Chromosomal Mutations in oprD, gyrA, and parC in Carbapenem Resistant Pseudomonas aeruginosa

Ji Youn Sung; Hye Hyun Cho; Kye Chul Kwon; Sun Hoe Koo

doi:10.5145/KJCM.2011.14.4.131

Journal List > Korean J Clin Microbiol > v.14(4) > 1038229

Go to TopGo to Top Go to BottomGo to Bottom

TOOLS

Sung, Cho, Kwon, and Koo: Chromosomal Mutations in oprD, gyrA, and parC in Carbapenem Resistant Pseudomonas aeruginosa

Original Article

Korean J Clin Microbiol 2011;14(4):131-137.

Published online: 21 December 2011

DOI: https://doi.org/10.5145/KJCM.2011.14.4.131

Chromosomal Mutations in oprD, gyrA, and parC in Carbapenem Resistant Pseudomonas aeruginosa

Ji Youn Sung¹, Hye Hyun Cho², Kye Chul Kwon², Sun Hoe Koo²

¹Department of Biomedical Laboratory Science, Far East University, Eumseong, Korea

²Department of Laboratory Medicine, College of Medicine, Chungnam National University, Daejeon, Korea

Correspondence: Sun Hoe Koo, Department of Laboratory Medicine, College of Medicine, Chungnam National University Hospital, 640 Daesa-dong, Jung-gu, Daejeon 301-721, Korea. (Tel) 82-42-280-7798, (Fax) 82-42-257-5365, (E-mail) shkoo@cnu.ac.kr

Received 27 July 2011 Revised 10 October 2011 Accepted 17 October 2011

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background

Outbreaks of carbapenem resistant P. aeruginosa give rise to significant therapeutic challenges for treating nosocomial infections. In this study, we analyzed carbapenem resistance mechanisms in carbapenem resistant and clonally different P. aeruginosa strains. We analyzed chromosomal alterations in the genes of OprD and efflux system regulatory proteins (MexR, NalC, NalD, MexT, and MexZ). We also investigated chromosomal alterations in the quinolone resistance-determining region (QRDR) for quinolone resistance mechanisms.

Methods

Twenty-one clonally different P. aeruginosa strains were isolated by repetitive extragenic palindromic sequence-based PCR (rep-PCR). PCR and DNA sequencing were conducted for the detection of β-lactamase genes and chromosomal alterations of efflux pump regulatory genes, oprD, and QRDR in gyrA, gyrB, parC, and parE.

Results

Only one (P28) of the 21 strains harbored bla_VIM-2. Two isolates had mutations in nalD or mexZ that were associated with efflux pump overexpression. Chromosomal alterations causing loss of OprD were found in 4 out of 21 carbapenem resistant P. aeruginosa strains. Nine of 10 imipenem and ciprofloxacin resistant strains had alterations in gyrA and/or parC.

Conclusion

Carbapenem resistance in P. aeruginosa was mediated by several mechanisms, including loss of the OprD, overexpression of efflux systems, and production of carbapenemase. Resistance to quinolone is frequently caused by point mutations in gyrA and/or parC.

Keywords: Carbapenem resistant P. aeruginosa, OprD, Efflux system regulatory proteins, QRDR

REFERENCES

1. Jacoby GA and Medeiros AA. More extended-spectrum beta-lactamases. Antimicrob Agents Chemother. 1991; 35:1697–704.

2. Lee K, Park KH, Jeong SH, Lim HS, Shin JH, Yong D, et al. Further increase of vancomycin-resistant Enterococcus faecium, amikacin- and fluoroquinolone-resistant Klebsiella pneumoniae, and imipenem-resistant Acinetobacter spp. in Korea: 2003 KONSAR surveillance. Yonsei Med J. 2006; 47:43–54.

3. Livermore DM. Of Pseudomonas, porins, pumps and carbapenems. J Antimicrob Chemother. 2001; 47:247–50.

4. Edalucci E, Spinelli R, Dolzani L, Riccio ML, Dubois V, Tonin EA, et al. Acquisition of different carbapenem resistance mechanisms by an epidemic clonal lineage of Pseudomonas aeruginosa. Clin Microbiol Infect. 2008; 14:88–90.

5. Pai H, Kim J, Kim J, Lee JH, Choe KW, Gotoh N. Carbapenem resistance mechanisms in Pseudomonas aeruginosa clinical isolates. Antimicrob Agents Chemother. 2001; 45:480–4.

