Molecular epidemiology and characterization of Streptococcus mutans strains in Korea

Se-Yeon Kim; Il Kown Bae; Jung-Ha Lee; Jeong Hwan Shin; Jin-Bom Kim

doi:10.11149/jkaoh.2020.44.1.34

Journal List > J Korean Acad Oral Health > v.44(1) > 1144478

Go to TopGo to Top Go to BottomGo to Bottom

TOOLS

Kim, Bae, Lee, Shin, and Kim: Molecular epidemiology and characterization of Streptococcus mutans strains in Korea

Original Article

J Korean Acad Oral Health 2020;44(1):34-40.

Published online: 15 March 2020

DOI: https://doi.org/10.11149/jkaoh.2020.44.1.34

Molecular epidemiology and characterization of Streptococcus mutans strains in Korea

Se-Yeon Kim¹, Il Kown Bae², Jung-Ha Lee¹, Jeong Hwan Shin³, Jin-Bom Kim^1,

¹Department of Preventive and Community Dentistry, School of Dentistry, Pusan National University, Yangsan, Korea

²Department of Dental Hygiene, College of Health and Welfare, Silla University, Busan, Korea

³Department of Laboratory Medicine, Inje University College of Medicine, Busan, Korea

Corresponding Author: Jin-Bom Kim Department of Preventive and Community Dentistry, School of Dentistry, Pusan National University, 49 Busandaehak-ro, Mulgeum-eup, Yangsan 50612, Korea Tel: +82-51-510-8223 Fax: +82-51-510-8221 E-mail: jbomkim@pusan.ac.kr https://orcid.org/0000-0001-8619-2741

Received 16 December 2019 Revised 12 February 2020 Accepted 25 February 2020

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Objectives

We investigated the characteristics of Streptococcus mutans in the national culture collection from Korea. Twenty-nine (dental plaque, n=27; endodontic infections, n=1; blood, n=1) isolates were included in this study.

Methods

Antimicrobial susceptibilities were tested using the disk diffusion test. Multilocus sequence typing (MLST), serotyping, and collagen-binding genes were used for polymerase chain reaction (PCR) and direct sequencing. A collagen-binding (to assess the adhesion properties) assay was performed. S. mutans demonstrated high susceptibility to antimicrobial agents. Differences in collagen-binding abilities of the cnm-positive and -negative groups were compared using the Mann-Whitney U test (P<0.05).

Results

MLST analyses revealed 25 sequence types (STs), 17 of which (ST213-ST229) contained new alleles. The strains were classified into four serotypes with the c type encompassing 79.3% of all strains, while the e, f, and k types representing 6.9% each. Analysis of the cnm and cbm genes, which encode the two surface adhesin components of S. mutans, revealed three cnm-positive strains, each displaying greater adhesion ability than those of the cnm-negative strains.

Conclusions

This study highlights the presence of a wide variety of S. mutans genotypes in Korea. These findings may provide useful information regarding the pathogenesis of infectious diseases, such as dental caries.

Keywords: Adhesion, Bacteremia, Collagen binding, MLST, Infection, Inflammation, Streptococcus mutans

References

1. Ajdić D, McShan WM, McLaughlin RE, Savić G, Chang J, Carson MB, et al. Genome sequence of Streptococcus mutans UA159, a cariogenic dental pathogen. Proc Natl Acad Sci USA. 2002; 99:14434–14439.

2. Switalski LM, Butcher WG, Caufield PC, Lantz MS. Collagen mediates adhesion of Streptococcus mutans to human dentin. Infect Im-mun. 1993; 61:4119–4125.

3. Miller JH, Avilés-Reyes A, Scott-Anne K, Gregoire S, Watson GE, Sampson E, et al. The collagen binding protein Cnm contributes to oral colonization and cariogenicity of Streptococcus mutans OMZ175. Infect Immun. 2015; 83:2001–2010.

4. Banas JA. Virulence properties of Streptococcus mutans. Front Biosci. 2004; 9:1267–1277.

5. Nakano K, Ooshima T. Serotype classification of Streptococcus mutans and its detection outside the oral cavity. Future Microbiol. 2009; 4:891–902.

