Journal List > Ann Clin Microbiol > v.16(1) > 1078486

Kim, Jeon, Kim, Kim, and Lee: Genetic Characteristics and Relatedness of Imported Vibrio cholerae O1 Biotype El Tor in Korea

초록

Background

Cholera is a representative water-borne disease that is caused by V. cholera ctx (+). V. cholera El Tor was previously the primary pathogen, but after the seventh pandemic outbreak, it was replaced by a V. cholera El Tor variant with a classical pheno-type and genotype. In this study, we investigated the genotypic and phenotypic characteristics of imported V. cholerae El Tor in Korea.

Methods

Forty-nine V. cholerae O1 El Tor strains isolated from 2004 to 2011 were used in this study. Polymerase chain reaction amplification of the ctxB and rstR genes was used for biotype determination. An antimicrobial susceptibility test was performed for phenotypic analysis, and pulse field gel electropho-resis (PFGE) was used for analysis of genetic relatedness.

Results

Classical ctxB genes were found in all of the isolates, while classical, El Tor, and combined rstRgenes were found. Twenty strains showed antimicrobial resistance against streptomycin, sulfamethoxazole/ trimethoprim, nalidixic acid, and ciprofloxacin. Based on PFGE, all isolates were grouped as cluster B. The country of origin and resistance pattern were highly related, although the time of influx and serogroup were not.

Conclusion

Isolates of V. cholera El Tor imported since 2004 were hybrids of V. cholera El Tor, which has the classical ctxB gene and is considered to be a CTX prophage. The SXT element plays an important role in antimicrobial resistance. PFGE patterns, which can be used for analysis of imported V. cholera, revealed the relatedness of the resistant isolates.

REFERENCES

1.Kaper JB., Morris JG Jr., Levine MM. Cholera. Clin Microbiol Rev. 1995. 8:48–86.
crossref
2.Kim SH. Prevention and Management of Cholera. Agreement of Biological Weapon Restriction. Seoul. 2007. 23–30.
3.Chin CS., Sorenson J., Harris JB., Robins WP., Charles RC., Jean- Charles RR, et al. The origin of the Haitian cholera outbreak strain. N Engl J Med. 2011. 364:33–42.
crossref
4.Nguyen BM., Lee JH., Cuong NT., Choi SY., Hien NT., Anh DD, et al. Cholera outbreaks caused by an altered Vibrio cholerae O1 El Tor biotype strain producing classical cholera toxin B in Vietnam in 2007 to 2008. J Clin Microbiol. 2009. 47:1568–71.
5.Safa A., Nair GB., Kong RY. Evolution of new variants of Vibrio cholerae O1. Trends Microbiol. 2010. 18:46–54.
6.Alam M., Nusrin S., Islam A., Bhuiyan NA., Rahim N., Delgado G, et al. Cholera between 1991 and 1997 in Mexico was associated with infection by classical, El Tor, and El Tor variants of Vibrio cholerae. J Clin Microbiol. 2010. 48:3666–74.
7.Nair GB., Qadri F., Holmgren J., Svennerholm AM., Safa A., Bhuiyan NA, et al. Cholera due to altered El Tor strains of Vibrio cholerae O1 in Bangladesh. J Clin Microbiol. 2006. 44:4211–3.
8.Raychoudhuri A., Mukhopadhyay AK., Ramamurthy T., Nandy RK., Takeda Y., Nair GB. Biotyping of Vibrio cholerae O1: time to redefine the scheme. Indian J Med Res. 2008. 128:695–8.
9.Choi SY., Lee JH., Kim EJ., Lee HR., Jeon YS., von Seidlein L, et al. Classical RS1 and environmental RS1 elements in Vibrio cholerae O1 El Tor strains harbouring a tandem repeat of CTX prophage: revisiting Mozambique in 2005. J Med Microbiol. 2010. 59:302–8.
10.Nusrin S., Khan GY., Bhuiyan NA., Ansaruzzaman M., Hossain MA., Safa A, et al. Diverse CTX phages among toxigenic Vibrio cholerae O1 and O139 strains isolated between 1994 and 2002 in an area where cholera is endemic in Bangladesh. J Clin Microbiol. 2004. 42:5854–6.
11.Ghosh A., Ramamurthy T. Antimicrobials & cholera: are we stranded? Indian J Med Res. 2011. 133:225–31.
12.Burrus V., Marrero J., Waldor MK. The current ICE age: biology and evolution of SXT-related integrating conjugative elements. Plasmid. 2006. 55:173–83.
crossref
13.Dalsgaard A., Forslund A., Sandvang D., Arntzen L., Keddy K. Vibrio cholerae O1 outbreak isolates in Mozambique and South Africa in 1998 are multiple-drug resistant, contain the SXT element and the aadA2 gene located on class 1 integrons. J Antimicrob Chemother. 2001. 48:827–38.
14.Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing; Twenty-first Informational Supplement. Document M100-S20. Wayne, PA; Clinical and Laboratory Standards Institute. 2011.
15.Kim SH., Kim JY., Kang YH., Park YK., Lee BK. Pulsed-field gel electrophoresis-based molecular typing reveals a shift in the major type of Vibrio cholerae O1 isolated in Korea. J Microbiol Biotechnol. 2006. 16:1814–8.
16.Goel AK., Jain M., Kumar P., Jiang SC. Molecular characterization of Vibrio cholerae outbreak strains with altered El Tor biotype from southern India. World J Microbiol Biotechnol. 2010. 26:281–7.
17.Goel AK., Jain M., Kumar P., Sarguna P., Bai M., Ghosh N, et al. Molecular characterization reveals involvement of altered El Tor biotype Vibrio cholerae O1 strains in cholera outbreak at Hyderabad, India. J Microbiol. 2011. 49:280–4.
18.Na-Ubol M., Srimanote P., Chongsa-Nguan M., Indrawattana N., Sookrung N., Tapchaisri P, et al. Hybrid & El Tor variant biotypes of Vibrio cholerae O1 in Thailand. Indian J Med Res. 2011. 133:387–94.
19.Lee JH., Han KH., Choi SY., Lucas ME., Mondlane C., Ansaruzzaman M, et al. Mozambique Cholera Vaccine Demonstration Project Coordination Group. Multilocus sequence typing (MLST) analysis of Vibrio cholerae O1 El Tor isolates from Mozambique that harbour the classical CTX prophage. J Med Microbiol. 2006. 55:165–70.
20.Garg P., Sinha S., Chakraborty R., Bhattacharya SK., Nair GB., Ramamurthy T, et al. Emergence of fluoroquinolone-resistant strains of Vibrio cholerae O1 biotype El Tor among hospitalized patients with cholera in Calcutta, India. Antimicrob Agents Chemother. 2001. 45:1605–6.
21.Okoh AI., Igbinosa EO. Antibiotic susceptibility profiles of some Vibrio strains isolated from wastewater final effluents in a rural community of the Eastern Cape Province of South Africa. BMC Microbiol. 2010. 10:143.

