Male Sprague-Dawley rats (weight, 250-300 g; Orient Bio Co., Seoul, Korea) were used. Animals were anesthetized with an intraperitoneal injection of ketamine (75 mg/kg body wt). After the abdomen was opened with a midline incision, UUO was performed by ligating the left ureter with 4.0 silk. Sham-operated animals were used to obtain control kidneys, and rats were killed at days 1, 3, 5, 7, 14, 21, and 28 after the operation. In total, we used 84 animals; two sham and 10 UUO, five for a morphological study, and five for immunoblotting were included at each time point.

The kidneys were perfused with phosphate-buffered saline (PBS) briefly through the abdominal aorta and subsequently were fixed by in vivo perfusion with a periodate-lysine-paraformaldehyde (PLP) solution for 10 minutes. They were cut into sagittal slices and then immersed in PLP overnight at 4℃. After a rinse in PBS, the tissues were dehydrated in a graded ethanol series, embedded in wax (polyethylene glycol 400 disterate, Polysciences Inc., Warrington, PA, USA), and 5-µm thick sections were prepared for in situ hybridization. PLP-fixed tissues were cut on a vibratome (Lancer Vibratomes Series 1000, Technical Products International, St. Louis, MO, USA) to a thickness of 50 µm for immunohistochemistry.

Immunohistochemistry using a pre-embedded method was conducted, as described previously [11]. The 50-µm thick vibratome sections were washed with 50 mM NH₄Cl in PBS. Before incubation with a primary antibody, the tissue sections were incubated for 3 hours with PBS containing 1% bovine serum albumin, 0.05% saponin, and 0.2% gelatin (solution A). Tissue sections were then incubated overnight at 4℃ with a polyclonal antibody against CNTF (1 : 1,500, Cedarlane Lab., Burlington, ON, Canada) in PBS containing 1% bovine serum albumin (solution B). After washes with solution A, the tissue sections were incubated for 2 hours with peroxidase-conjugated donkey anti-rabbit IgG Fab fragment (Jackson ImmunoResearch Laboratories, West Grove, PA, USA), diluted 1 : 100 in solution B. The tissues were then rinsed, first in solution A and subsequently in 0.05 M Tris buffer (pH 7.6). The sections were incubated in 0.1% 3,3'-diaminobenzidine in 0.05 M Tris buffer for 5 minutes to detect horseradish peroxidase, after which H₂O₂ was added to a final concentration of 0.01%, and the incubation was continued for 10 minutes. After the sections were washed with 0.05 M Tris buffer, they were dehydrated in a graded ethanol series and embedded in Epon-812. The embedded 50-µm thick sections were examined, and 1-µm semi-thin sections were cut and photographed with an Olympus photomicroscope (Tokyo, Japan) equipped with differential-interference contrast optics.

The cortical, outer medullary, and inner medullary renal tissues were separated from PBS-perfused kidneys and used for protein extraction. Tissues were homogenized in a buffer containing 20 mM Tris-HCl (pH 7.6), 150 mM NaCl, 0.5% (w/v) sodium deoxycholate, 1% (v/v) Triton X-100, 0.1% (v/v) sodium dodecyl sulfate (SDS), 0.02% (v/v) sodium azide, 1 mM ethylenediaminetetraacetic acid fresh leupeptin (1 µg/ml), and phenylmethylsulfonyl fluoride (1 mM). Homogenates were centrifuged at 16,000 ×g for 15 minutes at 4℃, and protein concentrations were determined in supernatants using the Bradford method protein microassay (Bio-Rad, Hercules, CA, USA). Homogenates were boiled for 5 minutes in Laemmli sample buffer. Proteins were separated by SDS-polyacrylamide gel electrophoresis on 15% polyacrylamide gels and were electroblotted onto Bio-Blot nitrocellulose membranes (Costar, Cambridge, MA, USA). Nonspecific binding was blocked by incubating the blots for 1 hour in 5% (w/v) nonfat milk. CNTF protein was detected with a polyclonal anti-CNTF antibody (1 : 15,000, Cedarlane Lab.) with an overnight incubation. The primary antibody incubation was followed by six washes with PBS containing 0.1% Tween 20. The blots were then incubated with peroxidase-conjugated donkey anti-rabbit CNTF IgG for 2 hours. Antibody-reactive protein was detected using an enhanced chemiluminescence kit (Amersham Life Science, Buckinghamshire, UK). Densitometric analysis was performed using Imagemaster VDS software (Pharmacia Biotech, Piscataway, NJ, USA).

Total RNA was extracted from the kidney using TRIZOL reagent (Life Technologies Inc., Carlsbad, CA, USA), and reverse transcribed using the oligo(dT) primer and Superscript II RNase H-reverse transcriptase (Life Technologies), followed by polymerase chain reaction (PCR)-amplification using specific primers (sense, GCTGTGACCTGGAGGGTAAA; antisense, GTGATAGCCGTGGTGTTGTG; probe length, 425 bp; Gene Bank S54212). The reverse trancscription-PCR product was cloned into the T-Easy Vector (Promega, Madison, WI, USA) and sequenced. The digoxygenin (DIG)-labeled sense and antisense CNTFRα riboprobes were prepared by in vitro transcription using a DIG RNA labeling kit (Boehringer, Mannheim, Germany). The specificity of the antisense CNTFRα riboprobe was confirmed by Northern blot (by Prof. JH Youn, Dept. Anatomy, Hanyang University, Medical College, Korea).

