed on a LI-COR imager (LI-COR Biosciences, Lincoln, NE, USA) using β-actin as a loading control.

Statistical analyses were performed using SPSS version 20.0 (IBM Co., Armonk, NY, USA). Data were obtained from ≥ 3 independent experiments and values were represented as the mean ± standard deviation. A Student’s t-test was used to identify significant differences between two groups. The comparison among more than two groups was performed using one-way analysis of variance (ANOVA). Tukey's post hoc test was used to validate ANOVA for pairwise comparisons. All graphs were made using GraphPad Prism v5 (GraphPad Software, Inc., La Jolla, CA, USA). p < 0.05 was considered statistically significant.

The expression of CENPU was determined in tumor tissues and cancer-adjacent normal tissues from 100 bladder cancer cases by qRT-PCR and Western Blot. Compared to normal tissues (1.13 ± 0.11), CENPU mRNA transcripts were 2-fold higher in tumor tissues (2.45 ± 0.26) (p < 0.01). Similarly, at the protein level, CENPU was more than 3-fold higher in tumor tissues (0.34 ± 0.09) than in normal tissues (0.10 ± 0.03) (p < 0.001) (Fig. 1A, B). CENPU expression was also investigated in bladder epithelium cell line (SV-HUC-1) and bladder cancer cell line (T24). The relative CENPU mRNA and protein expression levels were significantly higher in T24 cells (mRNA: 2.28 ± 0.17) compared to SV-HUC-1 cells (mRNA: 1.01 ± 0.05) (p < 0.01) (Fig. 1C, D).

To further characterize the role of CENPU in bladder cancer pathogenesis, siRNA was used to knockdown CENPU expression in T24 cells. At the mRNA and protein levels, the expression of CENPU was significantly lower in cells transfected with si-CENPU compared to the control group (si-NCgroup). We also overexpressed CENPU by transfecting T24 cells with a pcDNA-CENPU overexpression vector. CENPU mRNA and protein was significantly higher in pcDNA-CENPU transfected cells (pcDNA-CENPU group) than in the control (pcDNA-NC group) (p < 0.01) (Fig. 2A, B). The effect of CENPU down-regulation or up-regulation on cell viability, migration, and invasion was subsequently examined. Cells with down-regulated CENPU expression (si-CENPU group) had reduced viability compared to the control group (si-NC group) (p < 0.01), while cells overexpressing CENPU (pcDNA-CENPU group) had increased viability relative to the control (pcDNA-NC group) (p < 0.01) (Fig. 2C). Cell invasion was measured in the four groups using a Transwell assay. As shown in Fig. 2D, less invasive cells were observed in the si-CENPU group compared to the si-NC group. However, the number of invasive cells in the pcDNA-CENPU group was remarkably higher than in the pcDNA-NC group. A cell scratch test was used to examine the migration ability of the cells. After 48 and 72 h, significantly wider scratch widths were found in the si-CENPU group compared to the si-NC group, while significantly narrower scratch widths were found in the pcDNA-CENPU group relative to pcDNA-NC group (Fig. 2E). The protein expression of N-cadherin, Slug, and Snail proteins was also examined by Western blot analysis. Lower amounts of all three proteins were detected in si-CENPU cells compared to si-NC group cells (p < 0.05 or p < 0.01). In contrast, the pcDNA-CENPU had more N-cadherin, Slug, and Snail proteins relative to the pcDNA-NC group (p < 0.05 or p < 0.01) (Fig. 2F).

We investigated the role of MRPS28 by down-regulating (si-MRPS28 group) (Fig. 3A) and up-regulating (pcDNA-MRPS28 group) (Fig. 3B) MRPS28 expression in T24 cells. Down-regulation of MRPS28 decreased the viability of cells compared to the si-NC group (p < 0.05), while up-regulation of MRPS28 increased cell viability relative to the pcDNA-NC group (p < 0.05) (Fig. 3C). Similarly, cell invasion was lower in MRPS28 down-regulated cells and higher in MRPS28 up-regulated cells compared to the respective control groups (Fig. 3D). After incubation for 48 and 72 h, wider scratch widths were observed in the si-MRPS28 group compared to the si-NC group. However, at both time points, the scratch widths of the pcDNA-MRPS28 group were significantly narrower than that of the pcDNA-NC group (Fig. 3E).

