All animal protocols were approved by the Institutional Animal Care and Use Committee of Peking University First Hospital (permit no. 201734). Forty 5-week-old female BALB/c mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China) and were divided into four groups with 10 mice per group: Sham, Sham+LESW, UPK3A, and UPK3A+LESW. UPK3A (65–84, sequence AMVDSAMSRNVSVQDSAGVP, purity: 98%) was manufactured by Beijing SciLight Biotechnology Ltd., Co. (Beijing, China). At 6 weeks of age, the mice were injected subcutaneously in the abdominal flank with 200 µL of an emulsion containing equal volumes of water and complete Freund's adjuvant (CFA with mycobacteria tuberculosis) with (UPK3A and UPK3A+LESW groups) or without (Sham and Sham+LESW groups) 200 µg of UPK3A (first dose). At 10 weeks of age, the mice received a second dose of a booster immunization in exactly the same procedure as the first dose except that CFA was replaced by Freund's adjuvant (FA without mycobacteria tuberculosis). At 12 weeks of age, the mice underwent pain assessment (von Frey filaments test) and the frequency volume chart (FVC) test (micturition recording) as the pretreatment baseline assessment. LESW treatment and pain assessment were conducted from 13 to 15 weeks of age. One week after the final treatment (16 weeks of age), pain assessment and the FVC were conducted again as the post-treatment assessment. Mice were euthanized with an overdose of ketamine xylazine and sacrificed at 17 weeks of age. Serum and bladder tissue were processed for hematoxylin and eosin (H&E) staining, enzyme-linked immunosorbent assay (ELISA), polymerase chain reaction (PCR) testing, and Western blot.

A shock wave was delivered to the pelvic region with a special probe that was attached to a compact electrohydraulic unit with a focused shock wave source (HaiBing Medical Equipment Limited Corporation, Zhanjiang Economic and Technological Development Zone, Guangdong, China). Each mouse was anesthetized with isoflurane and then placed in the supine position with its lower abdomen shaved and sterilized with 75% alcohol. Standard commercial ultrasound gel (Aquasonic; Parker Laboratories Inc., Fairfield, NJ, USA) was applied between the probe and the skin of the pelvic region for optimal coupling. The treatment was applied at the energy flux density (maximum amount of acoustical energy that is transmitted through an area of 1 mm² per pulse) of 0.00 mJ/mm² (Sham group and UPK3A group) or 0.09 mJ/mm² (Sham+LESW group and UPK3A+LESW group) at 3 Hz (3 shocks per second), 400 shocks each time and three times a week. The course of treatment was designed on the basis of the clinical application of LESW, which patients with erectile dysfunction receive 2 to 3 times per week. This was also the course we used in our previous research [9].

Tactile sensitivities of the suprapubic region of mice were measured by using a series of 14 von Frey filaments with increasing calibrated forces from 0.008 to 8.0 g (Stoelting, Wood Dale, IL, USA). Beginning with the smallest filament, each filament was applied a total of five times for 3 seconds, with intervals of 8 seconds between each stimulus. The following behaviors were considered to be positive responses: 1) sharp retraction of the suprapubic abdominal region, 2) instant licking or scratching of the suprapubic abdominal region, and 3) jumping. The mouse was counted as positive if the response was positive more than 3 of 5 times (≥3/5). The whole procedure was repeated three times at each time point from 12 to 16 weeks of age weekly, and the number of mice with a positive response was recorded. In addition, the von Frey force that would elicit a positive response in half of the mice in each group (50% threshold) was also calculated.

Bladders were removed and fixed in 4% paraformaldehyde overnight. Paraffin-embedded tissue was cut into 5-µm sections and then stained with H&E. Gross histologic observations were performed using light microscopy.

Blood samples were collected and serum was separated and stored at −80℃ for ELISA. Concentrations of TNF-α (575209; Biolegend, San Diego, CA, USA), NGF (E-EL-M0815c; Elabscience, Houston, TX, USA), interleukin-2 (IL-2, 575409; Biolegend), and IL-6 (575709; Biolegend) were measured using ELISA kits according to the manufacturers' instructions. Absorbance at 450 nm was read in a Versamax ELISA microplate reader (Molecular Devices, Sunnyvale, CA, USA).

