Journal List > J Korean Acad Oral Health > v.38(2) > 1057631

TOOLS
Oh and Choi: Effect of bamboo salt on human gingival fibroblasts
Original Article

J Korean Acad Oral Health 2014;38(2):90-94.

Published online: 12 June 2014

DOI: https://doi.org/10.11149/jkaoh.2014.38.2.90

Effect of bamboo salt on human gingival fibroblasts

Han-Na Oh1, Choong-Ho Choi2, 3

1Dental Hygiene, Wonkwang Health Science University, Gwanju, Korea

2Department of Preventive & Public Health Dentistry, Chonnam National University School of Dentistry, Gwanju, Korea

3Dental Science Research Institute, Chonnam National University School of Dentistry, Gwanju, Korea

Corresponding Author: Choong-Ho Choi Department of Preventive & Public Health Dentistry, Chonnam National University School of Dentistry, 33 Yongbong-ro, Buk-gu, Gwangju 500-707, Korea Tel: +82-62-530-5834 Fax: +82-62-530-5835 E-mail: hochoi@chonnam.ac.kr

Received 19 May 2014       Revised 13 June 2014       Accepted 19 June 2014

Copyright © 2014 Journal of Korean Academy of Oral Health

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Objectives

To evaluate the anti-inflammatory and cytotoxic activities of bamboo salt.

Methods

Cytotoxicity of bamboo salt and bay salt (0.01%, 0.1%, and 1%) was evaluated using MTT assay. In addition, secretion of the pro-inflammatory cytokines interleukin (IL)-1β and IL-6 from human gingival fibroblasts (HGFs) was measured after application of 0.01% and 0.1% concentrations by using real-time polymerase chain reaction.

Results

Bamboo salt and bay salt at 1% concentration were cytotoxic to HGFs at 24 h; however, no such effect was observed at 0.01% or 0.1%. Bamboo salt showed a relatively low inhibitory effect. IL-1β secretion was inhibited by a 0.1% solution of bamboo salt. IL-6 secretion was inhibited by both bamboo salt and bay salt at 0.1% concentration.

Conclusions

The above results suggest that bamboo salt inhibits the release of IL-1β and IL-6 from HGFs. Thus, bamboo salt may be a useful material for gingival inflammation.

