Molecular Epidemiology and Characterization of Carbapenemase-Producing Enterobacteriaceae Isolated at a University Hospital in Korea during 4-Year Period

Sunyoung Ahn; Ji Yeon Sung; Hyunsoo Kim; Myung Sook Kim; Younjee Hwang; Sori Jong; Younghee Seo; Eunjin Ha; Eun Suk Park; Jun Yong Choi; Dongeun Yong; Kyungwon Lee

doi:10.5145/ACM.2021.19.1.39

Journal List > Ann Clin Microbiol > v.19(2) > 1078554

Go to TopGo to Top Go to BottomGo to Bottom

TOOLS

Ahn, Sung, Kim, Kim, Hwang, Jong, Seo, Ha, Park, Choi, Yong, and Lee: Molecular Epidemiology and Characterization of Carbapenemase-Producing Enterobacteriaceae Isolated at a University Hospital in Korea during 4-Year Period

Original Article

Ann Clin Microbiol 2016;19(2):39-47.

Published online: 12 June 2016

DOI: https://doi.org/10.5145/ACM.2021.19.1.39

Molecular Epidemiology and Characterization of Carbapenemase-Producing Enterobacteriaceae Isolated at a University Hospital in Korea during 4-Year Period

Sunyoung Ahn¹, Ji Yeon Sung¹, Hyunsoo Kim², Myung Sook Kim¹, Younjee Hwang³, Sori Jong¹, Younghee Seo¹, Eunjin Ha⁴, Eun Suk Park⁴, Jun Yong Choi^4,⁵, Dongeun Yong^1,⁴, Kyungwon Lee¹

^¹Department of Laboratory Medicine and Research Institute of Bacterial Resistance, Yonsei University College of Medicine, Seoul, Korea

^²Department of Laboratory Medicine, National Police Hospital, Seoul, Korea

^³Brain Korea 21 PLUS Project for Medical Science, Yonsei University, Seoul, Korea

^⁴Department of Infection Control, Severance Hospital, Seoul, Korea

^⁵Division of Infectious Diseases, Department of Internal Medicine, Yonsei University College of Medicine, Seoul, Korea

Correspondence: Ji Yeon Sung, Department of Laboratory Medicine and Research Institute of Bacterial Resistance, Yonsei University College of Medicine, 50-1 Yonsei-ro, Seodaemun-gu, Seoul 03722, Korea. (Tel) 82-2-2228-2453, (Fax) 82-2-364-1583, (E-mail) jysung80@yuhs.ac

Received 15 February 2016 Revised 25 March 2016 Accepted 31 March 2016

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background

Carbapenemase-producing Enterobacteriaceae (CPE) has been increasingly reported world-wide in the past 10 years, which is an important infection control concern. Since the epidemiology and characteristics of these CPEs vary according to in-stitutes, we aimed to characterize CPEs in a university hospital during the recent 4 years.

Methods

From October 2011 to September 2015, CPE isolates from clinical specimens and hospital surveillance cultures were collected. Carbapenem resistance was confirmed by disk diffusion method and Minimal Inhibitory Concentration (MIC) was determined by agar dilution method. Carbapenemase production was tested by double disk test using amino-phenylboronic acid and dipicolic acid. PCR and sequence analysis were performed to detect bla _KPC, bla _IMP-1, bla _VIM-2, bla _NDM-1-like genes and bla _OXA-48 gene. Pulsed-field gel electrophoresis (PFGE) and Multilocus sequence typing (MLST) were conducted for KPC-producing Klebsiella pneumoniae isolates.

Results

Twenty-five isolates (11%) of CPE were identified among 222 carbapenem-resistant Entero-bacteriacae isolates during the study period. The most prevalent CPE was KPC-producing K. pneumonia and others were IMP-1, VIM-2, NDM-1 type and OXA-48 producing CPEs. Most of these CPEs showed resistance to carbapenems with variable MICs. The sequence types (STs) of KPC-producing K. pneumoniae were ST307 and ST11. The PFGE of ST11 and ST307 showed clonality in each group suggesting the possibility of in-hospital outbreak.

Conclusion

The prevalence of CPE has been increasing. In our institute, KPC-producing K. pneumoniae was the most frequently isolated CPE in the recent 4 years. CPE including KPC producers can easily transfer their resistance. Therefore continuous monitoring and more intensified infection control for CPE should be considered.

Keywords: Beta-lactamase KPC, Carbapenem resistance, Enterobacteriaceae, Klebsiella pneumoniae

References

1. Nordmann P, Naas T, Poirel L. Global spread of carbapenemase-producing Enterobacteriaceae. Emerg Infect Dis. 2011; 17:1791–8.