Fresh bladder tissue was immediately homogenized in TRIzol reagent (Invitrogen, Carlsbad, CA, USA) followed by isolation of total RNA. cDNA was synthesized from the RNA using a Super Script III cDNA synthesis kit with random hexamer primers (Invitrogen). Expression of the following genes was analyzed: NGF (ACAGATAGCAATGTCCCAGAGGATCCAGAGTGTCCGAAGAGGTG), interferon-γ (IFN-γ) (ATGAACGCTACACACTGCATCCCATCCTTTTGCCAGTTCCTC), TNF-α (CAGGCGGTGCCTATGTCTCCGATCACCCCGAAGTTCAGTAG), IL-2 (GTCACAAACAGTGCACCTACCCCTGGGTCTTAAGTGAAAG), IL-4 (TCCATGCACCGAGATGTTTGTACCCGTAGGATGCTCCCTTTATGAACG), IL-6 (TAGTCCTTCCTACCCCAATTTCCTTGGTCCTTAGCCACTCCTTC), IL-8 (TTGCCAAGGAGTGCTAAAGAAGCCCTCTTCAAAAACTTCTCC), and GAPDH (AGGTCGGTGTGAACGGATTTGTGTAGACCATGTAGTTGAGGTCA). Quantitative PCR was performed using the SYBR Green PCR Master kit with an ABI Prism 7500 Sequence Detection System (Applied Biosystems, Foster City, CA, USA).

Protein isolation and Western blot were conducted as previously reported [9]; a total of 20 mg protein was loaded for each sample. The primary antibodies used in Western blot were nuclear factor-κB (NF-κB, 1:500, ab16502; Abcam, Cambridge, MA, USA), NGF (1:300, ab6199; Abcam), TNF-α (1:500, ab6671; Abcam), and β-actin (1:1,000, ab8227; Abcam). After incubation with the secondary antibody, the resulting images were analyzed with ChemiImager 4000 (Alpha Innotech Corp., San Leandro, CA, USA) to determine the integrated density value of each protein band.

Results were analyzed using Prism 5 (GraphPad Software, San Diego, CA, USA) and are expressed as means±standard deviations. Multiple groups were compared by using one-way analysis of variance followed by the Tukey Kramer test for post-hoc comparisons (four variables). Statistical significance was set at p<0.05.

Local pain or allodynia is the most prominent feature of IC/PBS. Injection of UPK3A induced persistent referred pelvic pain responses after 2 weeks. Mechanical stimulation with von Frey filaments of increasing size on the suprapubic region resulted in significantly greater tactile sensitivity in the EAC mice than in uninjected mice (Fig. 1A–E). Calculation of 50% threshold forces revealed significantly a lower tactile response threshold in UPK3A-immunized mice than in control mice (Fig. 1F). These results demonstrate the persistence of allodynia in the EAC mouse model. Three weeks of LESW treatment lowered the tactile sensitivity in UPK3A-induced EAC mice, and the 50% threshold forces increased significantly in the UPK3A+LESW group compared with the UPK3A group (p=0.005).

Urinary FVCs were used to determine whether LESW treatment could influence bladder function. Mice immunized with UPK3A showed significantly increased micturition frequency and significantly decreased mean urine outputs (Fig. 2A, B, p=0.001 and 0.001, respectively). After treatment, FVC measurement at 16 weeks showed that LESW decreased the urinary frequency and increased the mean urine output in the UPK3A+LESW group compared with that in the UPK3A group (Fig. 2C, D, p=0.011 and 0.049, respectively).

To determine whether functional changes in the bladder are associated with potential bladder tissue changes, H&E staining was done. The number of infiltrated inflammatory cells was higher in UPK3A-injected groups. The thickness of the bladder wall was also greater after UPK3A immunization, which was associated with impaired bladder compliance. LESW treatment attenuated these pathologic changes. Infiltrated inflammatory cells were especially decreased in the smooth muscle layers (Fig. 3).

The systemic inflammatory response was measured as represented by the levels of inflammatory cytokines in serum. Levels of TNF-α, NGF, IL-2, and IL-6 were calculated by using an ELISA kit. Serum levels of TNF-α and NGF increased significantly after UPK3A injection, which corresponded to the local inflammatory reaction in bladder tissue. LESW treatment also relieved the systemic inflammatory response represented by decreased TNF-α and NGF levels in serum. The decrease in the TNF-α level was significant after LESW treatment (Fig. 4A, p=0.004).

To assess the influence of UPK3A and LESW treatment on the expression of inflammatory markers in the bladder, bladders were harvested and processed for quantitative reverse transcription (RT)-PCR and Western blot. Common inflammatory markers including NGF, IFN-γ, TNF-α, and IL-2, -4, -6, and -8 were measured by use of RT-PCR. The results demonstrated that mRNA levels of TNF-α and NGF increased significantly after UPK3A immunization, and LESW treatment decreased the expression levels of TNF-α and NGF (Fig. 4B). These changes were further confirmed using Western blot, in which the protein levels of TNF-α, NGF, and the downstream inflammatory marker NF-κB were measured. Changes in the levels of TNF-α and NGF corresponded to the changes in mRNA expression levels. LESW treatment induced significantly decreased protein levels of TNF-α in the UPK3A+LESW group compared with the UPK3A group (Fig. 4C, D, p=0.003).