Journal List > J Bacteriol Virol > v.50(1) > 1144270

TOOLS
Kang and Ham: Age-specific Prevalence of Porcine Reproductive and Respiratory Syndrome Virus, Porcine Circovirus Type 2, and Mycoplasma hyopneumoniae in Korea Pig Farms
Original Article

J Bacteriol Virol 2020;50(1):9-16.

Published online: 9 March 2020

DOI: https://doi.org/10.4167/jbv.2020.50.1.009

Age-specific Prevalence of Porcine Reproductive and Respiratory Syndrome Virus, Porcine Circovirus Type 2, and Mycoplasma hyopneumoniae in Korea Pig Farms

Ikjae Kang1, Heejin Ham2, ∗

1Dong Bang Co LTD, Farm Animal Disease Research Center, Seoul 06301, Korea

2Anyang University, College of Liveral Arts, Anyang 14028, Korea

Corresponding Heejin Ham Anyang University, College of Liveral Arts, Anyang 14028, Korea Phone: +82-31-463-1353 Fax: +82-31-463-1386 E-mail: hhj3814@anyang.ac.kr

Received 20 November 201927 December 2019       Accepted 3 January 2020

Copyright © 2020 Journal of Bacteriology and Virology

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Porcine respiratory disease complex (PRDC) continues to be a significant economic problem to the swine industry. Porcine circovirus type 2 (PCV2), porcine reproductive and respiratory syndrome virus (PRRSV), and Mycoplasma hyopneumoniae (MH) are considered to be the most important pathogens that cause PRDC. In this study, we investigated the prevalence of antibodies against PRRSV and MH in the serum of sows and piglets from 89 domestic commercial pig farms by ELISA, and the presence of viral nucleic acids of PRRSV, including North American and European PRRS, and PCV2 was also investigated in the serum of sows and piglets from 89 domestic commercial pig farms by real-time PCR. In case of PRRSV, 78.7% (70/89) of sows were positive for PRRSV antibody, and 96.6% (86/89) of piglets were positive for PRRSV antibody. For MH, 76.4% (68/89) of sows showed positive for MH antibody. In the PRRSV viral nucleic acid detection experiment, 36.0% (32/89) of sows were positive for PRRSV nucleic acids, and virus nucleic acid was detected in 83.1% (74/89) of piglets. In case of virus type, both North American and European types were detected. In case of PCV2, 15.7% (14/89) of sows were positive for PCV2 nucleic acids. Conclusively, PCV2, PRRSV, and MH were widely distributed in pig farms in Korea. These prevalence data related with PRDC provides clinical information for vaccination strategy and development for the control of PRDC.

Keywords: porcine respiratory disease complex, porcine reproductive and respiratory syndrome virus, porcine circovirus type 2, Mycoplasma hyopneumoniae, real-time PCR, ELISA