6. Nakano K, Nomura R, Nemoto H, Mukai T, Yoshioka H, Shudo Y, et al. Detection of novel serotype k Streptococcus mutans in infective endocarditis patients. J Med Microbiol. 2007; 56:1413–1415.

7. Hirasawa M, Takada K. A new selective medium for Streptococcus mutans and the distribution of S. mutans and S. sobrinus and their serotypes in dental plaque. Caries Res. 2003; 37:212–217.

8. Nakano K, Nomura R, Nakagawa I, Hamada S, Ooshima T. Demonstration of Streptococcus mutans with a cell wall polysaccharide specific to a new serotype, k, in the human oral cavity. J Clin Micro-biol. 2004; 42:198–202.

9. Nakano K, Nomura R, Taniguchi N, Lapirattanakul J, Kojima A, Naka S, et al. Molecular characterization of Streptococcus mutans strains containing the cnm gene encoding a collagen-binding adhesin. Arch Oral Biol. 2010; 55:34–39.

10. Nomura R, Nakano K, Naka S, Nemoto H, Masuda K, Lapirat-tanakul J, et al. Identification and characterization of a collagen-binding protein, Cbm, in Streptococcus mutans. Mol Oral Microbiol. 2012; 27:308–323.

11. Sato Y, Okamoto K, Kagami A, Yamamoto Y, Igarashi T, Kizaki H. Streptococcus mutans strains harboring collagen-binding adhesin. J Dent Res. 2004; 83:534–539.

12. Nomura R, Nakano K, Taniguchi N, Lapirattanakul J, Nemoto H, Grönroos L, et al. Molecular and clinical analyses of the gene encoding the collagen-binding adhesin of Streptococcus mutans. J Med Microbiol. 2009; 58:469–475.

13. Nakano K, Hokamura K, Taniguchi N, Wada K, Kudo C, Nomura R, et al. The collagen-binding protein of Streptococcus mutans is involved in haemorrhagic stroke. Nat Commun. 2011; 2:485.

14. Kojima A, Nakano K, Wada K, Takahashi H, Katayama K, Yoneda M, et al. Infection of specific strains of Streptococcus mutans, oral bacteria, confers a risk of ulcerative colitis. Sci Rep. 2012; 2:332.

15. Lapirattanakul J, Nakano K, Nomura R, Hamada S, Nakagawa I, Ooshima T. Demonstration of mother-to-child transmission of Streptococcus mutans using multilocus sequence typing. Caries Res. 2008; 42:466–474.

16. Nomura R, Ogaya Y, Nakano K. Contribution of the collagen-binding proteins of Streptococcus mutans to bacterial colonization of inflamed dental pulp. PLoS One. 2016; 11:e0159613.

17. Pérez-Losada M, Cabezas P, Castro-Nallar E, Crandall KA. Pathogen typing in the genomics era: MLST and the future of molecular epidemiology. Infect Genet Evol. 2013; 16:38–53.

18. Cai JN, Jung JE, Lee MH, Choi HM, Jeon JG. Sucrose challenges to Streptococcus mutans biofilms and the curve fitting for the biofilm changes. FEMS Microbiol Ecol. 2018; 94.

19. Patel J, Cockerill F, Alder J, Bradford P, Eliopoulos G, Hardy D, et al. Performance standards for antimicrobial susceptibility testing; twenty-fourth informational supplement. PA: Clinical and Laboratory Standards Institute;2014. 34:p. 1–266.

20. Lapirattanakul J, Nakano K, Nomura R, Leelataweewud P, Chalerm-sarp N, Klaophimai A, et al. Multilocus sequence typing analysis of Streptococcus mutans strains with the cnm gene encoding collagen-binding adhesin. J Med Microbiol. 2011; 60:1677–1684.

21. Momeni SS, Whiddon J, Cheon K, Moser SA, Childers NK. Assessment of two multilocus sequence typing (MLST) schemes available for Streptococcus mutans. Arch Oral Biol. 2015; 60:1769–1776.

