Journal List > J Bacteriol Virol > v.46(4) > 1034221

Rhee, Choi, and Ko: Efflux Pump Inhibitor Carbonyl Cyanide-m-chlorophenylhydrazone (CCCP) Enhances Bacteriostatic Activity of Trimethoprim-sulfamethoxazole Against Clinical Stenotrophomonas maltophilia Isolates from Korea

Abstract

Although trimethoprim-sulfamethoxazole (TMP-SXT) is considered the first-line therapy for Stenotrophomonas maltophilia infections, there is debate on the use of the bacteriostatic drug in serious infections, and recently, there has been an increasing occurrence of acquired resistance to TMP-SXT. In the present study, the effect of efflux pump inhibitors on the susceptibility of TMP-SXT and other antibiotics were investigated in S. maltophilia complex. The sul and/or dfr A genes were identified in only up to 27.8% of all 36 TMP-SXT-resistant S. maltophilia complex isolates. Thus, TMP-SXT resistance in S. maltophilia was not explained completely by the presence of sul and dfr A genes. Carbonyl cyanide-m-chlorophenylhydrazone (CCCP) decreased the minimum inhibitory concentration (MIC) of TMP-SXT by eight to 128 folds in all 14 isolates. In contrast, 2,4-dinitrophenol (DNP), phenyl-arginine-β-naphthylamide (PAβN), and reserpine did not reduce the MIC of TMP-SXT. In addition to TMP-SXT, slight decrease in MICs was observed for tigecycline and piperacillin/tazobactam by CCCP (by two folds) in one isolate. Although efflux pump may play a role in TMP-SXT resistance in S. maltophilia, inhibition of the efflux pump could be done by active proton pore.

