Journal List > J Rheum Dis > v.19(2) > 1064021

Jeong, Kim, Lim, Hah, Cho, Yu, Park, Koh, and Lee: COMP-Angiopoietin-1 Stimulates Synovial Proliferation but Suppresses Osteoclast by Enhancing Angiogenesis and Osteoblast Maturation in Collagen-Induced Arthritis

Abstract

Objective

Angiopoietin-1 (Ang1) is a potent angiogenic factor that can increase synovial angiogenesis and also en-hance osteoblast maturation and bone formation. However, its role in rheumatoid arthritis (RA) has not been well documented. Thus, we investigated roles of Ang1 in collagen-induced arthritis (CIA).

Methods

A recombinant adenovirus carrying the gene that encodes either cartilage oligomeric matrix protein (AdCOMP)-Ang1 (a modified form of Ang1) or LacZ (AdLacZ) was injected intravenously into CIA mice. Clinical, radiological, histopathological, and immuno-fluorescent analyses were performed. Serum levels of receptor activators of nuclear factor κ B ligand (RANKL) and osteoprotegerin (OPG) and expression of osteoblast maturation genes were analyzed.

Results

AdCOMP-Ang1-injected mice developed more severe inflammation than the AdLacZ-injected mice. However, there were no significant differences in cartilage damage and bone erosion. More PECAM-1-positive blood vessels were seen in the synovium of the AdCOMP-Ang1-injected mice than in those injected with AdLacZ. Interestingly, a lower number of TRAP-positive osteoclasts were observed in AdCOMP-Ang1-injected CIA mice than in the AdLacZ group when comparing sections obtained from joints showing similar synovial proliferation. The serum OPG/RANKL ratio and expression of osteoblast maturation genes, such as runt-related transcription factor 2, bone sialoprotein, type 1 collagen, osteopontin, and osterix, were significantly upregulated in the AdCOMP-Ang1 group.

Conclusion

COMP-Ang1 facilitates arthritis onset and increases synovial inflammation, but enhances osteoblast maturation, which in turn inhibits osteoclastogenesis by increasing the OPG/RANKL ratio in CIA. Our results sug-gest that careful investigation is necessary to delineate the possible therapeutic use of COMP-Ang1 as an adjunctive agent, in combination with antiinflammatory therapies, for the prevention of bone destruction in RA.

