Journal List > Korean J Urogenit Tract Infect Inflamm > v.9(1) > 1059945

TOOLS
Lee, Kim, Chang, Han, Kim, Moon, and Myung: Modulation of Antimicrobial Peptide Human β-defensin-3 by Toll-like Receptor Ligands in Vaginal Epithelial Cells
Original Article

Korean J Urogenit Tract Infect Inflamm 2014;9(1):27-33.

Published online: 17 April 2014

DOI: https://doi.org/10.14777/kjutii.2014.9.1.27

Modulation of Antimicrobial Peptide Human β-defensin-3 by Toll-like Receptor Ligands in Vaginal Epithelial Cells

Seo Yeon Lee, Hae jong Kim1, In Ho Chang2, June Hyun Han3, Kyung Do Kim2, Young Tae Moon2, Soon Chul Myung2, 4,

Department of Urology, Myongji Hospital, Goyang, Korea

1Functional Food Research Center, School of Life Sciences and Biotechnology, Korea University, Seoul, Korea

2Department of Urology, Chung-Ang University College of Medicine, Seoul, Korea

3Department of Urology, Hallym University Dongtan Sacred Heart Hospital, Hallym University College of Medicine, Hwaseong, Korea

4Advanced Urogenital Disease Research Center, Chung-Ang University Hospital, Seoul, Korea

Correspondence to: Soon Chul Myung Department of Urology, Chung-Ang University Hospital, Chung-Ang University College of Medicine, 102, Heukseok-ro, Dongjak-gu, Seoul 156-755, Korea Tel: +82-2-6299-1785, Fax: +82-2-6299-1406 E-mail: uromyung@cau.ac.kr

Received 11 January 201429 January 2014       Accepted 3 February 2014

Copyright © 2014 Korean Association of Urogenital Tract Infection and Inflammation

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Purpose

Vaginal epithelial cells have always been exposed to various pathogens. However, this has not always caused clinical infection. In addition to a previously reported protection effect of the vagina, currently, the innate immune response is thought to be important as one of the causes explaining the phenomenon. Therefore, we investigated the innate immunity of the vagina and related mechanisms in infected vaginal epithelial cells focusing on the antimicrobial peptide human β-defensin-3 (HBD-3).

Materials and Methods

We investigated the signaling molecules, Toll-like receptors (TLRs), through which mammals sense infection in vaginal epithelial cells, with activation with lipopolysaccharide (LPS), Staphylococcus aureus peptidoglycan (PGN), or zymosan. Reverse transcriptase-polymerase chain reaction analysis of HBD-3 messenger RNA expression in vaginal epithelial cells after treatment with three pathogens was performed for investigation of pathogen-associated molecular patterns. Then, we also studied the following mechanism of innate immunity of the vagina focusing on HBD-3 in vaginal epithelial cells infected with gram-positive bacteria, gram-negative bacteria, or fungus.

Results

Vaginal epithelial cells (VK2/E6E7 cells) constitutively expressed TLR2 and TLR4 and produced antimicrobial peptide HBD-3 upon activation with LPS, PGN, or zymosan. VK2/E6/E7 cells exposed to LPS, PGN, or zymosan showed increased p38 mitogen activated protein kinase (MAPK) activity. In addition, LPS-, PGN-, and zymosan-induced HBD-3 expression was attenuated by SB203580, a p38 MAPK inhibitor, emphasizing the importance of p38 MAPK in induction of HBD-3.

Conclusions

Vaginal epithelial cells may contribute to the host innate immune defense upon exposure to gram-negative bacteria, gram-positive bacteria, or fungi in the vagina by upregulation of HBD-3 expression.

