Journal List > J Bacteriol Virol > v.47(1) > 1034272

TOOLS
Kim and Choi: Clonal and Virulence Distribution of Uropathogenic Escherichia coli Isolated from Children in Korea
Original Article

J Bacteriol Virol 2017;47(1):54-63.

Published online: 9 February 2017

DOI: https://doi.org/10.4167/jbv.2017.47.1.54

Clonal and Virulence Distribution of Uropathogenic Escherichia coli Isolated from Children in Korea

Dong Ho Kim, Chul Hee Choi∗

Department of Microbiology and Medical Science, Chungnam National University School of Medicine, Daejeon, Korea

∗Corresponding author: Dr. Chul Hee Choi. Department of Microbiology and Medical Science, Chungnam National University School of Medicine, 266 Munwha-ro, Jung-gu, Daejeon 35015, Korea. Phone: +82-42-580-8246, Fax: +82-42-585-3686, e-mail: choich@cnu.ac.kr

∗∗ This work was supported by Chungnam National University (2014).

Received 31 January 201712 February 2017       Accepted 20 February 2017

Copyright © 2017 Journal of Bacteriology and Virology

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Urinary tract infections (UTI) are one of the most frequent infectious diseases. Uropathogenic Escherichia coli (UPEC) are among major pathogens causing UTI. A variety of virulence genes are mainly responsible for the severity of these emerging infection. This study investigate the influences of virulence properties of UPEC isolates with reference to multilocus sequence typing (MLST). The aim of this study was targeted that investigation of the bacterial pathogenicity associated with UTI in children. A total of 58 UPEC isolates were collected from urine samples from patients with clinical diagnosis of uncomplicated UTI. The MLST of UPEC strains were assessed by methods based on polymerase chain reaction. Motility was evaluated using soft-agar plates. Biofilm formation was analyzed in microtiter dish biofilm formation assay. Cell death assay was analyzed by Annexin V/Phosphatidylserine staining and DNA fragmentation assay. According the result, the predominant sequence type (ST) was ST95 (24.1%) and ST73 (17.2%). There were some difference in virulence gene and antibiotics resistance between ST95 and ST73. The number of 11 (18.9%) isolates were strongly adherent. Based on the detected biofilm formation, these strongly adherent are almost ST73. The ST95 was higher than ST73 in population, but ST95 was lower than ST73 in motility and cell death induction. This study indicated that the UPEC molecular strains are related to some virulence traits. Furthermore, the virulence factors carried by ST73 strains contribute to their abilities to colonize the host and cause disease.

Keywords: Uropathogenic Escherichia coli, Virulence, MLST, Sequence type, Clonal complex