Fig. 1.
Dendrogram of Not I-digested PFGE patterns V. cholerae O1 El Tor strains. PFGE pattern is grouped as cluster B and showing high similarity with their imported nation (90%) and antimicrobial resistance pattern (92%).
acm-16-25f1.tif
Table 1.
Distribution of V. cholerae according to countries of origin and time of influx
Year* Countries of origin
Philippines Thailand Vietnam India Indonesia China Cambodia Total
2004 4 0 0 1 0 0 0 5
2005 8 7 0 1 1 0 0 17
2006 4 1 0 0 1 0 0 6
2007 3 2 0 1 0 0 0 6
2008 3 0 0 1 0 0 0 4
2010 0 0 3 1 3 0 1 8
2011 1 0 0 1 0 1 0 3
Total 23 10 3 6 5 1 1 49

V. cholerae O1 was not isolated in 2009.

Table 2.
Oligonucleotide sequences used in this study to detect ctx, rst & sxt
Primers Sequences (5’→3’) References
ctxBF CGAACCACAAAAAAGCCCAC In this study
ctxBR TGCGATGAAAAAACCCAAAGTC  
rstRETF TGAGCATAAGCTCTTGATTT Choi et al. [9]
rstRETR AAGGCTAGCCAACCAAAGAAAGG  
rstRclaF CAGCAAAGCCTCCATCAAAA Choi et al. [9]
rstRclaR GTTCAAAAATTAGGGATTTAAGAG TTGAG  
rstREnvF GCTTCATTTGTGTATTGGTCTATTA GGTAGTTA Choi et al. [9]
rstREnvR TCGAGTTGTAATTCATCAAGAGTG AAAA  
rstRCalF TCAAGCTTTTTTTTGCTTTATCTTA Choi et al. [9]
rstRCalR TGGCAACAAAGCACATTAAAGA  
rstRCF GATGTTTACGATAGCCTAGAAGAC TT Choi et al. [9]
rstRCR TACAGTGATGGCTCAGTCAATGC  
sxt1 GCTGGATAGGTTAAGGGCGG Dalsgaard et al.
sxt2 CTCTATGGGCACTGTCCACATTG [13]
Table 3.
Genetic characteristics of V. cholerae O1 El Tor in Korea from 2004 to 2011 by country
No. Year Country ctxB sequence type rstR type RS1 element SXT element
El Cla Env Cal rstC SXT
199200959 1992 Unknwon El Tor + - - - + -
199401070 1994 Thailand Classical + + - - + -
200101761 2001 Korea Classical + - - - + -
200413555 2004 India Classical - + - - - -
200416840 2004 Philippines Classical + + - - + -
200418292 2004 Philippines Classical + + - - + -
200420067 2004 Philippines Classical + + - - + -
200420068 2004 Philippines Classical + + - - + -
200501876 2005 Indonesia Classical - + - - - -
200512188 2005 Philippines Classical + + - - + -
200514306 2005 Thailand Classical + - - - + +
200514307 2005 Thailand Classical + - - - + +
200514308 2005 Thailand Classical + - - - + +
200514309 2005 Thailand Classical + - - - + +
200514310 2005 Thailand Classical + - - - + +
200514311 2005 Thailand Classical + - - - + +
200514312 2005 Thailand Classical + - - - + +
200516521 2005 Philippines Classical + - - - + -
200516946 2005 India Classical + + - - + +
200517010 2005 Philippines Classical + + - - + -
200517173 2005 Philippines Classical + + - - + -
200518295 2005 Philippines Classical + + - - + -
200518631 2005 Philippines Classical + + - - + -
20051E171 2005 Philippines Classical + + - - + -
20051E453 2005 Philippines Classical - + - - - -
200600448 2006 Philippines Classical - + - - - -
200600494 2006 Philippines Classical + + - - + -