Keywords: Bamboo salt, Human gingival fibroblast, IL-1β, IL-6

References

1. Ministry of Health and Welfare. 2010 Korean National Oral Health Survey: II. Survey results. Seoul: Ministry of Health and Welfare;2010. p. 475.
2. Lim JH, Jung HJ, Kim SC, Jee SY. Anti-inflammaory effects of the Gamroeum in vivo and in vitro. The Journal of Korean Oriental Medical Ophthalmology & Otolaryngology & Dermatology. 2010; 23:13–26.
3. Murtaugh MP, Baarsch MJ, Zhou Y, Scamurra RW, Lin G. Inflammatory cytokines in animal health and disease. Vet Immunol Im-munopathol. 1996; 54:45–55.
crossref
4. Choi KW. Inhibition of TNF-α-induced adhesion molecule expression by diosgenin or discorea batatas extracts in vascular smooth muscle cells [master’s thesis]. Seoul: Sungkyunkwan uni-versity;2011. [Korean].
5. Dinarello CA. Interleukin-1 and its biologically related cytokines. Adv Immunol. 1989; 44:153–205.
crossref
6. Kishimoto T. The biology of IL-6. Blood. 1989; 74:1–10.
7. Huh K, Kim YH, Jin DQ. Protective effect of an aged garlic-bamboo salt mixture on the rat with the alcohol-salicylate induced gastropathy. Yakhak Hoeji. 2001; 45:258–268.
8. Shin HY, Na HJ, Moon PD, Shin T, Shin TY, Kim SH, et al. Inhibition of mast cell-dependent immediate-type hypersensitivity reactions by purple bamboo salt. J Ethnopharmacol. 2004; 91:153–157.
crossref
9. Ju IO, Jung GT, Ryu J, Choi JS, Choi YG. Chemical components and physiological activities of bamboo (Phyllostachys bambusoides Starf) extracts prepared with different methods. Korean J Food Sci. Technol. 2005; 37:542–548.
10. Shin HY, Lee EH, Kim CY, Shin TY, Kim SD, Song YS, et al. Antiinflammatory activity of Korean folk medicine purple bamboo salt. Immunopharmacol Immunotoxicol. 2003; 25:377–384.
crossref
11. Myung NY, Choi IH, Jeong HJ, Kim HM. Ameliorative effect of purple bamboo salt-pharmaceutical acupuncture on cisplatin-induced ototoxicity. Acta Otolaryngol. 2011; 131:14–21.
crossref
12. Kim CY, Chung SC, Sohn WS. Comparison of the anti-plaque and anti-inflammatory effect of the dentifrices contatining NaCl and bamboo salt. J Korean Acad Dent Health. 1991; 15:269–280.
13. Min BS, Choi HY, Choi YJ, Hong JP, Chun YH, Kang NH. The reducing effects on dental plaque formation and gingivitis of toothpastes containing bamboo salt and several herb medicines. J Korean Dent Asso. 1996; 34:65–71.
14. Park KI, Choi EG. Dentifrice containing some oriental medicine and bamboo salt. J Korean Acad Oral Health. 1994; 18:390–400.
15. Kim YH, Ryu HI. Elements in a bamboo salt and comparision of its elemental contents with those in other salts. Yakhak Hoeji. 2003; 47:135–141.
16. Kim JG, Seo KW, Lee BH, Park MK, Park CW, Shin DW, et al. 3 Months repeated dose toxicity studies of the bamboo salt(Jukyum) in rats. J Toxicol Pub Health. 2002; 18:149–157.
17. Masada MP, Persson R, Kenney JS, Lee SW, Page RC, Allison AC. Measurement of interleukin-1α and-1β in gingival crevicular fluid: Implications for the pathogenesis of periodontal disease. J Periodontal Res. 1990; 25:156–163.
18. Takashiba S, Naruishi K. Gene polymorphisms in periodontal health and disease. Periodontol 2000. 2006; 40:94–106.
crossref
19. Yeom JH. Mechanisms of alveolar bone destruction by periodontal bacteria. [master’s thesis]. Gwang ju: Chonnam National Univer-sity;2009. [Korean].
20. Go YL. Relationship between Interleukin-1B gene makers and periodontal disease in Korean population[master’s thesis]. Gangneung: Gangneung-Wonju National University;2008. [Korean].
21. Hönig J, Rordorf-Adam C, Siegmund C, Wiedemann W, Erard F. Increased interleukin-1 beta (IL-1β) concentration in gingival tissue from periodontitis patients. J Periodontal Res. 1989; 24:362–367.
22. Stashenko P. The role of immune cytokines in the pathogenesis of periapical lesions. Endod Dent Traumatol. 1990; 6:89–96.
crossref
23. Irwin CR, Myrillas TT. The role of IL-6 in the pathogenesis of periodontal disease. Oral Dis. 1998; 4:43–47.
crossref
24. Takahashi K, Takashiba S, Nagai A, Takigawa M, Myoukai F, Kurihara H, et al. Assessment of interleukin-6 in the pathogenesis of periodontal disease. J Periodontol. 1994; 65:147–153.
crossref

Fig. 1.
Schematic diagram for experimental designs (*: Treatment of bamboo salt, NaCl and bay salt solutions, HGF: human gingival fibroblast).
jkaoh-38-90f1.tif
Table 1.
Nucleotide sequences for Real-Time PCR primers
Gene description Direction Nucleotide sequence (5'-3')
GAPDH Forward CGGAGTCAACGGATTTGGTCGTAT
Reverse AGCCTTCTCCATGGTGGTGAAGAC
IL-1β Forward GATACAAACTGATGAAGCTCGTCA
Reverse GAGATAGTGTTTTCCACATCCTGA
IL-6 Forward GAACAAGCCAGAGCTGTCCA
Reverse TGAGGTGCCCATGCTACATT
Table 2.
The cytotoxicity assay of experimental solutions
Group Concentration (%) Cytotoxicity*
Control - 2.41±0.02a
Bamboo salt 0.01 2.27±0.07ab
0.1 2.23±0.07ab
1 0.21±0.01d
Bay salt 0.01 2.09±0.12bc
0.1 1.86±0.04c
1 0.37±0.06d

*P<0.01, by Kruskal-Wallis test.

a ,b,c,dThe letter indicates significant difference by Mann-Whitney test, at α=0.05.

Table 3.
Effects of various salts on the production of TNFα-induced inflammatory cytokines IL-1β, IL-6 in human gingival fibroblast cells
Group Salt concentration (%) IL-1ß* IL-6*
Control - 1.00±0.57a 1.00±0.05a
TNF-α - 4.80±0.86b 13.09±0.19d
TNF-α+ Bamboo salt 0.01 2.61±0.95ab 4.52±0.03c
0.1 0.08±0.53a 2.56±0.07abc
TNF-α+ Bay salt 0.01 2.25±0.15ab 3.24±0.03bc
0.1 1.90±0.02ab 2.68±0.09abc

*P<0.01, by Kruskal-Wallis test.

a ,b,c,dThe letter indicates significant difference by Mann-Whitney test, at α=0.05.

TOOLS
Similar articles