Female (n=30) Sparague-Dawley rats (250 g, Gyeongsang National University Neurobiology Laboratory, Jinju, Korea) were housed in a temperature-controlled environment with lights on from 6:00-20:00 h and food ad libitum. Pregnant rats were killed by ethyl ether anesthesia at gestational day (GD) 17.5 of fetal development.

Primary hippocampal cultures were prepared from brains of GD 17.5 fetuses. Hippocampal tissues were treated with 0.25% trypsin-EDTA for 20 minutes and dissociated by mechanical trituration in ice-cold calcium- and magnesium-free Hank's balanced salt solution. After pelleting by centrifugation, cells were plated (1×10⁶ cells/ml) in cell culture plates pre-coated with poly-lysine (0.02 g/L) and chamber slides. The culture medium consisted of Dulbecco's modified Eagle medium (DMEM) with 10% heat-inactivated fetal bovine serum, 1 mM pyruvate, 4.2 mM sodium bicarbonate, 20 mM HEPES, 0.3 g/L bovine serum albumin, 50 U/ml penicillin, and 50 mg/L streptomycin. Cultures were maintained at 37℃ in a humidified atmosphere with 5% CO₂. Neuroglial cell proliferation was inhibited by treatment with growth medium containing 10 µM cytosine β-D-arabino furanoside (Sigma, St. Louis, MO, USA) for 12 hours.

GABA_B1R cDNA was removed from pCI vector by XbaI and EcoRI digestion (provided by Novatis Pharma, Basel, Switzerland). The primer which contained T7 promoter region (forward: 5'-CGGTAATACGACTCACTATAGGGAG ACGCTACCATCCAACAGACCA-3', reverse: 5'-GCGTAA TACGACTCACTATAGGGAGATCCTGTGAGCTCATGTT GGAA-3') was used for amplification of cDNA of GABA_B1R. Then dsRNAs were prepared with the MEGAscript® RNAi kit (Ambion, Austin, TX, USA) by incubation at 37℃ for 4 hours. RNAi was performed by using a ShortCut RNAi Kit (New England Biolabs, Buckinghamshire, UK). For GABA_B1R (420 bp) from 1,096 bp to 1,516 bp (accession no. NM 031028) with the highest silent activity was selected. One day before transfection, the medium was changed to DMEM without antibiotics and serum. Liposome solution (DMEM containing Lipofectamine2000™, Invitrogen, Carlsbad, CA, USA) and equal volume of dsRNA (21 bp as shortcut dsRNA) solution were incubated for 5 minutes at room temperature respectively, then combined together and incubated for 20 minutes. The mixture was added to the culture medium in each plate to reach a final concentration of 20 nM. After 48 hours of transfection, both cells with and without RNAi transfection transfer to the normal media as control, media contained 100 mM ethanol, 100 mM ethanol and 50 µM baclofen, 100 mM ethanol and 100 µM phaclofen, 100 mM ethanol and 50 µM baclofen plus 100 µM phaclofen. After 20 minutes of drug treatment, the cells were harvested. And the transfection efficiency was confirmed by using a BLOCK-iT™ transfection kit (Invitrogen) containing a fluorescent oligonucleotide (100 mM) for siRNA transfection after 2 days.

RT-PCR analysis was performed to identify cDNAs transcribed in transfected or mock-transfected cultures. Total RNA was isolated with TRIzol Reagent (Life Technologies, Rockville, MD, USA). First strand cDNA was transcribed from 2 µg RNA using oligo (dT)₁₅ and M-MLV reverse transcriptase (Promega, Madison, WI, USA) according to manufacturer's instructions. A total of 4 µl cDNA were used for PCR amplification with 1 µl Taq DNA polymerase. Thermal cycling was performed under the following conditions: 94℃ for 5 minutes; 30 cycles at 94℃, 68℃, and 72℃ for 1 minute each; final extension at 72℃ for 5 minutes. A negative control PCR for β-actin was performed at 58℃ for 25 cycles. PCR product was run out on a 1% agarose gel containing ethidium bromide and viewed under UV light. The primers used were the following:

GABA_B1R forward primer: 5'-AATTGAATTCCGCTACCATCCAACAGACCA-3';

GABA_B1R reverse primer: 5'-AATTAAGCTTTCCTGTGACGTCATGTTGGAA-3'