References

1. Firestein GS. Evolving concepts of rheumatoid arthritis. Nature. 2003; 423:356–61.
crossref
2. Lainer-Carr D, Brahn E. Angiogenesis inhibition as a therapeutic approach for inflammatory synovitis. Nat Clin Pract Rheumatol. 2007; 3:434–42.
crossref
3. Szekanecz Z, Koch AE. Mechanisms of Disease: angiogenesis in inflammatory diseases. Nat Clin Pract Rheumatol. 2007; 3:635–43.
crossref
4. Jones N, Iljin K, Dumont DJ, Alitalo K. Tie receptors: new modulators of angiogenic and lymphangiogenic responses. Nat Rev Mol Cell Biol. 2001; 2:257–67.
crossref
5. Augustin HG, Koh GY, Thurston G, Alitalo K. Control of vascular morphogenesis and homeostasis through the angiopoietin-Tie system. Nat Rev Mol Cell Biol. 2009; 10:165–77.
crossref
6. DeBusk LM, Chen Y, Nishishita T, Chen J, Thomas JW, Lin PC. Tie2 receptor tyrosine kinase, a major mediator of tumor necrosis factor alpha-induced angiogenesis in rheumatoid arthritis. Arthritis Rheum. 2003; 48:2461–71.
7. Gravallese EM, Pettit AR, Lee R, Madore R, Manning C, Tsay A, et al. Angiopoietin-1 is expressed in the synovium of patients with rheumatoid arthritis and is induced by tu-mour necrosis factor α. Ann Rheum Dis. 2003; 62:100–7.
8. Chen Y, Donnelly E, Kobayashi H, Debusk LM, Lin PC. Gene therapy targeting the Tie2 function ameliorates col-lagen-induced arthritis and protects against bone destruction. Arthritis Rheum. 2005; 52:1585–94.
crossref
9. Romas E, Gillespie MT, Martin TJ. Involvement of receptor activator of NFkappaB ligand and tumor necrosis factor-α in bone destruction in rheumatoid arthritis. Bone. 2002; 30:340–6.
10. Takayanagi H. Osteoimmunology and the effects of the immune system on bone. Nat Rev Rheumatol. 2009; 5:667–76.
crossref
11. Choi Y, Arron JR, Townsend MJ. Promising bone-related therapeutic targets for rheumatoid arthritis. Nat Rev Rheumatol. 2009; 5:543–8.
crossref
12. Glass DA 2nd, Bialek P, Ahn JD, Starbuck M, Patel MS, Clevers H, et al. Canonical Wnt signaling in differentiated osteoblasts controls osteoclast differentiation. Dev Cell. 2005; 8:751–64.
crossref
13. Walsh NC, Reinwald S, Manning CA, Condon KW, Iwata K, Burr DB, et al. Osteoblast function is compromised at sites of focal bone erosion in inflammatory arthritis. J Bone Miner Res. 2009; 24:1572–85.
crossref
14. Pap T, Distler O. Linking angiogenesis to bone destruction in arthritis. Arthritis Rheum. 2005; 52:1346–8.
crossref
15. Suzuki T, Miyamoto T, Fujita N, Ninomiya K, Iwasaki R, Toyama Y, et al. Osteoblast-specific Angiopoietin 1 overexpression increases bone mass. Biochem Biophys Res Commun. 2007; 362:1019–25.
crossref
16. Cho CH, Kammerer RA, Lee HJ, Steinmetz MO, Ryu YS, Lee SH, et al. COMP-Ang1: a designed angiopoie-tin-1 variant with nonleaky angiogenic activity. Proc Natl Acad Sci U S A. 2004; 101:5547–52.
crossref
17. Cho CH, Kim KE, Byun J, Jang HS, Kim DK, Baluk P, et al. Longterm and sustained COMP-Ang1 induces long-lasting vascular enlargement and enhanced blood flow. Circ Res. 2005; 97:86–94.
crossref
18. Thurston G, Suri C, Smith K, McClain J, Sato TN, Yancopoulos GD, et al. Leakage-resistant blood vessels in mice transgenically overexpressing angiopoietin-1. Science. 1999; 286:2511–4.
crossref
19. Jeong BC, Kim HJ, Bae IH, Lee KN, Lee KY, Oh WM, et al. COMP-Ang1, a chimeric form of Angiopoietin 1, enhances BMP2-induced osteoblast differentiation and bone formation. Bone. 2010; 46:479–86.
crossref
20. Park BH, Jang KY, Kim KH, Song KH, Lee SY, Yoon SJ, et al. COMP-Angiopoietin-1 ameliorates surgery-induced ischemic necrosis of the femoral head in rats. Bone. 2009; 44:886–92.
crossref
21. Park BH, Yoon SJ, Jang KY, Kim MR, Lee HS, Kim KB, et al. COMP-angiopoietin-1 accelerates bone formation during distraction osteogenesis. Bone. 2010; 46:1442–8.
crossref
22. Hah YS, Lee YR, Jun JS, Lim HS, Kim HO, Jeong YG, et al. A20 suppresses inflammatory responses and bone destruction in human fibroblast-like synoviocytes and in mice with collagen-induced arthritis. Arthritis Rheum. 2010; 62:2313–21.
crossref
23. Lee S, Kim W, Kim DH, Moon SO, Jung YJ, Lee AS, et al. Protective effect of COMP-angiopoietin-1 on cyclosporine-induced renal injury in mice. Nephrol Dial Transplant. 2008; 23:2784–94.
crossref
24. Folkman J. Angiogenesis: an organizing principle for drug discovery? Nat Rev Drug Discov. 2007; 6:273–86.
crossref
25. Carmeliet P. Angiogenesis in life, disease and medicine. Nature. 2005; 438:932–6.
crossref
26. Eskens FA, Verweij J. The clinical toxicity profile of vascular endothelial growth factor (VEGF) and vascular endothelial growth factor receptor (VEGFR) targeting angiogenesis inhibitors; a review. Eur J Cancer. 2006; 42:3127–39.
crossref
27. Hawighorst T, Skobe M, Streit M, Hong YK, Velasco P, Brown LF, et al. Activation of the tie2 receptor by angio-poietin-1 enhances tumor vessel maturation and impairs squamous cell carcinoma growth. Am J Pathol. 2002; 160:1381–92.
crossref
28. Machein MR, Knedla A, Knoth R, Wagner S, Neuschl E, Plate KH. Angiopoietin-1 promotes tumor angiogenesis in a rat glioma model. Am J Pathol. 2004; 165:1557–70.
crossref
29. Voskas D, Jones N, Van Slyke P, Sturk C, Chang W, Haninec A, et al. A cyclosporine-sensitive psoriasis-like disease produced in Tie2 transgenic mice. Am J Pathol. 2005; 166:843–55.
crossref
30. Hashiramoto A, Sakai C, Yoshida K, Tsumiyama K, Miura Y, Shiozawa K, et al. Angiopoietin 1 directly induces destruction of the rheumatoid joint by cooperative, but independent, signaling via ERK/MAPK and phosphati-dylinositol 3-kinase/Akt. Arthritis Rheum. 2007; 56:2170–9.
crossref
31. Komori T. Regulation of skeletal development by the Runx family of transcription factors. J Cell Biochem. 2005; 95:445–53.
crossref
32. Bais MV, Wigner N, Young M, Toholka R, Graves DT, Morgan EF, et al. BMP2 is essential for post natal osteogenesis but not for recruitment of osteogenic stem cells. Bone. 2009; 45:254–66.
crossref
33. Thomas GP, Baker SU, Eisman JA, Gardiner EM. Changing RANKL/OPG mRNA expression in differentiating murine primary osteoblasts. J Endocrinol. 2001; 170:451–60.
crossref