REFERENCES

1). C Kang MS, Kang MW, Jung SH, Lee HS. Study on porcine respiratory disease complex from slaughtered pigs in Namwon, Korea. Korean J Vet Serv. 2013; 36:139–45.
2). Chae C. Porcine respiratory disease complex: Interaction of vaccination and porcine circovirus type 2, porcine reproductive and respiratory syndrome virus, and Mycoplasma hyopneumoniae. Vet J. 2016; 212:1–6.
3). Lee CH, Hwang WM, Lee JG, Lee SM, Kim SJ, Kim NH, et al. Study on gross finding of lung lesions and causative pathogens of porcine respiratory disease complex from slaughtered pigs in Incheon. Korean J Vet Serv. 2011; 34:313–20.
crossref
4). Chu KS, Kang MS, Jo YS, Lee JW. Detection of porcine circovirus 2, porcine reproductive and respiratory syndrome virus and mycoplasma hyopneumoniae from swine lungs with lesions by PCR. Korean J Vet Serv. 2008; 31:71–7.
5). Jeong CG, Khatun A, Nazki S, Lee SI, Kim TH, Kim KS, et al. Production and evaluation of PRRS resistant pigs. Korean J Vet Serv. 2019; 42:1–7.
6). Gagnon CA, Del Castillo JR, Music N, Fontaine G, Harel J, Tremblay D. Development and use of a multiplex real-time quantitative polymerase chain reaction assay for detection and differentiation of Porcine circovirus-2 genotypes 2a and 2b in an epidemiological survey. J Vet Diagn Invest. 2008; 20:545–58.
crossref
7). Park KH, Oh T, Yang S, Cho H, Kang I, Chae C. Evaluation of a porcine circovirus type 2a (PCV2a) vaccine efficacy against experimental PCV2a, PCV2b, and PCV2d challenge. Vet Microbiol. 2019; 231:87–92.
crossref
8). Wasilk A, Callahan JD, Christopher HJ, Gay TA, Fang Y, Dammen M, et al. Detection of US, Lelystad, and European-like porcine reproductive and respiratory syndrome viruses and relative quantitation in boar semen and serum samples by real-time PCR. J Clin Microbiol. 2004; 42:4453–61.
crossref
9). Kang IJ, Kang HS, Jeong JW, Park CH, Kim SU, Choi KH, et al. Improved growth performance by type 2 porcine reproductive and respiratory syndrome virus (PRRSV)-based modified live vaccine in a herd with concurrent circulation of type 1 and type 2 PRRSV. Thai J Vet Med. 2017; 47:109–15.
10). Cheong Y, Oh C, Lee K, Cho KH. Survey of porcine respiratory disease complex-associated pathogens among commercial pig farms in Korea via oral fluid method. J Vet Sci. 2017; 18:283–9.
crossref
11). Oh T, Kim H, Park KH, Yang S, Jeong J, Kim S, et al. Comparison of 4 commercial modified-live porcine reproductive and respiratory syndrome virus (PRRSV) vaccines against heterologous Korean PRRSV-1 and PRRSV-2 challenge. Can J Vet Res. 2019; 83:57–67.
12). Park C, Jeong J, Choi K, Chae C. Efficacy of a new bivalent vaccine of porcine circovirus type 2 and Mycoplasma hyopneumoniae (Fostera TM PCV MH) under experimental conditions. Vaccine. 2016; 34:270–5.
13). Lee HH, Rha J, Han JH. Evaluation of vaccination against Mycoplasma hyopneumoniae in pigs at different vaccination time-points. Korean J Vet Serv. 2008; 31:291–303.
14). Hong SH, Lee HA, Kim DW, Kim TW, Kim OJ. Simultaneous diagnosis and differentiation of Mycoplasma hyopneumoniae and Mycoplasma hyorhinis infections by multiplex PCR. Korean J Vet Serv. 2014; 37:247–52.
crossref
15). Choi WZ, Hong GS, Jeong WH, Kim NS, Kim NS, Kim KT, et al. Prevalence of porcine circovirus type 2 from slaughtered pigs in eastern area of Gangwon province. Korean J Vet Serv. 2006; 29:249–56.
16). Oh Y, Seo HW, Park C, Chae C. Comparison of sow and/or piglet vaccination of 3 commercial porcine circovirus type 2 (PCV2) single-dose vaccines on pigs under experimental PCV2 challenge. Vet Microbiol. 2014; 172:171–80.
crossref

Table 1.
Primer sequences used by real time PCR for the survey of porcine reproductive and respiratory syndrome virus (PRRSV) and porcine circovirus type 2 (PCV2) in Korea
Pathogen Primers (‘5-3’) PCR production Reference‡
North American PRRSV forward: 5′ TGTGCCAGATGCTGGGTAAGATCA backward: 5′ ATTGACGACAGACACAATTGCCGC 172 base pairs Wasilk et al, 2004
European PRRSV forward: 5′ TGGCCAGTCAGTCAATCAAC backward: 5′ AATCGATTGCAAGCAGAGGGAA 603 base pairs Wasilk et al, 2004
PCV2 forward: 5′ GCACAGAGCGGGGGTTTG backward: 5′ ACCGCTGGAGAAGGAAAAAT 168 base pairs Gagnon et al., 2008

PRRSV, porcine reproductive and respiratory syndrome virus; PCV2, porcine circovirus type 2; PCR, polymerase chain reaction

Table 2.
Detection rate of porcine reproductive and respiratory syndrome virus (PRRSV), porcine circovirus type 2 (PCV2), and Mycoplasma hyopneumoniae (MH) antibodies and antigens in pigs during 2016–2018 in Korea
PRRSV pattern of sows PRRSV pattern of piglets PCV2 infection pattern MH antibody pattern
Antibody Antigen Type Farm number Antibody Antigen Type Farm number Sows Piglets Farm number Sows Piglets Farm number
North American European North American European
+ + + 6 + + + 27 + + 5 + + 46
+ + - 14 + + - 25 + - 9 + - 22
+ - + 11 + - + 22 - + 18 - + 15
+ - - 39 + - - 12 - - 57 - - 6
- + - 1 - + - 0            
- - - 18 - - - 3            
  Total   89   Total   89 To otal 89 To otal 89
Table 3.
Age distribution of porcine reproductive and respiratory syndrome virus (PRRSV), porcine circovirus type 2 (PCV2), and Mycoplasma hyopneumoniae (MH) antibodies and antigens in piglets during 2016–2018 in Korea
Age (weeks) North American PRRSV positive European PRRSV positive PCV2 positive MH antibody positive
1 4 2 0 6
2 0 0 0 2
3 1 1 0 1
5 16 13 6 13
6 0 2 0 0
7 15 15 5 3
8 0 0 1 1
9 1 0 0 1
10 8 4 4 9
16 4 5 5 12
20 2 0 2 9
21 0 0 0 1
Total 51 42 23 58

∗ Serum samples were taken and pooled from five pigs at each week of age (n=89).

TOOLS
Similar articles