After dewaxing, the sections were treated in 0.2 N HCl for 10 minutes and incubated in 20 µg/ml pepsin (0.1 N HCl) for 10 minutes at room temperature, followed by three washes with PBS. Prehybridization and hybridization steps were carried out at 58℃ for 1 hour and 15 hours, respectively. The prehybridization buffer was composed of 50% formamide, 4× sodium chloride/sodium citrate, 10% dextran sulfate, 1× Denhardt's solution, and 1 µg/µl salmon sperm DNA. The hybridization buffer was identical to the prehybridization buffer except that salmon sperm DNA was substituted with 400 ng/µl CNTFRα riboprobe. After posthybridization washing, the sections were incubated with anti-DIG antiserum conjugated with alkaline phosphatase (Boehringer), and histochemical detection was performed using a 4-nitroblue tetrazolium chloride/5-bromo-4-chloro-3-indolyl-phosphate mixture (Boehringer).

Data are reported as mean±standard deviation. Sham-operation data were used as a control reference. Comparisons between these data and those for UUO rats were analyzed using an analysis of variance and Dunnett's post hoc test. A P<0.05 indicated statistical significance.

From UUO day 21, the length of the outer and inner medulla including renal papilla decreased extremely (Figs. 1G, H, 5G, H). However, many cortical tubular cells and glomeruli maintained their normal structure until day 28 (Fig. 2F).

No CNTF immunoreactivity was detected in the cortex or OSOM in sham-operated rat kidneys (Figs. 1A, 2A). CNTF immunoreactivity was observed only in the tubular profiles in the inner stripe of the outer medulla (ISOM) and the proximal half of the inner medulla (IM) (Fig. 1A); that is, the descending thin limb (DTL) of the loop of Henle (Figs. 2B, 3A).

In the UUO rats, CNTF expression began to appear in the OSOM on day 1 (Figs. 1B, 2C). On day 3, CNTF expression extended to the cortex along the medullary ray and progressively expanded into the cortex and the OSOM up to day 7 (Fig. 1C-E). Subsequently, CNTF expression decreased slightly, but upregulated CNTF expression was maintained until day 28, particularly in the OSOM (Fig. 1H).

Strong CNTF expression was observed partly in convoluted proximal tubules (cPT) and distal tubules (DT) of the cortex in UUO rat kidneys from days 3 to 14 (Fig. 2D), but with weak intensity on days 21 and 28 (Fig. 3C). Furthermore, the parietal epithelial cells (PEC) of Bowman's capsule (Fig. 3C) were CNTF immunoreactive, but CNTF immunoreactivity was not observed in the glomerulus. Strong induction of the CNTF protein was observed in most of the S3 segments (S3s) of the PTs in the OSOM (Fig. 2C, E) after UUO. The CNTF-positive cells of the S3s (arrows in Fig. 3B) usually had poor or no brush borders, in contrast to CNTF-negative cells (arrowheads in Fig. 3B) with well-developed brush borders. In the ISOM, no CNTF-positive tubules were detected except in the DTL, which showed no change in CNTF immunoreactivity throughout the experiment (Fig. 1A-H). No CNTF-positive tubules were detected in the IM except in the DTL (Fig. 3D). However, from day 14, weak to moderate CNTF expression began to appear in the inner medullary collecting duct (IMCD) (Fig. 3E, F), and such CNTF expression increased until day 28.

CNTF protein expression in the cortex and OM began to increase on days 1 to 3 and was maximal on days 7 to 14 after UUO. It then decreased slightly but sustained high expression up to day 28 (Fig. 4A, B). CNTF protein expression in the IM increased slightly (Fig. 4C).

A very faint CNTF protein band was detected in sham-operated rat kidney cortex (Fig. 4A). CNTF protein began to increase on day 1 and was maximum on day 14 in UUO rats. The relative optical densities in each lane were as follows: day 1, 507%; day 3, 2,212%; day 5, 6,978%; day 7, 9,534%; day 14, 10,467%; day 21, 9,701%; and day 28, 8,553%. The CNTF expression pattern in the OM was similar to that of the cortex (Fig. 4B). The relative optical densities of the CNTF protein were as follows: day 1, 104%; day 3, 130%; day 5, 155%; day 7, 163%; day 14, 149%; day 21, 143%; and day 28, 128%. The relative optical densities of the CNTF protein in the IM (Fig. 4C) were as follows: day 1, 101%; day 3, 103%; day 5, 149%; day 7, 121%; day 14, 121%; day 21, 133%; and day 28, 114%.

Northern blot using P³²-labeled antisense CNTFRα revealed a strong band between 18S and 28S (Fig. 8), which was identical with previous results [12]. After confirming the specificity of our riboprobe, we used a non-isotope DIG labeling method for in situ hybridization.

In sham-operated rat kidneys, the CNTFRα mRNA hybridization signal was detected weakly in the DTL, the thick ascending limb (TAL), the DT, and in some S3s cells (Fig. 6A, B) but was hardly expressed in the IM (Figs. 5A, 6C).

CNTFRα mRNA expression began to increase in the TAL (Fig. 5B) as early as day 1 in UUO rats, and CNTFRα mRNA expression increased in almost all parts of kidney, including the IM, up to day 7 (Fig. 5C-E). Thereafter, the CNTFRα mRNA signal decreased slightly but remained upregulated until day 28 (Fig. 5H).

The CNTFRα mRNA signal was partly observed in the cPT, the PEC with moderate intensity, and many DT with strong intensity in the cortex of UUO rats (Fig. 7A). However, the CNTFRα signal decreased markedly in the outer cortex on day 28 (Fig. 5H). The most prominent increase in the signal (Fig. 5B-E) occurred in the S3s and TAL of the ISOM and OSOM (Fig. 6D, F). This increased expression was maintained until day 28 (Fig. 7C, E). The OMCD showed moderately induced CNTFRα expression (Figs. 6F, 7C-E). The CNTFRα mRNA signal increased from day 1 in the IMCD, and such induction was observed in all experimental groups including the day-28 group (Figs. 6E, F, 7B, F).