Figure 1.
COMP-Ang1 increases erythema and joint swelling. (A) Representative photographs showing the gross features of the hind paws. The mouse injected with AdCOMP-Ang1 shows increased redness (right panel) compared with the Ad-LacZ mouse (left panel), despite showing comparable arthritic development in all paws. (B) The cumulative incidence of arthritis, (C) severity of arthritis, as assessed by a visual arthritis scoring system and (D) hind paw thickness were determined (n=10 for each group). Values are the mean± SEM, ∗p<0.05 vs. AdLacZ.
jrd-19-82f1.tif
Figure 2.
AdCOMP-Ang1-injected mice show increased synovial proliferation and angiogenesis but no bone destruction. (A) Representative sections of the ankle joints stained with H&E (bars=250 μm), (B) mean pathological scores, and (C) mean radiological scores (n=10 for each group). Note the increased synovial proliferation (asterisk) in the joint of an AdCOMP-Ang1-injected mouse compared with PBS- and AdLacZ-injected mice. (D) Images showing PECAM-1+ blood vessels (bars=50 μm). (E) Density of blood vessels in the synovium (n=5-6 for each group). Note the increased angiogenesis in the synovium of an AdCOMP-Ang1-injected mouse compared with an AdLacZ. Values are the mean± SEM, ∗p<0.05 vs. AdLacZ.
jrd-19-82f2.tif
Figure 3.
COMP-Ang1 decreases TRAP-positive osteoclasts. (A) Representative sections of the ankle joints stained with H&E (bars=500 μm) and TRAP (bars=50 μm) from an AdLacZ- or AdCOMP-Ang1-injected mouse with grade 3 synovial proliferation. The TRAP- stained image (lower panel) corres-ponds to the boxed area in the H&E-stained sections (upper panel). (B) Mean pathological scores and (C) total number of TRAP-positive cells in the joints showing grade 3 synovial proliferation from the AdLacZ- or AdCOMP-Ang1-injec-ted groups (n=5 for each group). Values are the mean± SEM, ∗p <0.05.
jrd-19-82f3.tif
Figure 4.
COMP-Ang1 increases the OPG/RANKL ratio and the expression of the osteogenic genes. Ankle joint tissues were obtained from AdLacZ- and AdCOMP-Ang1-injected mice on day 45 (n=10 for each group). Real-time RT-PCR analysis for osteogenic and chondrogenic genes was performed. Values are the mean± SEM, ∗p<0.05, p<0.01 vs. AdLacZ.
jrd-19-82f4.tif
Table 1.
Sequences and accession numbers for the forward and reverse primers used in real-time RT-PCR
Gene Forward Reverse Accession No.
Runx2 GCTCACGTCGCTCATCTTG ACACCGTGTCAGCAAAGC NM_009820
BSP TGAAGAGTCACTGCCTCCCT GTCTTTAAGTACCGGCCACG NM_008318
Osteopontin TGGCTATAGGATCTGGGTGC ATTTGCTTTTGCCTGTTTGG NM_009263
Type 1 collagen TAGGCCATTGTGTATGCAGC ACATGTTCAGCTTTGTGGACC NM_007742
Osterix GGACTGGAGCCATAGTGAGC CTCTCCATCTGCCTGACTCC NM_130458
Type 2 collagen GCAAGATGAGGGCTTCCATA CTACGGTGTCAGGGCCAG NM_031163
Sox-9 TCCACGAAGGGTCTCTTCTC AGGAAGCTGGCAGACCAGTA NM_011448
GAPDH CGTCCCGTAGACAAAATGGT TTGATGGCAACAATCTCCAC NM_008084
TOOLS
Similar articles