REFERENCES

1). Asadi S, Kargar M, Solhjoo K, Najafi A, Ghorbani-Dalini S. The Association of Virulence Determinants of Uropathogenic Escherichia coli With Antibiotic Resistance. Jundishapur J Microbiol. 2014; 7:e9936.
crossref
2). Tabasi M, Asadi Karam MR, Habibi M, Yekaninejad MS, Bouzari S. Phenotypic Assays to Determine Virulence Factors of Uropathogenic Escherichia coli (UPEC) Isolates and their Correlation with Antibiotic Resistance Pattern. Osong Public Health Res Perspect. 2015; 6:261–8.
3). Blango MG, Mulvey MA. Persistence of uropathogenic Escherichia coli in the face of multiple antibiotics. Antimicrob Agents Chemother. 2010; 54:1855–63.
4). Lee S, Yu JK, Park K, Oh EJ, Kim SY, Park YJ. Phylogenetic groups and virulence factors in pathogenic and commensal strains of Escherichia coli and their association with blaCTX-M. Ann Clin Lab Sci. 2010; 40:361–7.
5). Bashir S, Sarwar Y, Ali A, Mohsin M, Saeed MA, Tariq A, et al. Multiple drug resistance patterns in various phylogenetic groups of uropathogenic E. coli isolated from Faisalabad region of Pakistan. Braz J Microbiol. 2011; 42:1278–83.
6). Obata-Yasuoka M, Ba-Thein W, Tsukamoto T, Yoshikawa H, Hayashi H. Vaginal Escherichia coli share common virulence factor profiles, serotypes and phylogeny with other extraintestinal E. coli. Microbiology. 2002; 148:2745–52.
7). Tartof SY, Solberg OD, Manges AR, Riley LW. Analysis of a uropathogenic Escherichia coli clonal group by multilocus sequence typing. J Clin Microbiol. 2005; 43:5860–4.
8). Banerjee R, Johnston B, Lohse C, Chattopadhyay S, Tchesnokova V, Sokurenko EV, et al. The clonal distribution and diversity of extraintestinal Escherichia coli isolates vary according to patient characteristics. Antimicrob Agents Chemother. 2013; 57:5912–7.
9). Yun KW, Kim DS, Kim W, Lim IS. Molecular typing of uropathogenic Escherichia coli isolated from Korean Children with urinary tract infection. Korean J Pediatr. 2015; 58:20–7.
10). Johnson JR. Virulence factors in Escherichia coli urinary tract infection. Clin Microbiol Rev. 1991; 4:80–128.
11). Le Bouguenec C, Garcia MI, Ouin V, Desperrier JM, Gounon P, Labigne A. Characterization of plasmid-borne afa-3 gene clusters encoding afimbrial adhesins expressed by Escherichia coli strains associated with intestinal or urinary tract infections. Infect Immun. 1993; 61:5106–14.
12). Lacher DW, Steinsland H, Whittam TS. Allelic subtyping of the intimin locus (eae) of pathogenic Escherichia coli by fluorescent RFLP. FEMS Microbiol Lett. 2006; 261:80–7.
13). Mulvey MA, Lopez-Boado YS, Wilson CL, Roth R, Parks WC, Heuser J, et al. Induction and evasion of host defenses by type 1-piliated uropathogenic Escherichia coli. Science. 1998; 282:1494–7.
14). Wiles TJ, Kulesus RR, Mulvey MA. Origins and virulence mechanisms of uropathogenic Escherichia coli. Exp Mol Pathol. 2008; 85:11–9.
15). Kammler M, Schön C, Hantke K. Characterization of the ferrous iron uptake system of Escherichia coli. J Bacteriol. 1993; 175:6212–9.
16). Kaper JB, Nataro JP, Mobley HL. Pathogenic Escherichia coli. Nat Rev Microbiol. 2004; 2:123–40.
17). Uhlich GA, Cooke PH, Solomon EB. Analyses of the red-dry-rough phenotype of an Escherichia coli O157: H7 strain and its role in biofilm formation and resistance to antibacterial agents. Appl Environ Microbiol. 2006; 72:2564–72.
18). Nolan LM, Cavaliere R, Turnbull L, Whitchurch CB. Extra-cellular ATP inhibits twitching motility-mediated biofilm expansion by Pseudomonas aeruginosa. BMC Microbiol. 2015; 15:55.
crossref
19). Lee JH, Subhadra B, Son YJ, Kim DH, Park HS, Kim JM, et al. Phylogenetic group distributions, virulence factors and antimicrobial resistance properties of uropathogenic Escherichia coli strains isolated from patients with urinary tract infections in South Korea. Lett Appl Microbiol. 2016; 62:84–90.
20). Novais Â, Vuotto C, Pires J, Montenegro C, Donelli G, Coque TM, et al. Diversity and biofilm-production ability among isolates of Escherichia coli phylogroup D belonging to ST69, ST393 and ST405 clonal groups. BMC Microbiol. 2013; 13:144.
21). Mills M, Meysick KC, O'Brien AD. Cytotoxic necrotizing factor type 1 of uropathogenic Escherichia coli kills cultured human uroepithelial 5637 cells by an apoptotic mechanism. Infect Immun. 2000; 68:5869–80.
22). Dhakal BK, Mulvey MA. The UPEC pore-forming toxin alpha-hemolysin triggers proteolysis of host proteins to disrupt cell adhesion, inflammatory, and survival pathways. Cell Host Microbe. 2012; 11:58–69.
23). Enari M, Sakahira H, Yokoyama H, Okawa K, Iwamatsu A, Nagata S. A caspase-activated DNase that degrades DNA during apoptosis, and its inhibitor ICAD. Nature. 1998; 391:43–50.
crossref
24). Johnson JR, Stell AL. Extended virulence genotypes of Escherichia coli strains from patients with urosepsis in relation to phylogeny and host compromise. J Infect Dis. 2000; 181:261–72.
25). Gordon DM, Clermont O, Tolley H, Denamur E. Assigning Escherichia coli strains to phylogenetic groups: multi-locus sequence typing versus the PCR triplex method. Environ Microbiol. 2008; 10:2484–96.
26). Emody L, Kerényi M, Nagy G. Virulence factors of uropathogenic Escherichia coli. Int J Antimicrob Agents. 2003; 22(Suppl 2):29–33.
27). Soto SM, Smithson A, Martinez JA, Horcajada JP, Mensa J, Vila J. Biofilm formation in uropathogenic Escherichia coli strains: relationship with prostatitis, urovirulence factors and antimicrobial resistance. J Urol. 2007; 177:365–8.