22. Nakano K, Nemoto H, Nomura R, Homma H, Yoshioka H, Shudo Y, et al. Serotype distribution of Streptococcus mutans a pathogen of dental caries in cardiovascular specimens from Japanese patients. J Med Microbiol. 2007; 56:551–556.

23. Do T, Gilbert SC, Clark D, Ali F, Fatturi Parolo CC, Maltz M, et al. Generation of diversity in Streptococcus mutans genes demonstrated by MLST. PLoS One. 2010; 5:e9073.

24. Nakano K, Lapirattanakul J, Nomura R, Nemoto H, Alaluusua S, Grönroos L, et al. Streptococcus mutans clonal variation revealed by multilocus sequence typing. J Clin Microbiol. 2007; 45:2616–2625.

25. Lapirattanakul J, Nomura R, Nemoto H, Naka S, Ooshima T, Nakano K. Multilocus sequence typing of Streptococcus mutans strains with the cbm gene encoding a novel collagen-binding protein. Arch Oral Biol. 2013; 58:989–996.

26. Abranches J, Miller JH, Martinez AR, Simpson-Haidaris PJ, Burne RA, Lemos JA. The collagen-binding protein Cnm is required for Streptococcus mutans adherence to and intracellular invasion of human coronary artery endothelial cells. Infect Immun. 2011; 79:2277–2284.

27. Nomura R, Naka S, Nemoto H, Inagaki S, Taniguchi K, Ooshima T, et al. Potential involvement of collagen-binding proteins of Streptococcus mutans in infective endocarditis. Oral Dis. 2013; 19:387–393.

28. García-Godoy F, Hicks MJ. Maintaining the integrity of the enamel surface: the role of dental biofilm, saliva and preventive agents in enamel demineralization and remineralization. J Am Dent Assoc. 2008; 139(Suppl):S25–34.

29. Goyal D, Sharma S, Mahmood A. Inhibition of dextransucrase activity in Streptococcus mutans by plant phenolics. Indian J Biochem Biophys. 2013; 50:48–53.

30. Shibata Y, Ozaki K, Seki M, Kawato T, Tanaka H, Nakano Y, et al. Analysis of loci required for determination of serotype antigenicity in Streptococcus mutans and its clinical utilization. J Clin Microbiol. 2003; 41:4107–4112.

Fig. 1.

Comparison of collagen-binding activities between cnm-positive (cnm+)and cnm-negative (cnm-) strains.

Table 1.

PCR primers for S. mutans used in this study

Name	Purpose	Sequence (5' to 3')	Product size (bp)	Reference
cnm-F	Collagen-binding	TGCTGTTGATGGTAAGGAATTTAAC	717	This study
cnm-R	detection	CTTTCTTCGCCTGTGCTTG
cbm-F		CGCGGACAAAGTGGTATCAG	847
cbm-R		TGTTTGAACTTGAGCCTGCC
SC-F	Serotyping	CGGAGTGCTTTTTACAAGTGCTGG	727	Shibata et al. (2003)
SC-R		AACCACGGCCAGCAAACCCTTTAT
SE-F		CCTGCTTTTCAAGTACCTTTCGCC	517
SE-R		CTGCTTGCCAAGCCCTACTAGAAA
SF-F		CCCACAATTGGCTTCAAGAGGAGA	316
SF-R		TGCGAAACCATAAGCATAGCGAGG
CEFK-F		ATTCCCGCCGTTGGACCATTCC	294	Nakano et al. (2004)
CEFK-R		CCAATGTGATTCATCCCATACC
tkt-F*	MLST analysis	ACCCGGGTGTTGTCATGGGCGCTGC	432	Nakano et al. (2007)
tkt-R*		CATAGGATGACGCTTCGCCAGAAAC
glnA-F*		CCTTGGGGAGATGAAAACGGAGCCG	462
glnA-R*		TGGCCATAAAGGTTGCATACAAACC
gltA-F*		TGCCTTAACGATGTTAGAGAGAATG	387
gltA-R*		AAAGACTATCTTCAAAAGCACACCC
glk-F*		GACAAGTTCAGGAGAAATGGGCTAT	402
glk-R*		CAGCAACTCCATGAATAAGATTGCC
aroE-F*		GATGAAGTAACGAAAGCAGCAGATT	396
aroE-R*		TGCCATCCATACCAACATTGGTCGC
murI-F*		TCCGGAGTGGGCGGTTTAACGGTCG	432
murI-R*		TCAACAATAGGAACAAATTTGGGGC
lepC-F*		CCGCGTCTCTTTATCTGGTTTCTTG	423
lepC-R*		GACAATGCGATCATCACCTAAAAGC
gyrA-F*		TACAGGTGATGTCATGGGTAAATAC	417
gyrA-R*		CCGGGTAGTACTTCCATTAGGTCAC