REFERENCES

1). Al-Hamad A, Burnie J, Upton M. Enhancement of antibiotic susceptibility of Stenotrophomonas maltophilia using a polyclonal antibody developed against an ABC multidrug efflux pump. Can J Microbiol. 2011; 57:820–8.
2). Caylan R, Kaklikkaya N, Aydin K, Aydin F, Yilmaz G, Ozgumus B, et al. An epidemiological analysis of Stenotrophomonas maltophilia strains in a university hospital. Jpn J Infect Dis. 2004; 57:37–40.
3). Gülmez D, Hascelik G. Stenotrophomonas maltophilia: antimicrobial resistance and molecular typing of an emerging pathogen in a Turkish university hospital. Clin Microbiol Infect. 2005; 11:880–6.
4). Fedler KA, Biedenbach DJ, Jones RN. Assessment of pathogen frequency and resistance patterns among paediatric patient isolates: report from the 2004 SENTRY Antimicrobial Surveillance Program on three continents. Diagn Microbiol Infect Dis. 2006; 56:427–36.
5). Barchitta M, Cipresso R, Giaquinta L, Romeo MA, Denaro C, Pennisi C, et al. Acquisition and spread of Acinetobacter baumannii and Stenotrophomonas maltophilia in intensive care patients. Int J Hyg Environ Health. 2009; 212:330–7.
6). Rhee JY, Choi JY, Choi MJ, Song JH, Peck KR, Ko KS. Distinct groups and antimicrobial resistance of clinical Stenetrophomonas maltophilia complex isolates from Korea. J Med Microbiol. 2013; 62:748–53.
7). Ma L, Borio L, Masur H, Kovacs JA. Pneumocystis carinii dihydropteroate synthase but not dihydrofolate reductase gene mutations correlate with prior trimethoprim-sulfamethoxazole or dapsone use. J Infect Dis. 1999; 180:1969–78.
8). Coque TM, Singh KV, Weinstock GM, Murray BE. Characterization of dihydrofolate reductase genes from trimethoprim-susceptible and trimethoprim-resistant strains of Enterococcus faecalis. Antimicrob Agents Chemother. 1999; 43:141–7.
9). Hu LF, Chang X, Ye Y, Wang ZX, Shoa YB, Shi W, et al. Stenotrophomonas maltophilia resistance to trimethoprim/sulfamethoxazole mediated by acquisition of sul and dfr A genes in a plasmid-mediated class 1 integron. Int J Antimicrob Agents. 2011; 37:230–4.
10). Kalkut G. Sulfonamides and trimethoprim. Cancer Invest. 1998; 16:612–5.
crossref
11). Ziha-Zarifi I, Llanes C, Köhler T, Pechere JC, Plesiat P. In vivo emergence of multidrug-resistant mutants of Pseudomonas aeruginosa overexpressing the active efflux system MexA-MexB-OprM. Antimicrob Agents Chemother. 1999; 43:287–91.
12). Coldham NG, Webber M, Woodward MJ, Piddock LJ. A 96-well plate fluorescence assay for assessment of cellular permeability and active efflux in Salmonella enterica serovar Typhimurium and Escherichia coli. J Antimicrob Chemother. 2010; 65:1655–63.
13). Baugh S, Ekanayaka AS, Piddock LJ, Webber MA. Loss of or inhibition of all multidrug resistance efflux pumps of Salmonella enterica serovar Typhimurium results in impaired ability to form a biofilm. J Antimicrob Chemother. 2012; 67:2409–17.
14). Falagas ME, Valkimadi PE, Huang YT, Matthaiou DK, Hsueh PR. Therapeutic options for Stenotrophomonas maltophilia infections beyond co-trimoxazole: a systemic review. J Antimicrob Chemother. 2008; 62:889–94.
15). Alonso A, Martinez JL. Expression of multidrug efflux pump SmeDEF by clinical isolates of Stenotrophomonas maltophilia. Antimicrob Agents Chemother. 2001; 45:1879–81.
16). Clinical and Laboratory Standards Institute (CLSI). Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria that Grow Aerobically M07-A8; Approved Standard-Eighth Edition, Wayne, PA: CLSI. 2009.
17). Clinical and Laboratory Standards Institute (CLSI). Performance standards for antimicrobial susceptibility testing, 21st informational supplement, M100-S21. Wayne, PA: CLSI. 2011.
18). Hu LF, Chen GS, Kong QX, Gao LP, Chen X, Ye Y, et al. Increase in the prevalence of resistance determinants to trimethoprim/sulfamethoxazole in clinical Stenotrophomonas maltophilia isolates in China. PLoS One. 2016; 11:e015693.
19). Coldham NG, Webber M, Woodward MJ, Piddock LJ. A 96-well plate fluorescence assay for assessment of cellular permeability and active efflux in Salmonella enterica serovar Typhimurium and Escherichia coli. J Antimicrob Chemother. 2010; 65:1655–63.
20). Zhang L, Li XZ, Poole K. SmeDEF Multidrug Efflux Pump Contributes to Intrinsic Multidrug Resistance in Stenotrophomonas maltophilia. Antimicrob Agents Chemother. 2001; 45:3497–503.
21). Cortez-Cordova J, Kumar A. Activity of the efflux pump inhibitor phenylalanine-arginine β-naphthylamide against the AdeFGH pump of Acinetobacter baumannii. Int J Antimicrob Agents. 2011; 37:420–4.
22). Mamelli L, Amoros JP, Pagès JM, Bolla JM. A phenylalanine-arginine β-naphthylamide sensitive multidrug efflux pump involved in intrinsic and acquired resistance of Campylobacter to macrolides. Int J Antimicrob Agents. 2003; 22:237–41.
23). Garvey MI, Piddock LJ. The Efflux Pump Inhibitor Reserpine Selects Multidrug-Resistant Streptococcus pneumoniae Strains That Overexpress the ABC Transporters PatA and PatB. Antimicrob Agents Chemother. 2008; 52:1677–85.
24). Ito M, Ohnishi Y, Itoh S, Nishimura M. Carbonyl cyanide-m-chlorophenyl hydrazone-resistant Escherichia coli mutant that exhibits a temperature-sensitive unc phenotype. J Bacteriol. 1983; 153:310–5.
25). Ramón-García S, Martín C, Thompson CJ, Aínsa JA. Role of the Mycobacterium tuberculosis P55 efflux pump in intrinsic drug resistance, oxidative stress responses, and growth. Antimicrob Agents Chemother. 2009; 53:3675–82.
26). Ghoul M, Pommepuy M, Moillo-Batt A, Cormier M. Effect of carbonyl cyanide m-chlorophenylhydrazone on Escherichia coli halotolerance. Appl Environ Microbiol. 1989; 55:1040–3.
27). Banerjee SK, Bhatt K, Rana S, Misra P, Chakraborti PK. Involvement of an efflux system in mediating high level of fluoroquinolone resistance in Mycobacterium smegmatis. Biochem Biophys Res Commun. 1996; 226:362–8.