Figure 1.
Biofilm formation of UPEC isolates. UPEC isolates incubate for 24 h at 37°C in LB broth without NaCl. Biofilm was stained by 0.1% crystal violet. Error bars represent the standard deviations of the results from three independent experiments.
jbv-47-54f1.tif
Figure 2.
Motility of UPEC. (A and B) Motility on 0.3% LB Agar of CFT073, isolated UPEC No.2, 22, 26-1, 53 and 29 after 16 h of incubation at 37°C. The errors bars in panel A represent the standard deviations from four independent experiments. Significant difference in motility was to determined using one-way ANOVA; ∗, p < 0.005.
jbv-47-54f2.tif
Figure 3.
UPEC-induced cell death. (A) Apoptosis of T24 infected with UPEC No. 2, 22, 38, 26-1 or 53 (MOI 10) for 3 h was measured by flow cytometry using Annexin V/PI staining. (B) DNA fragmentation analysis of T24 cells infected with UPEC isolate No. 26-1. T24 cells were infected with UPEC isolate No. 26-1 at an MOI of 10 for different time point at 37°C. M, 100 bp DNA marker; Ctrl, no infection.
jbv-47-54f3.tif
Table 1.
Primers used for MLST
Housekeeping gene Primer Primer sequence (5′-3′) Amplicon size (bp) Annealing (Tm)
Adk (adenylate kinase) adk-F ATTCTGCTTGGCGCTCCGGG 583 54
adk-R CCGTCAACTTTCGCGTATTT
FumC (fumarate hydratase) fumC-F TCACAGGTCGCCAGCGCTTC 806 54
fumC-R GTACGCAGCGAAAAAGATTC
GyrB (DNA gyrase) gyrB-F TCGCGCACACGGATGACGGC 911 60
gyrB-R ATCAGGCCTTCACGCGATC
Icd (isocitrate dehydrogenase) Icd-F ATGGAAAGTAAAGTAGTTGTTCCGGCACA 878 54
Icd-R GGACGCAGCAGGATCTGTT
Mdh (malate dehydrogenase) Mdh-F ATGAAAGTCGCAGTCCTCGGCGCTGCTGGCGG 932 60
Mdh-R TTAACGAACTCCTGCCCCAGAGCGATATCTTTCTT
PurA (adenylosuccinate synthetase) purA-F CGCGCTGAGAAAGAGATGA 816 54
purA-R CATACGGTAAGCCACGCAGA
RecA (adenosine triphosphate/guanosine triphosphate binding motif) recA-F CGCATTCGCTTTACCCTGACC 780 58
recA-R TCGTCGAAATCTACGGACCGGA
Table 2.
Prevalence of sequence type and clonal complex in UPEC isolated from UTI
Clonal Complex (CC) Sequence type MLST allelic profile No. (%) of isolates
adk fumC gyrB icd mdh purA recA
ST 95 Cplx ST 95 37 38 19 37 17 11 26 14 (24.1)
ST 979 37 38 19 13 17 11 26 1 (1.7)
ST 3201 37 38 4 37 17 11 26 1 (1.7)
ST 73 Cplx ST 73 36 24 9 13 17 11 25 10 (17.2)
ST 638 76 24 9 13 17 11 25 5 (8.6)
ST 131 Cplx ST 3443 13 40 47 13 36 11 29 3 (5.2)
UA                 24 (41.4)

UA, Unassigned to any clonal complex

Table 3.
Prevalence of virulence gene in clonal complex
Virulence gene ST95 Cplx ST73 Cplx ST95 Cplx vs ST73 Cplx Total
n=16 (%) n=24 (%) p value 58 (%)
FimH 16 (100) 24 (100) 1 58 (100)
Sfa 16 (100) 24 (100) 1 58 (100)
PapA 11 (68.8) 5 (20.8) 0.003 23 (39.7)
HylA 7 (43.8) 21 (87.5) 0.003 36 (62.1)
CnfⅠ 8 (50) 21 (87.5) 0.01 38 (65.5)
IucC 15 (93.8) 17 (70.8) 0.08 47 (81)
AfaC - - 2 (8.3) 0.242 5 (8.6)
FeoB 16 (100) 23 (95.8) 0.414 57 (98.3)
Irp-2 15 (93.8) 22 (91.7) 0.809 55 (94.8)
IroN 4 (25) 17 (70.8) 0.005 23 (39.7)
Iha 1 (6.3) 18 (75) 0.000025 30 (51.7)
Eae - - 0 - 1 6 (10.3)
Stb 5 (31.3) 10 (41.7) 0.51 25 (43.1)
LT-1 - - - - 1 - -
Table 4.
Prevalence of antibiotics resistance in clonal complex
Antibiotics ST95 Cplx ST73 Cplx Total
n=16 % n=24 % n=58 %
Gentamycin 2 (12.5) 5 (20.8) 11 (18.9)
Tobramycin 2 (12.5) 6 (25) 9 (15.5)
Amikacin - - - - - -
Ampicillin 11 (68.8) 23 (95.8) 49 (84.4)
Imipenem - - - - - -
Meropenem - - - - - -
Cefotaxime 2 (12.5) 5 (20.8) 8 (13.7)
Ceftazidime 1 (6.3) 2 (8.3) 4 (6.8)
Cefepim 1 (6.3) 1 (4.2) 4 (6.8)
Cefoxitin 1 (6.3) - - 3 (5.1)
Aztreonam 2 (12.5) 2 (8.3) 5 (8.6)
Chloramphenicol - - 2 (8.3) 2 (3.4)
Trimethoprim 5 (31.3) 5 (20.8) 22 (37.9)
Ciprofloxacin 3 (18.8) 6 (25) 18 (31)
Tetracycline 3 (18.8) 7 (29.2) 21 (36.2)
TOOLS
Similar articles