Loading [MathJax]/jax/output/HTML-CSS/fonts/TeX/fontdata.js

Journal List > Ann Lab Med > v.35(1) > 1091230

Lee, Chae, Lee, Cho, Seo, Park, Seong, and Park: Non-Homologous End Joining Repair Mechanism-Mediated Deletion of CHD7 Gene in a Patient with Typical CHARGE Syndrome

Abstract

CHARGE syndrome MIM #214800 is an autosomal dominant syndrome involving multiple congenital malformations. Clinical symptoms include coloboma, heart defects, choanal atresia, retardation of growth or development, genital hypoplasia, and ear anomalies or deafness. Mutations in the chromodomain helicase DNA binding protein 7 (CHD7) gene have been found in 65-70% of CHARGE syndrome patients. Here, we describe a 16-month-old boy with typical CHARGE syndrome, who was referred for CHD7 gene analysis. Sequence analysis and multiplex ligation-dependent probe amplification were performed. A heterozygous 38,304-bp deletion encompassing exon 3 with a 4-bp insertion was identified. There were no Alu sequences adjacent to the breakpoints, and no sequence microhomology was observed at the junction. Therefore, this large deletion may have been mediated by non-homologous end joining. The mechanism of the deletion in the current case differs from the previously suggested mechanisms underlying large deletions or complex genomic rearrangements in the CHD7 gene, and this is the first report of CHD7 deletion by this mechanism worldwide.

Go to : Goto

INTRODUCTION

CHARGE syndrome MIM #214800 is an autosomal dominant genetic disorder with multiple congenital anomalies. The syndrome derives its name from the first letters of its main clinical manifestations: Coloboma, Heart defects, Atresia of choanae, Retardation, Genitourinary malformation, and Ear abnormalities. The clinical criteria for CHARGE syndrome were first described by Blake et al. [1], and then modified by Verloes [2]. According to Verloes' criteria, CHARGE syndrome can be classified as typical, partial, or atypical.
The chromodomain helicase DNA binding protein 7 (CHD7) gene located on chromosome 8q12.1 is 188 kb in length and consists of 38 exons. The CHD7 protein functions as a regulator of DNA transcription [3]. CHD7 gene mutations have been identified in 65-70% of patients with CHARGE syndrome [4, 5, 6]. As most of cases of CHARGE syndrome are caused by a de novo mutation [7], familial cases are rarely reported.
CHD7 gene mutations have been identified throughout the coding exons, and most of them are point mutations. Large deletions and duplications account for only 2% of the observed mutations, while translocations account for <1%. As they are rare, large CHD7 gene deletions and duplications have not been reported previously in the Korean population. Here, we report a typical CHARGE syndrome patient with a large deletion in the CHD7 gene and a presumptive relevant mechanism.
Go to : Goto

CASE REPORT

A 16-month-old boy was referred for genetic workup because of typical manifestations of the CHARGE syndrome. Facial asymmetry was observed at birth, and auditory and visual dysfunctions were also noted. Heart defects, including aortic stenosis, persistent ductus arteriosus, atrial septal defect, and pulmonary stenosis, were identified on cardiological examination. Multiple abnormal findings, including incomplete cochlear turn and dysplasia of the vestibule and semicircular canal, were found on a computerized tomography scan. Two major signs (coloboma and hypoplastic semicircular canals) and four minor signs (rhombencephalic dysfunction, abnormal middle or external ear, malformation of mediastinal organs, and mental retardation) were identified according to Verloes' criteria. The patient was diagnosed as having typical CHARGE syndrome. A CHD7 gene analysis was requested for a confirmative diagnosis.
Informed consent was obtained from his legal representative, and genomic DNA was extracted from whole blood. PCR was performed by using primers specific for the 37 coding exons of the CHD7 gene. The sequencing reaction was performed with an ABI 3730 analyzer (Applied Biosystems, Foster City, CA, USA) by using a BigDye Terminator v3.1 Cycle sequencing kit (Applied Biosystems). Sequencher 5.0 software (Gene Codes Corporation, Ann Arbor, MI, USA) was used for the sequencing data analysis. No mutations were identified from this CHD7 gene sequence analysis.
Gene dosage analysis was performed by using a multiplex ligation-dependent probe amplification (MLPA) kit (SALSA MLPA P201-C1 CHARGE probemix; MRC-Holland, Amsterdam, Netherlands). MLPA analysis of the CHD7 gene revealed a heterozygous exon 3 deletion (Fig. 1). Genetic analyses of the patient's parents were not available. Further experiments were then performed in order to identify the precise breakpoints of this large deletion. A total of nine Alu sequences were located in intron 2 and three were located in intron 3 (Fig. 2C). Long range PCR was performed by using five forward primers adjacent to AluSx3, AluSg, AluSx1 (the more distal of the two), AluY, and AluSx, and one common reverse primer adjacent to AluSq2. The proximal breakpoint was localized between AluSg and AluSx1 (the more distal of the two). Another long range PCR was performed by using one common forward primer adjacent to AluSg, and two reverse primers adjacent to AluJr and AluSq2. The distal breakpoint was localized between AluJr and AluSq2. An additional long range PCR was performed by using forward primers located 1 kb, 2 kb, and 3 kb distal to AluSg and reverse primers located 1 kb, 2 kb, and 3 kb proximal to AluSq2. The proximal breakpoint was located between 3 kb distal to AluSg and AluSx1 (more distal of the two), while the distal breakpoint was located between 3 kb and 2 kb proximal to AluSq2. Finally, a 1kb-sized PCR fragment was obtained by using the following primers: GGTGGGCTGTGAAGTGTTCTGGC (forward primer; located in intron 2) and ACCCACAGTGCACTCCTCCCC (reverse primer; located in intron 3) (Fig. 2A). Sequence analysis revealed the exact breakpoints (Fig. 2B). The deleted region totaled 38,304 bp from c.1665+10039 in intron 2 to c.2097-3547 in intron 3, and it was accompanied by a TAAC insertion (Fig. 2D).
alm-35-141-g001
Fig. 1
Multiplex ligation-dependent probe amplification analysis of the CHD7 gene. Arrows indicate the reduced ratio of exon 3.