In order to explore the link between CENPU and MRPS28, we simultaneously down-regulated CENPU and up-regulated MRPS28 in T24 cells (si-CENPU + pcDNA-MRPS28 group). Down-regulation of CENPU alone (si-CENPU group) significantly decreased the viability of cells relative to the control group (si-NC group) (p < 0.01). However, simultaneous up-regulation of MRPS28 (si-CENPU + pcDNA-MRPS28 group) increased cell viability relative to the si-CENPU group (p < 0.01) (Fig. 4A). Similarly, more invasive cells (Fig. 4B) and higher migration (Fig. 4C) abilities were detected in the si-CENPU + pcDNA-MRPS28 group compared to the si-CENPU group. In addition, we simultaneously up-regulated CENPU and down-regulated MRPS28 in T24 cells (pcDNA-CENPU + si-MRPS28 group). Cells with up-regulation of CENPU (pcDNA-CENPU group) had higher cell viability (p < 0.01) and more invasive and migrated cells relative to the control group (pcDNA-NC group). Simultaneous down-regulation of MRPS28 (pcDNA-CENPU + si-MRPS28 group) significantly decreased the viability (p < 0.01), invasion, and migration of T24 cells compared to the pcDNA-CENPU group (Fig. 4D–F).

Mice with up-regulated CENPU expression (pcDNA-CENPU group) and simultaneously down-regulated MRPS28 expression (pcDNA-CENPU + si-MRPS28 group) were used to examine the role of CENPU/MRPS28 in bladder cancer progression in vivo. In this study, a total of 3 × 10⁶ cells were injected subcutaneously into nude mice. At week 1, tumor volume were comparable between the experimental and control (pcDNA-NC) groups. However, within 2–4 weeks, CENPU-overexpressing mice (pcDNA-CENPU) had significantly higher tumor volume compared to the pcDNA-NC group (p < 0.05). In contrast, from 1–4 weeks, CENPU-overexpressing mice with down-regulated MRPS28 expression (pcDNA-CENPU + si-MRPS28 group) had significantly lower tumor volume compared to the pcDNA-CENPU group (p < 0.05 or p < 0.01 or p < 0.001). After 4 weeks of injection, the maximum tumor volume was about 1.3 cm³, which was in line with the recommendations of the University of Pennsylvania Institutional Animal Care and Use Committee guidelines (Fig. 5A). CENPU and MRPS28 expression at the protein level was established in tumor tissues by immunohistochemistry and Western blot analysis. In comparison to the pcDNA-NC group, more CENPU protein was detected in the tumor tissues of CENPU-overexpressing mice (pcDNA-CENPU group) (p < 0.001). As expected, more CENPU protein and less MRPS38 protein was detected in CENPU-overexpressing mice with down-regulated MRPS28 expression (pcDNA-CENPU + si-MRPS28 group) compared to the pcDNA-NC group (p < 0.001) (Fig. 5B, C). The levels of N-cadherin, Slug, and Snail proteins in tumor tissues were examined by Western blot analysis. Tumor tissues of CENPU-overexpressing mice (pcDNA-CENPU group) had a higher amount of N-cadherin, Slug, and Snail proteins compared to the pcDNA-NC group (p < 0.001). Furthermore, the amount of all three proteins was lower in tumor tissues of CENPU-overexpressing mice with down-regulated MRPS28 expression (pcDNA-CENPU + si-MRPS28 group) compared to the pcDNA-CENPU group (p < 0.001) (Fig. 5D).