200600495 2006 Philippines Classical + + - - + -
200600585 2006 Thailand Classical + + - - + -
200600586 2006 Indonesia Classical + + - - + -
200600654 2006 Philippines Classical + + - - + -
200700448 2007 Philippines Classical + + - - + -
200701544 2007 India Classical + - - - + +
200704648 2007 Thailand Classical + - - - + +
200704649 2007 Thailand Classical + + - - + +
200709509 2007 Philippines Classical - + - - - -
200709510 2007 Philippines Classical - + - - - -
200800020 2008 Philippines Classical + + - - + -
200803505 2008 India Classical + - - - + +
200803983 2008 Philippines Classical + + - - + -
200804066 2008 Philippines Classical + + - - + -
201000167 2010 Indonesia Classical - + - - - -
201000747 2010 Indonesia Classical - + - - - -
201000748 2010 Vietnam Classical + + - - + +
201000749 2010 India Classical + + - - + +
201000882 2010 Indonesia Classical - + - - - -
201001254 2010 Vietnam Classical + - - - + +
201001451 2010 Cambodia Classical + - - - + +
201001602 2010 Vietnam Classical + - - - + +
201101054 2011 India Classical + + - - + +
201101575 2011 Philippines Classical + - - - + -
201101625 2011 China Classical + - - - + +

Abbreviations: SXT, sulfamethoxazole/trimethoprim; El, El Tor; Cla, classical; Env, environmental; Cal, calcutta.

Table 4.
Genotypic characteristics of V. cholerae O1 El Tor in Korea from 2004 to 2011 by country
Year Genetic type (No. of isolates)*
Philippines Thailand Vietnam India Indonesia China Cambodia
2004 rstR-El,rstR-cla, rstC (4) rstR-cla (1)      
2005 rstR-El,rstR-cla, rstC (6) rstR-El,rstC, SXT (7) rstR-El,rstR-cla, rstC,SXT (1) rstR-cla (1)
rstR-El, rstC (1)
rstR-cla (1)
2006 rstR-El,rstR-cla, rstC (3) rstR-El,rstR-cla, rstC (1)
rstR-cla (1)
2007 rstR-El,rstR-cla, rstC (1) rstR-El,rstC, SXT (1) rstR-El,rstC, SXT (1)
rstR-cla (2) rstR-El,rstR-cla, rstC,SXT (1)
2008 rstR-El,rstR-cla, rstC (3) rstR-El,rstC, SXT (1)
2010 rstR-El,rstR-cla, rstR-El,rstR-cla, rstR-cla (3)  rstR-El,rstC,
rstC,SXT (1) rstR-El,rstC, SXT (2) rstC,SXT (1) SXT (1)
2011 rstR-El,rstC (1) rstR-El,rstR-cla, rstC,SXT (1) rstR-El,rstC, SXT (1)

Abbreviations: El, El Tor; SXT, sulfamethoxazole/trimethoprim.

Table 5.
Antibiogram of V. cholera O1 El Tor based on countries or origin and time of influx
Year Antibiogram (No. of isolates)*
Philippines Thailand Vietnam India Indonesia China Cambodia
2004              
2005   S,SXT,NA,CIP (7)   S,SXT,NA,CIP (1)      
2006              
2007   S,SXT,NA,CIP (2)   NA,CIP (1)      
               
2008 S,SXT,NA,CIP (1)     S,SXT,NA,CIP (1)      
2010     S,SXT,NA,CIP (3) S,SXT,NA,CIP (1)     S,SXT,NA,CIP (1)
2011       S,SXT,NA,CIP (1)   S,SXT,NA,CIP (1)  

Abbreviations: S, streptomycin; SXT, sulfamethoxazole/trimethoprim; NA, nalidixic acid; CIP, ciprofloxacin.

TOOLS
Similar articles