Download Figure

alm-35-141-g002
Fig. 2
Results of the sequence analysis and genomic structure encompassing exons 2-4 of the CHD7 gene. (A) Electrophoresis of a PCR product using the forward and reverse primers designated in (C) showed an apparent band in the patient. (B) The proximal and distal parts had no homologous sequences near the breakpoints. (C) Schematic diagram showing the range of the 38,304-bp deletion from c.1665+10039 to c.2097-3547. Alu sequences (blue triangles) were not adjacent to the breakpoints. Orange, green, and violet arrows indicate stepwise long-range PCR primers. (D) Sequence analysis revealed a 4-bp insertion (TAAC) between the breakpoints.
Abbreviations: Pt., patient; NC, normal control.

Download Figure

Go to : Goto

DISCUSSION

The majority of CHD7 gene mutations are point mutations-nonsense mutations, 44%; frameshift deletions or insertions, 34%; splice site mutations, 11%; and missense mutations, 8% [8]. Large deletions or duplications account for only 2% of total cases. To date, 15 cases of large deletions and 5 cases of large duplications in the CHD7 gene region have been reported (Table 1). Of these 20 cases, 10 cases involved whole gene deletions and duplications. To date, 16 index cases of CHD7 gene mutations have been reported in Korea [9, 10, 11, 12]. However, large deletions and duplications have not yet been reported in the Korean population.
Table 1
Previously reported cases of gross deletion or duplication of the CHD7 gene
alm-35-141-i001

Abbreviations: PMID, PubMed identifier; Mb, megabase.

Download Table

Copy number variations including both additions and deletions are mediated by homologous recombination and non-homologous repair mechanisms [13]. Homologous recombination is composed of non-allelic homologous recombination and single-strand annealing. Non-homologous repair mechanisms are classified into non-replicative non-homologous repair (non-homologous end joining [NHEJ] and microhomology-mediated end joining), and replicative non-homologous repair (replication slippage or template switching, fork stalling and template switching [FosTes], and microhomology-mediated break-induced replication [MMBIR]).
Two different mechanisms underlying CHD7 gene deletions have been previously reported. In the first case, a large deletion spanning exons 8-12 was detected in a Japanese girl [14]. The deletion encompassed 10,417 bases from intron 7 to intron 12. A polyadenine tract of approximately 100 bases was inserted into the junction. Therefore, this deletion was attributed to an Alu retrotransposition-mediated mechanism. In the second case, a complex genomic rearrangement was detected in a Caucasian girl [15]. A deletion of approximately 4,484 bases, including exon 7, was accompanied by an insertion of 347 bases from intron 4 between the breakpoints. This deletion was attributed to a FosTes or MMBIR mechanism.
The CHD7 gene mutations in the current study were mediated by a distinctly different mechanism from the aforementioned cases. Alu sequences were not adjacent to the breakpoints of the deleted region in the current case. The nearest Alu sequences from the proximal and distal breakpoints were located 469 bp and 2,400 bp away, respectively. There was a 4-bp, non-template insertion at the junction site, and there was no sequence microhomology between the upstream and downstream sequences near the junction. Therefore, NHEJ is the most probable mechanism responsible for the current case. NHEJ is a part of the double-strand break repair pathway and is the predominant repair mechanism used in mammals [16]. Furthermore, it is not uncommonly related to large deletions [17]. One or more nucleotide bases can be inserted into the junctions during the repair procedure in NHEJ [18, 19]. In summary, we report the first case of a CHD7 gene deletion mediated by NHEJ worldwide.
Go to : Goto

Notes

No potential conflicts of interest relevant to this article were reported.