2. Pitout JD. Infections with extended-spectrum beta-lactamase-producing Enterobacteriaceae: changing epidemiology and drug treatment choices. Drugs. 2010; 70:313–33.

3. CDC. Antibiotic Resistance Threats in the United States, 2013. http://www.cdc.gov/drugresistance/threat-report-2013/. [Online] (last visited on 1 November 2015).

4. Nordmann P, Cuzon G, Naas T. The real threat of Klebsiella pneumoniae carbapenemase-producing bacteria. Lancet Infect Dis. 2009; 9:228–36.

5. Tzouvelekis LS, Markogiannakis A, Psichogiou M, Tassios PT, Daikos GL. Carbapenemases in Klebsiella pneumoniae and other Enterobacteriaceae: an evolving crisis of global dimensions. Clin Microbiol Rev. 2012; 25:682–707.

6. Park JW, Lee EJ, Lee DH. Status of carbapenemase producing Enterobacteriaceae in Korea, 2014. Public Health Weekly Report. 2016; 9:9–13.

7. Ko KS, Lee JY, Baek JY, Suh JY, Lee MY, Choi JY, et al. Predominance of an ST11 extended-spectrum beta-lactamase-producing Klebsiella pneumoniae clone causing bacteraemia and urinary tract infections in Korea. J Med Microbiol. 2010; 59:822–8.

8. Kim SY, Shin J, Shin SY, Ko KS. Characteristics of carbapenem-resistant Enterobacteriaceae isolates from Korea. Diagn Microbiol Infect Dis. 2013; 76:486–90.

9. Kim MN, Yong D, An D, Chung HS, Woo JH, Lee K, et al. Nosocomial clustering of NDM-1-producing Klebsiella pneumoniae sequence type 340 strains in four patients at a South Korean tertiary care hospital. J Clin Microbiol. 2012; 50:1433–6.

10. CLSI. Performance standards for antimicrobial susceptibility testing: twenty-fifth informational supplement. CLSI document M100-S25. Wayne, PA: Clinical and Laboratory Standards Institute;2015.

11. Breakpoint tables for interpretation of MICs and zone diameters. EUCAST (The European Committee on Antimicrobial Susceptibility Testing). http://www.eucast.org/[Online. ] (last visited on 1 November 2015).

12. Diancourt L, Passet V, Verhoef J, Grimont PA, Brisse S. Multilocus sequence typing of Klebsiella pneumoniae nosocomial isolates. J Clin Microbiol. 2005; 43:4178–82.

13. Gona F, Barbera F, Pasquariello AC, Grossi P, Gridelli B, Mezzatesta ML, et al. In vivo multiclonal transfer of bla _KPC-3 from Klebsiella pneumoniae to Escherichia coli in surgery patients. Clin Microbiol Infect. 2014; 20:O633–5.

14. Goren MG, Carmeli Y, Schwaber MJ, Chmelnitsky I, Schechner V, Navon-Venezia S. Transfer of carbapenem-resistant plasmid from Klebsiella pneumoniae ST258 to Escherichia coli in patient. Emerg Infect Dis. 2010; 16:1014–7.

15. Tijet N, Muller MP, Matukas LM, Khan A, Patel SN, Melano RG. Lateral dissemination and inter-patient transmission of bla _KPC-3: role of a conjugative plasmid in spreading carbapenem resistance. J Antimicrob Chemother. 2016; 71:344–7.

16. Mathers AJ, Cox HL, Kitchel B, Bonatti H, Brassinga AK, Carroll J, et al. Molecular dissection of an outbreak of carbapenem-resistant Enterobacteriaceae reveals intergenus KPC carbapenemase transmission through a promiscuous plasmid. MBio. 2011; 2:e00204–11.

17. Richter SN, Frasson I, Bergo C, Parisi S, Cavallaro A, Palù G. Transfer of KPC-2 carbapenemase from Klebsiella pneumoniae to Escherichia coli in a patient: first case in Europe. J Clin Microbiol. 2011; 49:2040–2.

18. Chen L, Mathema B, Chavda KD, DeLeo FR, Bonomo RA, Kreiswirth BN. Carbapenemase-producing Klebsiella pneumoniae: molecular and genetic decoding. Trends Microbiol. 2014; 22:686–96.

19. Monaco M, Giani T, Raffone M, Arena F, Garcia-Fernandez A, Pollini S. Colistin resistance superimposed to endemic carbapenem-resistant Klebsiella pneumoniae: a rapidly evolving problem in Italy, November 2013 to April 2014. Euro Surveill. 2014; 19.