6. Köhler T, Michéa-Hamzehpour M, Henze U, Gotoh N, Curty LK, Pechère JC. Characterization of MexE-MexF-OprN, a positively regulated multidrug efflux system of Pseudomonas aeruginosa. Mol Microbiol. 1997; 23:345–54.

7. Sawada I, Maseda H, Nakae T, Uchiyama H, Nomura N. A quorum-sensing autoinducer enhances the mexAB-oprM efflux-pump expression without the MexR-mediated regulation in Pseudomonas aeruginosa. Microbiol Immunol. 2004; 48:435–9.

8. Quale J, Bratu S, Gupta J, Landman D. Interplay of efflux system, ampC, and oprD expression in carbapenem resistance of Pseudomonas aeruginosa clinical isolates. Antimicrob Agents Chemother. 2006; 50:1633–41.

9. Sobel ML, Neshat S, Poole K. Mutations in PA2491 (mexS) promote MexT-dependent mexEF-oprN expression and multidrug resistance in a clinical strain of Pseudomonas aeruginosa. J Bacteriol. 2005; 187:1246–53.

10. Vogne C, Aires JR, Bailly C, Hocquet D, Plésiat P. Role of the multidrug efflux system MexXY in the emergence of moderate resistance to aminoglycosides among Pseudomonas aeruginosa isolates from patients with cystic fibrosis. Antimicrob Agents Chemother. 2004; 48:1676–80.

11. Sung JY, Koo SH, Kwon KC, Park JW, Ko CS, Shin SY, et al. Characterization of class 1 integrons in metallo-beta-lactamase-producing Pseudomonas aeruginosa. Korean J Clin Microbiol. 2009; 12:17–23.

12. Yoon WS, Lee BY, Bae IK, Kwon SB, Jeong SH, Jeong TJ, et al. Prevalence of imipenem-resistant Pseudomonas aeruginosa isolates and mechanisms of resistance. Korean J Clin Microbiol. 2005; 8:26–33.

13. Jalal S and Wretlind B. Mechanisms of quinolone resistance in clinical strains of Pseudomonas aeruginosa. Microb Drug Resist. 1998; 4:257–61.

14. Rubin J, Walker RD, Blickenstaff K, Bodeis-Jones S, Zhao S. Antimicrobial resistance and genetic characterization of fluoroquinolone resistance of Pseudomonas aeruginosa isolated from canine infections. Vet Microbiol. 2008; 131:164–72.

15. Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; sixteenth informational supplement. M100-S10 (M2). Wayne, Pensylvania: CLSI. 2006.

16. Shannon KP and French GL. Increasing resistance to antimicrobial agents of Gram-negative organisms isolated at a London teaching hospital, 1995-2000. J Antimicrob Chemother. 2004; 53:818–25.

17. Chung SY, Sung JY, Kwon KC, Park JW, Ko CS, Shin SY, et al. Characteristics of acquired beta-lactamase gene in clinical isolates of multidrug-resistant Pseudomonas aeruginosa. Korean J Clin Microbiol. 2008; 11:98–106.

18. Llanes C, Hocquet D, Vogne C, Benali-Baitich D, Neuwirth C, Plésiat P. Clinical strains of Pseudomonas aeruginosa overproducing MexAB-OprM and MexXY efflux pumps simultaneously. Antimicrob Agents Chemother. 2004; 48:1797–802.

19. Ziha-Zarifi I, Llanes C, Köhler T, Pechere JC, Plesiat P. In vivo emergence of multidrug-resistant mutants of Pseudomonas aeruginosa overexpressing the active efflux system MexA-MexB-OprM. Antimicrob Agents Chemother. 1999; 43:287–91.

20. Lee K, Chong Y, Shin HB, Yong D. Rapid increase of imipenem-hydrolyzing Pseudomonas aeruginosa in a Korean hospital. Abstr E-85, 38th ICAAC. 1998.

21. Lee K, Lee WG, Uh Y, Ha GY, Cho J, Chong Y. Korean Nationwide Surveillance of Antimicrobial Resistance Group. VIM-and IMP-type metallo-beta-lactamase-producing Pseudomonas spp. and Acinetobacter spp. in Korean hospitals. Emerg Infect Dis. 2003; 9:868–71.

22. Kim IS, Lee NY, Ki CS, Oh WS, Peck KR, Song JH. Increasing prevalence of imipenem-resistant Pseudomonas aeruginosa and molecular typing of metallo-beta-lactamase producers in a Korean hospital. Microb Drug Resist. 2005; 11:355–9.