Go to : Goto

References

1. Blake KD, Davenport SL, Hall BD, Hefner MA, Pagon RA, Williams MS, et al. CHARGE association: an update and review for the primary pediatrician. Clin Pediatr (Phila). 1998; 37:159–173. PMID: 9545604.
crossref
2. Verloes A. Updated diagnostic criteria for CHARGE syndrome: a proposal. Am J Med Genet A. 2005; 133A:306–308. PMID: 15666308.
crossref
3. Woodage T, Basrai MA, Baxevanis AD, Hieter P, Collins FS. Characterization of the CHD family of proteins. Proc Natl Acad Sci USA. 1997; 94:11472–11477. PMID: 9326634.
crossref
4. Aramaki M, Udaka T, Kosaki R, Makita Y, Okamoto N, Yoshihashi H, et al. Phenotypic spectrum of CHARGE syndrome with CHD7 mutations. J Pediatr. 2006; 148:410–414. PMID: 16615981.
crossref
5. Zentner GE, Layman WS, Martin DM, Scacheri PC. Molecular and phenotypic aspects of CHD7 mutation in CHARGE syndrome. Am J Med Genet A. 2010; 152A:674–686. PMID: 20186815.
6. Jongmans MC, Admiraal RJ, van der Donk KP, Vissers LE, Baas AF, Kapusta L, et al. CHARGE syndrome: the phenotypic spectrum of mutations in the CHD7 gene. J Med Genet. 2006; 43:306–314. PMID: 16155193.
crossref
7. Sanlaville D, Verloes A. CHARGE syndrome: an update. Eur J Hum Genet. 2007; 15:389–399. PMID: 17299439.
crossref
8. Janssen N, Bergman JE, Swertz MA, Tranebjaerg L, Lodahl M, Schoots J, et al. Mutation update on the CHD7 gene involved in CHARGE syndrome. Hum Mutat. 2012; 33:1149–1160. PMID: 22461308.
crossref
9. Lee YW, Kim SC, Shin YL, Kim JW, Hong HS, Lee YK, et al. Clinical and genetic analysis of the CHD7 gene in Korean patients with CHARGE syndrome. Clin Genet. 2009; 75:290–293. PMID: 19159393.
10. Song MH, Cho HJ, Lee HK, Kwon TJ, Lee WS, Oh S, et al. CHD7 mutational analysis and clinical considerations for auditory rehabilitation in deaf patients with CHARGE syndrome. PLoS One. 2011; 6:e24511. PMID: 21931733.
crossref
11. Cho HJ, Song MH, Choi SY, Kim J, Lee J, Kim UK, et al. Genetic analysis of the CHD7 gene in Korean patients with CHARGE syndrome. Gene. 2013; 517:164–168. PMID: 23333604.
crossref
12. Kim Y, Lee HS, Yu JS, Ahn K, Ki CS, Kim J. Identification of a novel mutation in the CHD7 gene in a patient with CHARGE syndrome. Korean J Pediatr. 2014; 57:46–49. PMID: 24578717.
13. Hastings PJ, Lupski JR, Rosenberg SM, Ira G. Mechanisms of change in gene copy number. Nat Rev Genet. 2009; 10:551–564. PMID: 19597530.
crossref
14. Udaka T, Okamoto N, Aramaki M, Torii C, Kosaki R, Hosokai N, et al. An Alu retrotransposition-mediated deletion of CHD7 in a patient with CHARGE syndrome. Am J Med Genet A. 2007; 143A:721–726. PMID: 17334995.
15. Vatta M, Niu Z, Lupski JR, Putnam P, Spoonamore KG, Fang P, et al. Evidence for replicative mechanism in a CHD7 rearrangement in a patient with CHARGE syndrome. Am J Med Genet A. 2013; 161A:3182–3186. PMID: 23956205.
crossref
16. Guirouilh-Barbat J, Huck S, Bertrand P, Pirzio L, Desmaze C, Sabatier L, et al. Impact of the KU80 pathway on NHEJ-induced genome rearrangements in mammalian cells. Mol Cell. 2004; 14:611–623. PMID: 15175156.
crossref
17. Roth DB, Porter TN, Wilson JH. Mechanisms of nonhomologous recombination in mammalian cells. Mol Cell Biol. 1985; 5:2599–2607. PMID: 3016509.
crossref
18. Roth DB, Proctor GN, Stewart LK, Wilson JH. Oligonucleotide capture during end joining in mammalian cells. Nucleic Acids Res. 1991; 19:7201–7205. PMID: 1662811.
crossref
19. Little KC, Chartrand P. Genomic DNA is captured and amplified during double-strand break (DSB) repair in human cells. Oncogene. 2004; 23:4166–4172. PMID: 15048077.
crossref
Go to : Goto
TOOLS
Similar articles