Keywords: Vagina, Beta defensin 3, human, Toll-like receptors

REFERENCES

1. Redondo-Lopez V, Cook RL, Sobel JD. Emerging role of lactobacilli in the control and maintenance of the vaginal bacterial microflora. Rev Infect Dis. 1990; 12:856–72.
crossref
2. Pivarcsi A, Nagy I, Koreck A, Kis K, Kenderessy-Szabo A, Szell M, et al. Microbial compounds induce the expression of proinflammatory cytokines, chemokines and human beta-defensin-2 in vaginal epithelial cells. Microbes Infect. 2005; 7:1117–27.
3. Hertzman M. Galantamine in the treatment of adult autism: a report of three clinical cases. Int J Psychiatry Med. 2003; 33:395–8.
crossref
4. Nahid MA, Satoh M, Chan EK. MicroRNA in TLR signaling and endotoxin tolerance. Cell Mol Immunol. 2011; 8:388–403.
crossref
5. Kawai T, Sato S, Ishii KJ, Coban C, Hemmi H, Yamamoto M, et al. Interferon-alpha induction through Toll-like receptors involves a direct interaction of IRF7 with MyD88 and TRAF6. Nat Immunol. 2004; 5:1061–8.
6. Hertz CJ, Wu Q, Porter EM, Zhang YJ, Weismüller KH, Godowski PJ, et al. Activation of Toll-like receptor 2 on human tracheobronchial epithelial cells induces the antimicrobial peptide human beta defensin-2. J Immunol. 2003; 171:6820–6.
7. Zhang FX, Kirschning CJ, Mancinelli R, Xu XP, Jin Y, Faure E, et al. Bacterial lipopolysaccharide activates nuclear factor-kappaB through interleukin-1 signaling mediators in cultured human dermal endothelial cells and mononuclear phagocytes. J Biol Chem. 1999; 274:7611–4.
8. Pasare C, Medzhitov R. Toll-like receptors: linking innate and adaptive immunity. Microbes Infect. 2004; 6:1382–7.
crossref
9. Gayer G, Mini S, Olchovsky D, Leibovitch I, Apter S, Weitzen R, et al. Pulmonary embolism-the initial manifestation of renal cell carcinoma in a young woman. Emerg Radiol. 2003; 10:43–5.
crossref
10. Ganz T, Selsted ME, Szklarek D, Harwig SS, Daher K, Bainton DF, et al. Defensins. Natural peptide antibiotics of human neutrophils. J Clin Invest. 1985; 76:1427–35.
crossref
11. Ganz T. Antimicrobial polypeptides. J Leukoc Biol. 2004; 75:34–8.
crossref
12. Harder J, Bartels J, Christophers E, Schröder JM. A peptide antibiotic from human skin. Nature. 1997; 387:861.
crossref
13. Becker MN, Diamond G, Verghese MW, Randell SH. CD14-dependent lipopolysaccharide-induced beta-defensin-2 expression in human tracheobronchial epithelium. J Biol Chem. 2000; 275:29731–6.
14. Harder J, Bartels J, Christophers E, Schroder JM. Isolation and characterization of human beta -defensin-3, a novel human inducible peptide antibiotic. J Biol Chem. 2001; 276:5707–13.
15. Harder J, Meyer-Hoffert U, Teran LM, Schwichtenberg L, Bartels J, Maune S, et al. Mucoid Pseudomonas aeruginosa, TNF-alpha, and IL-1beta, but not IL-6, induce human beta-defensin-2 in respiratory epithelia. Am J Respir Cell Mol Biol. 2000; 22:714–21.
16. Ishimoto H, Mukae H, Date Y, Shimbara T, Mondal MS, Ashitani J, et al. Identification of hBD-3 in respiratory tract and serum: the increase in pneumonia. Eur Respir J. 2006; 27:253–60.
crossref
17. Maisetta G, Batoni G, Esin S, Florio W, Bottai D, Favilli F, et al. In vitro bactericidal activity of human beta-defensin 3 against multidrug-resistant nosocomial strains. Antimicrob Agents Chemother. 2006; 50:806–9.
18. Spiegel CA. Vaginitis/vaginosis. Clin Lab Med. 1989; 9:525–33.
crossref
19. Strus M, Malinowska M, Heczko PB. In vitro antagonistic effect of Lactobacillus on organisms associated with bacterial vaginosis. J Reprod Med. 2002; 47:41–6.
20. Nomanbhoy F, Steele C, Yano J, Fidel PL Jr. Vaginal and oral epithelial cell anti-Candida activity. Infect Immun. 2002; 70:7081–8.
21. Steele C, Ozenci H, Luo W, Scott M, Fidel PL Jr. Growth inhibition of Candida albicans by vaginal cells from naïve mice. Med Mycol. 1999; 37:251–9.
crossref
22. Akira S, Takeda K, Kaisho T. Toll-like receptors: critical proteins linking innate and acquired immunity. Nat Immunol. 2001; 2:675–80.
crossref
23. Han JH, Kim MS, Lee MY, Kim TH, Lee MK, Kim HR, et al. Modulation of human beta-defensin-2 expression by 17beta-estradiol and progesterone in vaginal epithelial cells. Cytokine. 2010; 49:209–14.
24. Albanesi C, Fairchild HR, Madonna S, Scarponi C, De Pità O, Leung DY, et al. IL-4 and IL-13 negatively regulate TNF-alpha-and IFN-gamma-induced beta-defensin expression through STAT-6, suppressor of cytokine signaling (SOCS)-1, and SOCS-3. J Immunol. 2007; 179:984–92.
25. Menzies BE, Kenoyer A. Signal transduction and nuclear responses in Staphylococcus aureus-induced expression of human beta-defensin 3 in skin keratinocytes. Infect Immun. 2006; 74:6847–54.
26. Steubesand N, Kiehne K, Brunke G, Pahl R, Reiss K, Herzig KH, et al. The expression of the beta-defensins hBD-2 and hBD-3 is differentially regulated by NF-kappaB and MAPK/AP-1 pathways in an in vitro model of Candida esophagitis. BMC Immunol. 2009; 10:36.
crossref
27. Ventura JJ, Kennedy NJ, Lamb JA, Flavell RA, Davis RJ. c-Jun NH(2)-terminal kinase is essential for the regulation of AP-1 by tumor necrosis factor. Mol Cell Biol. 2003; 23:2871–82.