*The asterisks indicate 8 housekeeping genes, tkt (transketolase), glnA (glutamine synthetase subunit 1a), gltA (glutamate synthase), glk (glucose kinase), aroE (shikimate-5 dehydrogenase), murI (glutamate racemase), lepC (signal peptidase 1) and gyrA (DNA gyrase subunit A).

Table 2.

Characteristics of S. mutans strains analyzed by PCR and sequencing

Species	cnm	cbm	Allelic profiles								ST	Serotype
Species	cnm	cbm	tkt	glnA	gltA	glk	aroE	murI	lepC	gyrA	ST	Serotype
KCOM2966	―	―	6	5	9	3	17	4	1	3	221	e
KCOM2084	―	―	2	2	15	1	14	3	1	10	213	c
KCOM1225	+	―	1	3	8	1	25	3	1	1	123	f
KCOM1223	―	―	2	5	9	1	4	3	3	1	93	c
KCOM1220	―	―	2	5	9	1	4	3	3	1	93	c
KCOM1219	+	―	25	2	1	1	9	10	3	1	222	k
KCOM1216	―	―	1	14	36	3	32	2	11	1	223	c
KCOM1212	―	―	1	2	8	1	14	18	22	15	214	c
KCOM1209	―	―	1	14	15	4	4	3	11	1	215	c
KCOM1203	―	―	1	14	15	4	4	3	11	1	215	c
KCOM1201	―	―	2	3	15	3	4	5	35	1	224	c
KCOM1200	―	―	1	14	15	4	4	3	11	1	215	c
KCOM1195	+	―	1	1	1	1	18	5	3	1	216	e
KCOM1194	―	―	1	1	1	1	17	17	1	9	217	c
KCOM1188	―	―	1	14	15	4	4	3	1	1	225	c
KCOM1187	―	―	1	14	5	3	7	19	11	1	218	c
KCOM1186	―	―	2	2	4	3	4	25	1	4	209	c
KCOM1183	―	―	1	1	1	13	1	1	1	1	2	c
KCOM1179	―	―	3	2	37	3	4	3	1	1	226	k
KCOM1178	―	―	2	3	15	3	4	5	35	1	224	c
KCOM1147	―	―	1	5	5	1	23	2	1	1	121	f
KCOM1146	―	―	3	8	38	1	7	3	11	1	227	c
KCOM1145	―	―	1	14	15	1	2	19	11	9	219	c
KCOM1143	―	―	2	2	4	5	4	22	30	1	181	c
KCOM1142	―	―	1	1	1	13	1	1	1	1	2	c
KCOM1141	―	―	6	1	1	3	2	4	1	3	72	c
KCOM1140	―	―	6	1	1	3	2	4	1	3	72	c
KCOM1139	―	―	2	2	15	8	4	3	30	1	220	c
PO1463	―	―	4	1	1	2	2	5	1	1	228	c
ATCC25175	―	―	1	1	1	8	11	3	19	1	229	c
UA159	―	―	1	1	1	1	1	1	1	1	1	c

Bold letters indicate new alleles and sequence type (ST) registered with PubMLST for S. mutans MLST scheme in this study. tkt (#25), GenBank accession no. AB281747; gltA (#36), GenBank accession no. AB281970; gltA (#37), Genbank accession no. AB281943; gltA (#38), GenBank accession no. AB282001; aroE (#32), GenBank accession no. AB282285; lepC (#35), GenBank accession no. AB282484.

TOOLS

Similar articles