Drug-treated hippocampal cells were homogenized in cell lysis buffer (Cell Signaling no. 9803, Danvers, MA, USA) for protein extraction. After two rounds of ultra-centrifugation at 12,000 rpm for 10 minutes (4℃), supernatant protein concentration was quantified using the Bio-Rad protein assay kit. Thirty µg soluble fraction were separated on duplicate 12% sodium dodecyl sulfate (SDS)-polyacrylamide gels (30% acrylamide, 1% Bis, 1 M Tris, 20% SDS, 10% APS, TEMED). Proteins were transferred to polyvinylidene fluoride membrane at 90 V for 1 hour (in electrotransfer buffer with 48 mM Tris, 39 mM glycine, 20% MeOH, and 0.037% SDS). Membranes were treated with blocking solution (Tris-buffered saline containing 0.1% [v/v] Tween-20 and 6% [w/v] non-fat dry milk) to reduce non-specific binding. Immunostaining was carried out using a guinea-pig derived anti-rat GABA_B1R (1 : 500, 24 hours, 4℃, Santa Cruz Biotechnology, Santa Cruz, CA, USA), rabbit anti-rat PKA-α (1 : 500, Santa Cruz Biotechnology), rabbit anti-rat CaMKII (1 : 500, Cell Signaling) or rabbit anti-rat p-CREB (1 : 500, Cell Signaling). Anti-Actin antibody (1 : 1,000, Sigma-Aldrich, Jerusalem, Israel) was taken as control to confirm uniform loading. Antigen was detected by enhanced chemiluminescence (Western blotting detection reagents, Amersham Pharmacia Biotech, Piscataway, NJ, USA) according to manufacturer's instructions. In some cases, the blots were stripped and reprobed. Briefly, after film exposure, washed membrane four times for 5 minutes each in TBST, then agitated gently the membrane in the antibody stripping solution (ReBlot Plus Strong Antibody stripping solution, Millipore, Temecula, CA, USA) at room temperature for 15 minutes. After that, again washed the membrane four times for minutes each in TBST, then reprobed with a rabbit antiactin (1 : 1,000, Sigma-Aldrich). Western blots were analyzed by densitometry using the computer-based Sigma Gel system (SPSS Inc., Chicago, IL, USA). Density values were expressed as mean±SEM. A Student's t-test was performed to determine significant differences among groups. In each case, significance was accepted to be P<0.05.

Immunofluorescence was performed on GD 17.5 primary hippocampal cell cultures grown in vitro on poly-L-lysine coated round glass coverslips. Cultures were fixed for 5 minutes with 4% paraformaldehyde in phosphate buffered saline (PBS), permeabilized in 0.3% Triton X-100 in PBS for 5 minutes, and rinsed twice in PBS. The cells were preincubated with 10% bovine seum albumin in PBS for 1 hour at 37℃ before exposure to primary antibodies overnight at 4℃. Immunostaining was carried out using guinea-pig derived anti-rat GABA_B1R antibody (1 : 500, 24 hours, 4℃, Santa Cruz Biotechnology), rabbit anti-rat PKA-α antibody (1 : 500, Santa Cruz Biotechnology), or rabbit anti-rat anti-p-CREB antibody (1 : 500, Cell Signaling). Following incubation, cells were washed and secondary antibodies applied as follows: anti-rabbit IgG-TRITC and -FITC conjugated antibodies, 1 : 100; anti-guinea pig IgG-FITC conjugate, 1 : 150 (both from DAKOCytomation, Glostrup, Denmark). For co-staining, incubations were performed in parallel. Glass cover-slips were affixed to slides with mounting medium. Imaging was performed with a fluorescence microscope (Zeiss, Jena, Germany) or confocal microscope (Olympus, Tokyo, Japan), and images captured with a soft imaging systems video camera.

To investigate whether ethanol can modulate GABA_B1R expression, we observed the changes in GABA_B1R expression levels induced by ET on cultured GD 17.5 rat hippocampal neurons. GABA_B1R mRNA levels were decreased by ET, but increased by baclofen treatment (BT) or phaclofen treatment (PT). Transfection of siRNA complementary to endogenous GABA_B1R mRNA led to its efficient destruction, while β-actin levels were unchanged (Fig. 1).

We wished to ascertain whether ET-mediated transcriptional alterations affected protein levels in cultured GD 17.5 rat hippocampal neurons. Western blotting results showed that GABA_B1R protein levels were increased by ET in vitro, but this effect was reversed by PT. BT potentiated the effect of ethanol on GABA_B1R expression (Fig. 2). In contrast, no remarkable change in PKA-α level was observed under ET or PT in vitro (Fig. 3). Because PKA-α levels were unchanged upon GABA_B1R knockdown, as well as BT and PT, we speculated that CaMKII might instead regulate p-CREB. Ethanol decreased CaMKII expression in GD 17.5 rat hippocampal neurons, whereas BT, PT, and baclofen plus phaclofen treatment (BPT) reversed these effects; BT, PT, and BPT significantly decreased CaMKII expression upon siRNA knockdown of GABA_B1R (Fig. 4). p-CREB protein levels were decreased by ET, an effect reversed by BT, PT did not alter protein expression. We additionally probed whether ethanol-induced changes in GABA_B1R expression affected its intracellular signal transduction, knocking down its expression by RNAi to that end. GABA_B1R knockdown reduced all of p-CREB expression level (Fig. 5).

To confirm the localization of GABA_B1R and p-CREB, and to determine changes mediated by siRNA knockdown of GABA_B1R, we performed immunofluorescence assays on GD 17.5 rat hippocampal neurons. GABA_B1R co-localized with p-CREB in hippocampal neuronal cytoplasm and p-CREB distribution was reduced by GABA_B1R siRNA (Fig. 6).

Together, these results demonstrate that ethanol can modulate phosphorylation of CREB via PKA-α or CaMKII pathway intracellular Ca²⁺ dependently, which is linked to GABA_B1R activation in prenatal hippocampal neurons (Fig. 7).