20. Tumbarello M, Trecarichi EM, De Rosa FG, Giannella M, Giacobbe DR, Bassetti M, et al. Infections caused by KPC-producing Klebsiella pneumoniae: differences in therapy and mortality in a multicentre study. J Antimicrob Chemother. 2015; 70:2133–43.

21. Miriagou V, Cornaglia G, Edelstein M, Galani I, Giske CG, Gniadkowski M, et al. Acquired carbapenemases in Gram-negative bacterial pathogens: detection and surveillance issues. Clin Microbiol Infect. 2010; 16:112–22.

22. Docquier JD, Calderone V, De Luca F, Benvenuti M, Giuliani F, Bellucci L, et al. Crystal structure of the OXA-48 beta-lactamase reveals mechanistic diversity among class D carbapenemases. Chem Biol. 2009; 16:540–7.

23. Doi Y and Paterson DL. Carbapenemase-producing Enterobacteriaceae. Semin Respir Crit Care Med. 2015; 36:74–84.

24. Song W, Jeong SH, Lee J, Lee SS, Lee K. Emergence and spread of OXA-48-like carbapenemase-producing Enterobacteriaceae. Korean J Nosocomial Infect Control. 2015; 20:7–18.

25. Chen L, Chavda KD, Mediavilla JR, Zhao Y, Fraimow HS, Jenkins SG, et al. Multiplex realtime PCR for detection of an epidemic KPC-producing Klebsiella pneumoniae ST258 clone. Antimicrob Agents Chemother. 2012; 56:3444–7.

26. Wang Q, Li B, Tsang AK, Yi Y, Woo PC, Liu CH. Genotypic analysis of Klebsiella pneumoniae isolates in a Beijing Hospital reveals high genetic diversity and clonal population structure of drug-resistant isolates. PLoS One. 2013; 8:e57091.

27. Damjanova I, Tóth A, Pászti J, Hajbel-Vékony G, Jakab M, Berta J, et al. Expansion and countrywide dissemination of ST11, ST15 and ST147 ciprofloxacin-resistant CTX-M-15-type beta-lactamase-producing Klebsiella pneumoniae epidemic clones in Hungary in 2005–the new ‘MRSAs’? J Antimicrob Chemother. 2008; 62:978–85.

28. Qi Y, Wei Z, Ji S, Du X, Shen P, Yu Y. ST11, the dominant clone of KPC-producing Klebsiella pneumoniae in China. J Antimicrob Chemother. 2011; 66:307–12.

29. Castanheira M, Farrell SE, Wanger A, Rolston KV, Jones RN, Mendes RE. Rapid expansion of KPC-2-producing Klebsiella pneumoniae isolates in two Texas hospitals due to clonal spread of ST258 and ST307 lineages. Microb Drug Resist. 2013; 19:295–7.

30. Park DJ, Yu JK, Park KG, Park YJ. Genotypes of ciprofloxacin-resistant Klebsiella pneumoniae in Korea and their characteristics according to the genetic lineages. Microb Drug Resist. 2015; 21:622–30.

31. Johnson JK, Arduino SM, Stine OC, Johnson JA, Harris AD. Multilocus sequence typing compared to pulsed-field gel electrophoresis for molecular typing of Pseudomonas aeruginosa. J Clin Microbiol. 2007; 45:3707–12.

32. Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE, Persing DH, et al. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol. 1995; 33:2233–9.

Fig. 1.

The number of carbapenemase-producing Enterobacteriaceae isolates and carbapenemase types reported annually.

Fig. 2.

KPC-producing Klebsiella pneumoniae dendrogram based on Pulsed-field gel electrophoresis (PFGE) pattern and their sequence type. Abbreviation: ST, sequence type.

Table 1.

Primers used for carbapenemase gene PCR

Gene		Primer sequence	Amplicon size
KPC	Forward	TGGACACACCCATCCGTTAC	500 bp
	Reverse	GACGGCCAACACAATAGGTG
VIM	Forward	TTTGATTGATACAGCGTGG	459 bp
	Reverse	TGCTTCCGGGTAGTG
IMP	Forward	CATGGTTTGGTGGTTCTTGT	448 bp
	Reverse	ATAATTTGGCGGACTTTGGC
NDM	Forward	CAATATTATGCACCCGGTCG	726 bp
	Reverse	ATCATGCTGGCCTTGGGGAA
OXA	Forward	TTGGTGGCATCGATTATCGG	744 bp
	Reverse	GAGCACTTCTTTTGTGATGG

Table 2.

