Loading [MathJax]/jax/output/HTML-CSS/fonts/TeX/fontdata.js

Journal List > J Korean Acad Prosthodont > v.49(3) > 1034670

Kim, Jeong, Jeon, Ryu, Huh, and Yun: Effect of RGD peptide coating of implant titanium surface on human mesenchymal stem cell response

Abstract

Purpose

The aim of this in vitro study was to estimate surface characteristic after peptide coating and investigate biological response of human mesenchymal stem cell to anodized titanium discs coated with RGD peptide by physical adhesion and chemical fixation.

Materials and methods

Fluorescence isothiocyanate (FITC) modified RGD-peptide was coated on the anodized titanium discs (diameter 12 mm, height 3 mm) using two methods. One was physical adhesion method and the other was chemical fixation method. Physical adhesion was performed by dip and dry procedure, chemical fixation was performed by covalent bond via silanization. In this study, human mesenchymal stem cell was used for experiments. The experiments consisted of surface characteristic evaluation after peptide coating, analysis about cell adhesion, proliferation, differentiation, and mineralization. Obtained data are statistically treated using Kruskal-Wallis test and Bonferroni test was performed as post hoc test (P=.05).

Results

The evaluation of FE-SEM images revealed no diffenrence at micro-surfaces between each groups. Total coating dose was higher at physical adhesion experimental group than at chemical fixation experimental group. In cell adhesion and proliferation, RGD peptide coating did not show a statistical significance compared with control group (P>.05). In cell differentiation and mineralization, physical adhesion method displayed significantly increased levels compared with control group and chemical fixation method (P<.05).

Conclusion

RGD peptide coating seems to enhance osseointegration by effects on the response of human mesenchymal stem cell. Especially physical adhesion method showed more effective than chemical fixation method on response of human mesenchymal stem cell. (J Korean Acad Prosthodont 2011;49:245-53)

Go to : Goto

REFERENCES

1.Le Gue′hennec L., Soueidan A., Layrolle P., Amouriq Y. Surface treatments of titanium dental implants for rapid osseointegration. Dent Mater. 2007. 23:844–54.
2.Junker R., Dimakis A., Thoneick M., Jansen JA. Effects of implant surface coatings and composition on bone integration: a systematic review. Clin Oral Implants Res. 2009. 20:185–206.
crossref
3.Puleo DA., Nanci A. Understanding and controlling the bone-implant interface. Biomaterials. 1999. 20:2311–21.
crossref
4.Dettin M., Conconi MT., Gambaretto R., Bagno A., Di Bello C., Menti AM., Grandi C., Parnigotto PP. Effect of synthetic peptides on osteoblast adhesion. Biomaterials. 2005. 26:4507–15.
crossref
5.Kim KH., Kwon TY., Kim SY., Kang IK., Kim S., Yang Y., Ong JL. Preparation and characterization of anodized titanium surfaces and their effect on osteoblast responses. J Oral Implantol. 2006. 32:8–13.
crossref
6.Balasundaram G., Yao C., Webster TJ. TiO2 nanotubes functionalized with regions of bone morphogenetic protein-2 increases osteoblast adhesion. J Biomed Mater Res A. 2008. 84:447–53.
7.Kataoka Y., Tamaki Y., Miyazaki T. Synergistric responses of su-perficail chemistry and micro topography of titanium created by wire-type electric discharge machining. Biomed Mater Eng. 2011. 21113–21.
8.Sato M., Webster TJ. Nanobiotechnology: implications for the future of nanotechnology in orthopedic applications. Expert Rev Med Devices. 2004. 1:105–14.
crossref
9.Dard M., Sewing A., Meyer J., Verrier S., Roessler S., Scharnweber D. Tools for tissue engineering of mineralized oral structures. Clin Oral Investig. 2000. 4:126–9.
crossref
10.Ruoslahti E., Pierschbacher MD. Arg-Gly-Asp: a versatile cell recognition signal. Cell. 1986. 44:517–8.
crossref
11.Xiao SJ., Textor M., Spencer ND. Covalent attachment of cell-adhesive, (Arg-Gly-Asp)-containing peptides to titanium surfaces. Langmuir. 1998. 14:5507–16.
crossref
12.Massia SP., Hubbell JA. Covalently attached GRGD on polymer surfaces promotes biospecific adhesion of mammalian cells. Ann N Y Acad Sci. 1990. 589:261–70.
crossref
13.Rezania A., Johnson R., Lefkow AR., Healy KE. Bioactivation of metal oxide surfaces. 1. Surface characterization and cell response. Langmuir. 1999. 15:6931–9.
crossref
14.Grzesik WJ., Robey PG. Bone matrix RGD glycoproteins: im-munolocalization and interaction with human primary osteoblastic bone cells in vitro. J Bone Miner Res. 1994. 9:487–96.
crossref
15.Schaffner P., Meyer J., Dard M., Wenz R., Nies B., Verrier S., Kessler H., Kantlehner M. Induced tissue integration of bone implants by coating with bone selective RGD-peptides in vitro and in vivo studies. J Mater Sci Mater Med. 1999. 10:837–9.
16.Kantlehner M., Schaffner P., Finsinger D., Meyer J., Jonczyk A., Diefenbach B., Nies B., Ho ¨lzemann G., Goodman SL., Kessler H. Surface coating with cyclic RGD peptides stimulates osteoblast adhesion and proliferation as well as bone formation. Chembiochem. 2000. 1:107–14.
crossref
17.Piattelli A., Scarano A., Corigliano M., Piattelli M. Effects of alkaline phosphatase on bone healing around plasma-sprayed titanium implants: a pilot study in rabbits. Biomaterials. 1996. 17:1443–9.
crossref
18.Lind M., Overgaard S., Ongpipattanakul B., Nguyen T., Bu ¨nger C., S � balle K. Transforming growth factor-beta 1 stimulates bone on-growth to weight-loaded tricalcium phosphate coated implants: an experimental study in dogs. J Bone Joint Surg Br. 1996. 78:377–82.
19.Liu SQ., Ito Y., Imanishi Y. Cell growth on immobilized cell growth factor: 5. Interaction of immobilized transferrin with fibroblast cells. Int J Biol Macromol. 1993. 15:221–6.
crossref
20.Kilpadi KL., Sawyer AA., Prince CW., Chang PL., Bellis SL. Primary human marrow stromal cells and Saos-2 osteosarcoma cells use different mechanisms to adhere to hydroxylapatite. J Biomed Mater Res A. 2004. 68:273–85.
crossref
21.Rezania A., Healy KE. The effect of peptide surface density on mineralization of a matrix deposited by osteogenic cells. J Biomed Mater Res. 2000. 52:595–600.
crossref
22.Zreiqat H., Akin FA., Howlett CR., Markovic B., Haynes D., Lateef S., Hanley L. Differentiation of human bone-derived cells grown on GRGDSP-peptide bound titanium surfaces. J Biomed Mater Res A. 2003. 64:105–13.
crossref
23.Huang H., Zhao Y., Liu Z., Zhang Y., Zhang H., Fu T., Ma X. Enhanced osteoblast functions on RGD immobilized surface. J Oral Implantol. 2003. 29:73–9.
crossref
24.Yang F., Williams CG., Wang DA., Lee H., Manson PN., Elisseeff J. The effect of incorporating RGD adhesive peptide in polyethylene glycol diacrylate hydrogel on osteogenesis of bone marrow stromal cells. Biomaterials. 2005. 26:5991–8.
crossref
25.Sawyer AA., Hennessy KM., Bellis SL. Regulation of mesenchymal stem cell attachment and spreading on hydroxyapatite by RGD peptides and adsorbed serum proteins. Biomaterials. 2005. 26:1467–75.
crossref
Go to : Goto