23. Akasaka T, Tanaka M, Yamaguchi A, Sato K. Type II topoisomerase mutations in fluoroquinolone-resistant clinical strains of Pseudomonas aeruginosa isolated in 1998 and 1999: role of target enzyme in mechanism of fluoroquinolone resistance. Antimicrob Agents Chemother. 2001; 45:2263–8.

Table 1.

Oligonucleotide primers for the detection of efflux regulator-encoding, OprD, and QRDR genes

Primer pairs	Target	Sequence (5′ – 3′)	Reference
Efflux regulator-encoding genes
mexR-F	mexR	TGTTCTTAAATATCCTCAAGCGG	8
mexR-R		GTTGCATAGCGTTGTCCTCA
nalC-F	nalC	TCAACCCTAACGAGAAACGCT	8
nalC-R		TCCACCTCACCGAACTGC
nalD-F	nalD	GCGGCTAAAATCGGTACACT	8
nalD-R		ACGTCCAGGTGGATCTTGG
mexT-F	mexT	AAAACCACCCGTCGTTATTG	8
mexT-R		CAGTTCGTCGGTGTAGCTGA
mexZ-F	mexZ	ATTGGATGTGCATGGGTG	8
mexZ-R		TGGAGATCGAAGGCAGC
Opr D gene
oprD-F	oprD	ATGCGACATGCGTCATGCAAT	4
oprD-R		CGGTACCTACGCCCTTCCTT
QRDR gene
GyrA-F	gyrA	CGGGATGAACGAATTGGGTGTGA	14
GyrA-R		AATTTTACTCATACGTGCTTCGG
ParC-F	parC	TTCCCGTGCATTTCGATCAGTACTTC	14
ParC-R		CGTATGACAAAGGATTCGGTAAATC
ParE-F	parE	GTCCGTAAAGCAATCAAAG	14
ParE-R		CTTTATATAAAGGCGGTAACG
GyrB-F	gyrB	TGAAATTCTTGCTGGAAAAC	14
GyrB-R		CAACAATAGGACGCATGTAAC

Table 2.

Minimum inhibitory concentrations (MICs) of the 7 antimicrobial agents for 21 isolates of imipenem-resistant Pseudomonas aeruginosa as determined by agar dilution

Isolates	MICs (mg/L) FEP							Rep-PCR identical strains^∗
Isolates	AMK	GEN	CAZ	FEP	IPM	MEM	CIP	Rep-PCR identical strains^∗
P1	128	＞1,024	16	4	＞1,024	128	＞32	4
P2	128	＞1,024	16	4	＞1,024	128	＞32	4
P3	＜2	64	64	＜2	256	16	4	5
P4	512	＞1,024	64	16	＞1,024	64	＞32	13
P5	128	＞1,024	16	4	＞1,024	128	＞32	4
P6	1,024	256	＞1,024	＞256	＞1,024	256	1	1
P8	1,024	256	＞1,024	＞256	＞1,024	64	1	1
P11	64	64	128	48	＞1,024	128	1	3
P15	＜2	＜2	＜2	＜2	16	2	＞32	1
P17	＞1,024	256	＞1,024	＞256	＞1,024	256	＞32	1
P18	＞1,024	＞1,024	＞1,024	＞256	＞1,024	512	2	1
P20	＜2	＜2	16	＜2	256	8	1	1
P28	32	32	256	128	＞1,024	16	＞32	1
P41	＞1,024	256	＞1,024	＞256	＞1,024	128	1	2
P48	16	32	＜2	8	512	32	＞32	6
P53	512	＞1,024	128	＞256	512	256	＞32	5
P55	＜2	＜2	16	＜2	256	8	1	1
P70	＜2	＜2	256	＞256	512	8	1	1
P86	＜2	＜2	256	128	512	16	1	1
P91	64	16	256	＞256	＞1,024	64	1	3
P92	32	32	256	＞256	＞1,024	32	＞32	3

^∗ The number of strain(s) shown identical rep-PCR band pattern. Abbreviations: AMK, amikacin; GEN, gentamicin; CAZ, ceftazidime; FEP, cefepime; IPM, imipenem; MEM, meropenem; CIP, ciprofloxacin.

Table 3.