Gene loci included in the Klebsiella pneumoniae Multilocus sequence typing scheme and PCR primers

Locus	Putative function of gene	Primer sequence	Size (bp)	Number of alleles
rpoB	Beta-subunit of RNA polymerase B	(F) VIC3: GGCGAAATGGCWGAGAACCA	501	8
		(R) VIC2: GAGTCTTCGAAGTTGTAACC
gapA	Glyceraldehyde 3-phosphate	(F) 173: TGAAATATGACTCCACTCACGG	450	6
	dehydrogenase	(R) 181: CTTCAGAAGCGGCTTTGATGGCTT
mdh	Malate dehydrogenase	(F) 130: CCCAACTCGCTTCAGGTTCAG	477	10
		(R) 867: CCGTTTTTCCCCAGCAGCAG
pgi	Phosphoglucose isomerase	(F) 1R: GAGAAAAACCTGCCTGTACTGCTGGC	432	6
		(R) IF: CGCGCCACGCTTTATAGCGGTTAAT
phoE	Phosphoporine E	(F) 604.1: ACCTACCGCAACACCGACTTCTTCGG	420	14
		(R) 604.2: TGATCAGAACTGGTAGGTGAT
infB	Translation initiation factor 2	(F) 1F: CTCGCTGCTGGACTATATTCG	318	10
		(R) 1R: CGCTTTCCAGCTCAAGAACTTC
tonB	Periplasmic energy transducer	(F) 1F: CTTTATACCTCGGTACATCAGGTT	414	21
		(R) 2R: ATTCGCCGGCTGRGCRGAGAG

Abbreviations: (F), forward; (R), reverse.

Table 3.

Clinical features of 25 carbapenemase-producing Enterobacteriaceae isolates

Isolate	Year	Age	Sex	Admitted from	Reason for Admission	Interval from admission to positive culture (days)	Source	Infection or colonization	Outcome
1	2011	74	F	Home	Congestive heart failure	16	Blood	Infection	Expired
2	2011	55	F	Home	Pulmonary thromboembolism	23	Urine	Colonization	Expired
3	2013	57	M	Home	Hematochezia	3	Blood	Infection	Expired
4	2013	72	M	Home	Dyspnea	6	Sputum	Infection	Expired
5	2013	56	M	Home	Hepatocellular carcinoma	4	Blood	Infection	Discharged
6	2014	61	F	Home	Vesicovaginal fistula	133	Urine	Infection	Discharged
7	2014	84	F	Hospital A	Perforation of small bowel	2	Blood	Infection	Expired
8	2014	73	M	Home	Intracranial hemorrhage	0	Sputum	Colonization	Discharged
9	2014	72	M	Hospital B	Quadriplegia	72	Sputum	Infection	Transfered
10	2015	81	M	Home	Aspiration pneumonia	129	Endotracheal aspirate	Colonization	Expired
11	2015	60	F	Home	Lateral medullary infarction	12	Sputum	Colonization	Discharged
12	2015	47	M	Hospital C	Brain death donor	0	Endotracheal tube tip	Colonization	Expired
13	2015	69	F	Hospital C	Hematochezia	5	Drainage Buttock	Infection	Transfered
14	2015	70	M	Hospital D	Middle cerebral artery infarction	28	Peritoneal fluid	Infection	Discharged
15	2015	78	M	Home	Traumatic subdural hemorrhage	77	Stool CRE culture	Colonization	Transfered
16	2015	0	F	Hospital E	Neonatal jaundice	0	Stool CRE culture	Colonization	Discharged
17	2015	70	M	Hospital D	Middle cerebral artery infarction	79	Stool CRE culture	Colonization	Discharged
18	2015	52	F	Home	Choroid plexus carcinoma	53	Urine	Colonization	Discharged
19	2015	23	F	Hospital F	Tuberculous meningoencephalitis	21	Urine	Colonization	Transfered
20	2015	71	M	Home	Acute pulmonary edema	3	Drainage Foot	Colonization	Discharged
21	2015	1	F	Home	Sepsis	22	Stool CRE culture	Colonization	Discharged
22	2015	55	M	Home	Klatskin's tumor	48	Bile	Infection	Discharged
23	2015	57	F	Hospital G	Pancreatic cancer, head	30	Bile	Infection	Discharged
24	2015	48	F	Hospital H	Cellulitis	13	Urine	Colonization	On admission
25	2015	68	M	Home	Hepatocellular carcinoma	31	Stool CRE culture	Colonization	Discharged

Table 4.

Antimicrobial susceptibility, sequence type and plasmid characteristics of 25 carbapenemase-producing Enterobacteriaceae isolates

TOOLS

Similar articles