jkap-49-245f1.tif
Fig. 1.
Schematic diagram of the chemical fixation.
undefined
jkap-49-245f2.tif
Fig. 2.
FE-SEM images after peptide coating (×50,000 magnification). A: Control, B: Chemical fixation, C: Physical adhesion.
undefined
jkap-49-245f3.tif
Fig. 3.
Fluorescent microscope images after peptide coating. A: Control, B: Chemical fixation, C: Physical adhesion.
undefined
jkap-49-245f4.tif
Fig. 4.
Concentration curve by fluorescent spectroscopy.
undefined
jkap-49-245f5.tif
Fig. 5.
Confocal laser scanning microscopy images of cells grown on the surface of titanium specimen after incubation of 2 hours and 24 hours (×400 magnification). actin staining.
undefined
jkap-49-245f6.tif
Fig. 6.
Crystal violet assay of human mesenchymal stem cells grown on the surface of titanium specimen after incubation of 3 hours.
undefined
jkap-49-245f7.tif
Fig. 7.
Cell proliferation of human mesenchymal stem cells grown on the surface of titanium specimen after incubation of 3 days and 7 days.
undefined
jkap-49-245f8.tif
Fig. 8.
Real time-PCR analysis for mRNA of osteopontin grown on the surface of titanium specimen after incubation of 7 days (★:P<.05, Bonferroni test).
undefined
jkap-49-245f9.tif
Fig. 9.
Real time-PCR analysis for mRNA of collagen type I grown on the surface of titanium specimen after incubation of 7 days (★:P<.05, Bonferroni test).
undefined
jkap-49-245f10.tif
Fig. 10.
Real time-PCR analysis for mRNA of osteocalcin grown on the surface of titanium specimen after incubation of 7 days (★:P<.05, Bonferroni test).
undefined
jkap-49-245f11.tif
Fig. 11.
ALP activity of humen mesenchymal stem cells grown on the surface of titanium specimen after incubation of 7 days and 14 days (★:P<.05, Bonferroni test).
undefined
jkap-49-245f12.tif
Fig. 12.
Alizarin red assay of humen mesenchymal cells grown on the surface of titanium specimen after incubation of 21 days (★: P<.05, Bonferroni test).
undefined
Table 1.
RT-PCR primer sequence of bone forming related gene
  Primer (forward) 5 ‘→3’ Primer (reverse)
GAPDH AGCCACATCGCTCAGACAC GCCCAATACGACCAAATCC
Osteopontin CCCTGGCTGCGCTCTGT GCGCCGGAGTCTGTTCAC
Collagen type I AAGATGTGCCACTCTGACTG ATAGGTGATGTTCTGGGAGG
Osteocalcin CATGAGAGCCCTCACACTCC CTAGACCGGGCCCTAGAAGCG
Table 2.
The percentage of element content (%)
Element Control APTES Chemical fixation Physical adhesion
N 2.9 4.1 4.6 17.9
Si 0.0 5.9 3.0 0.0
C 46.6 40.0 55.4 92.0
S 3.8 3.4 2.6 2.7

ATPES: aminopropyltriethoxysilane

TOOLS
Similar articles