Fig. 1.
Expression of Toll-like receptors (TLRs) and accessory molecules in cultured human vaginal epithelial cells. VK2/E6E7, a normal human vaginal epithelial cell line, was screened for mRNA expression of all known human TLRs and the accessory molecules myeloid differentiation protein 2 (MD-2), CD14, and myeloid differentiation primary response gene 88 (MyD88) by reverse transcriptase-polymerase chain reaction. The expression of TLR2 and TLR4 mRNA was detected in VK2/E6E7 cells. The expression of accessory molecules such as MyD88, CD14, and MD-2 was also detected. N.C: normal control, ACTB: β-actin.
kjutii-9-27f1.tif
Fig. 2.
Pathogen-associated molecular patterns, representing gram-negative and gram-positive bacteria as well as fungal pathogens, induced human β-defensin-3 (HBD-3) in vaginal epithelial cells. Semiquantitative reverse transcriptase-polymerase chain reaction analysis of HBD-3 mRNA expression in immortalized vaginal epithelial cells after treatment with lipopolysaccharide (LPS), Staphylococcus aureus peptidoglycan (PGN), or zymosan was performed. LPS, PGN, and zymosan had an extremely strong stimulatory effect on HBD-3 mRNA expression in VK2/E6E7 cells at 3, 6, 12, and 24 hours after stimulation. ACTB: β-actin.
kjutii-9-27f2.tif
Fig. 3.
The specific inhibitor of p38 MAPK (SB203580) attenuates lipopolysaccharide (LPS)-, Staphylococcus aureus peptidoglycan (PGN)-, and zymosan-induced human beta-defensin-3 (HBD-3) expression in VK2/E6E7 cells in the mRNA level (A) and the protein level (B).
kjutii-9-27f3.tif
Fig. 4.
Lipopolysaccharide (LPS), Staphylococcus aureus peptidoglycan (PGN), and zymosan induced p38 mitogen-activated protein kinase (MAPK) phosphorylation in VK2/E6E7 cells. The activation of p38 MAPK by detecting the phosphor-p38 MAPK protein was observed.
kjutii-9-27f4.tif
Table 1.
Primer sets used in polymerase chain reaction analysis
Gene Primer sequence Product size
HBD-2   255
   Sense TGCCTCTTCCAGGTGTTTTT  
   Antisense ATGGCTTTTTGCAGCATTTT  
HBD-3   206
   Sense AGCCTAGCAGCTATGAGGATC  
   Antisense CTTCGGCAGCATTTTCGGCCA  
β-actin   375
   Sense CTCGGTGAGGATCTTCATGA 　
   Antisense CCATCGAGCACGGCATCGTC  

HBD: human β-defensin.

TOOLS
Similar articles