Chromosomal alteration(s) in efflux regulator-encoding genes of imipenem-resistant Pseudomonas aeruginosa

Isolate	Chromosomal alteration(s) in
Isolate	MexR	NalC	NalD	MexT	MexZ
P1	Val₁₂₆→ Glu	None	None	Leu₂₆→ Val	None
P2	None	Gly₇₁→Glu, Ser₂₀₉→Arg	None	Leu₂₆→ Val	Ser₁₈₆→Asp
P3	Val₁₂₆→ Glu	Gly₇₁→Glu, Ser₂₀₉→Arg	None	Leu₂₆→ Val	Ser₁₈₆→Asp
P4	None	Gly₇₁→Glu, Glu₁₅₃→Gln, Ser₂₀₉→Arg	None	Leu₂₆→ Val	None
P5	None	Gly₇₁→Glu, Glu₁₅₃→Gln, Ser₂₀₉→Arg	None	Leu₂₆→ Val	His₅₁→Tyr, Arg₁₃₈→Leu, Ser₁₈₆→Asp
P6	None	None	None	None	None
P8	Val₁₂₆→ Glu	Gly₇₁→Glu, Ser₂₀₉→Arg	None	None	Arg₁₃₈→Leu, Ser₁₈₆→Asp
P11	None	Gly₇₁→Glu, Ser₂₀₉→Arg	None	Leu₂₆→ Val	Arg₁₃₈→Leu, Ser₁₈₆→Asp
P15	None	None	None	None	Gln₁₃₂→stop
P17	None	Gly₇₁→Glu, Glu₁₅₃→Gln, Ser₂₀₉→Arg	None	Leu₂₆→ Val	None
P18	None	Gly₇₁→Glu, Ala₁₈₆→Thr	None	Leu₂₆→ Val	Arg₁₃₈→Leu, Ser₁₈₆→Asp
P20	Val₁₂₆→ Glu	Gly₇₁→Glu, Ser₂₀₉→Arg	Thr₁₈₈→A	la Leu₂₆→ Val	None
P28	None	None	None	Leu₂₆→ Val	None
P41	Val₁₂₆→ Glu	Gly₇₁→Glu, Ser₂₀₉→Arg	None	None	None
P48	None	Gly₇₁→Glu, Ser₂₀₉→Arg	None	Leu₂₆→ Val	None
P53	None	Gly₇₁→Glu, Glu₁₅₃→Gln, Ser₂₀₉→Arg	None	Leu₂₆→ Val	Arg₁₃₈→Leu, Ser₁₈₆→Asp
P55	None	None	None	None	Arg₁₃₈→Leu, Ser₁₈₆→Asp
P70	None	None	None	None	Arg₁₃₈→Leu, Ser₁₈₆→Asp
P86	None	Gly₇₁→Glu, Ser₂₀₉→Arg	None	Leu₂₆→ Val	None
P91 P92	Val₁₂₆→ Glu Val₁₂₆→ Glu	Gly₇₁→Glu, Ser₂₀₉→Arg None	None None	Leu₂₆→ Val Leu₂₆→ Val	Arg₁₃₈→Leu, Ser₁₈₆→Asp Ser₁₈₆→ Asp

Table 4.

Chromosomal alteration(s) in oprD, gyrA, and parC of imipenem-resistant Pseudomonas aeruginosa

Isolate	Chromosomal alteration(s) in
Isolate	OprD	GyrA	ParC
P1	None	Thr83→Ile	Ser₈₇→Leu
P2	Deletion bp 352-368	Thr83→Ile	Ser₈₇→Leu
P3	None	None	None
P4	None	Thr83→Ile	Ser₈₇→Leu
P5	None	Thr83→Ile	Ser₈₇→Leu
P6	None	None	Ser₈₇→Leu
P8	None	None	None
P11	Tyr₉₁→stop	None	None
P15	None	None	Ser₈₇→Leu
P17	None	Thr83→Ile	Ser₈₇→Leu
P18	None	Thr83→Ile	Ser₈₇→Leu
P20	None	Thr83→Ile,	None
P28	None	Asp₈₇→Tyr
P41	None	Thr83→Ile	Ser₈₇→Leu
P48	Deletion G 333	None	Ser₈₇→Leu
P53	None	Thr83→Ile	Ser₈₇→Trp
P55	None	Thr83→Ile	Ser₈₇→Leu
P70	None	None	None
P86	None	None	None
P91	None	None	None
P92	GA insertion after A382	None	None

TOOLS

Similar articles