Table 1.
Oligonucleotide primers used in detecting sul1, sul2, and dfr A genes
Gene PCR primers (5′ to 3′) Ta Product size (bp)
sul1 F: GCGATCGAAATGCTGCGAGT R: AACCCTCGGTCTCTGGCGGCGT 61℃ 429
sul2 F: CCTGTTTCGTCCGACACAGA R: GAAGCGCAGCCGCAATTCAT 60℃ 435
dfr A1 F: CTTGTTAACCCTTTTGCCAGA R: TTGTGAAACTATCACTAATGGTAG 58℃ 480
dfr A5 F: ATCGTCGATATATGGAGCGTA R: TCCACACATACCCTGGTCCG 62℃ 350
dfr A12/13 F: GTCGTTGTCATGGGGCGAAA R: TCGACGCGCATAAACGGAGT 60℃ 381
dfr A17 F: GTTAGCCTTTTTTCCAAATCTGGTATG R: TTGAAAATATTATTGATTTCTGCAGTG 60℃ 475
Table 2.
Distribution of sul1 and dfrA genes in TMP-SXT-resistant isolates
Isolate MIC (mg/l) Gene
TMP-SXT LVX CZM P/T TG sul1 dfr A1 dfr A5 dfr A12/13
K01-OTH-06-119 4:76 16 2 16:4 8 - - + +
K01-OTH-09-7 4:76 16 >64 64:4 2 - - + +
K01-OTH-09-126 4:76 32 8 16:4 1 - - - +
K01-OTH-06-3 8:152 0.5 64 32:4 2 + + - -
K01-OTH-09-142 8:152 16 16 16:4 4 - - + -
M11610766 16:304 32 >64 >256:4 16 + - - +
M11733232 16:304 64 >64 256:4 8 - - - +
K103-OTH-08-1 >64:1216 1 64 16:4 0.5 + - - -
M11893222 >64:1216 32 64 32:4 0.5 + - - +
M11893758 >64:1216 32 64 16:4 4 + - - +

TMP-SXT, trimethoprim-sulfamethoxazole; LVX, levofloxacin, CZM, ceftazidime; P/T, piperacillin-tazobactam; TG, tigecycline.

Table 3.
Trimethoprim-sulfamethoxazole MICs of Stenotrophomonas maltophilia complex in treating with efflux pump inhibitors including CCCP and PAβN
Isolate MIC (mg/l)
TMP-SXT TMP-SXT + CCCP (10 μM) TMP-SXT + PAβN (25 mg/l)
K01-OTH-06-4 32:608 2:38 32:608
K01-OTH-06-116 4:76 0.125:2.375 8:152
K01-OTH-06-119 16:304 0.5:9.5 32:608
K01-OTH-06-167 16:304 0.125:2.375 32:608
K01-OTH-08-84 8:152 0.125:2.375 16:304
K01-OTH-09-7 64:1216 8:152 32:608
K103-OTH-08-1 32:608 4:76 32:608
K01-OTH-06-1 2:38 0.0625:1.1875 4:76
K01-OTH-06-6 2:38 0.0625:1.1875 2:38
K01-OTH-06-18 2:38 0.0625:1.1875 2:38
K01-OTH-06-20 2:38 0.0625:1.1875 2:38
K01-OTH-06-94 2:38 0.0625:1.1875 2:38
K01-OTH-06-122 2:38 0.0625:1.1875 2:38
K01-OTH-07-13 2:38 0.0625:1.1875 2:38

TMP-SXT, trimethoprim-sulfamethoxazole; CCCP, carbonyl cyanide-m-chlorophenylhydrazone; PAβN, phenyl-arginine-β-naphthylamide.

Table 4.
Trimethoprim-sulfamethoxazole MICs of Trimethoprim-sulfamethoxazole resistant strains in treating with efflux pump inhibitors
Isolate MIC (mg/l)
TMP-SXT TMP-SXT + CCCP (10 mg/l) TMP-SXT + DNP (1 mM/ml) TMP-SXT + PAβN (25 mg/l) TMP-SXT Reserpine (20 mg/l)
K01-OTH-06-4 32:608 2:38 32:608 32:608 32:608
K01-OTH-06-116 4:76 0.125:2.375 16:304 8:152 4:76
K01-OTH-06-119 16:304 0.5:9.5 32:608 32:608 16:304
K01-OTH-06-167 16:304 0.125:2.375 32:608 32:608 16:304
K01-OTH-08-84 8:152 0.125:2.375 16:304 16:304 8:152
K103-OTH-08-1 32:608 4:76 16:304 32:608 32:608

TMP-SXT, trimethoprim-sulfamethoxazole; CCCP, carbonyl cyanide-m-chlorophenylhydrazone; DNP, 2,4-dinitrophenol; PAβN, phenyl-arginine-β-naphthylamide.

Table 5.
MICs of a trimethoprim-sulfamethoxazole resistant strain K01-OTH-06-119 and K01-OTH-06-167 in treating with efflux pump inhibitors
Antimicrobial agent Strain MIC (mg/l)
  + CCCP (10 μM) + DNP (1 mM) + PAβN (25 mg/l) Reserpine (20 mg/l)
TMP-SXT K01-OTH-06-119 16:304 0.5:9.5 32:608 32:608 16:304
K01-OTH-06-167 16:304 0.125:2.375 32:608 32:608 16:304
levofloxacin K01-OTH-06-119 8 8 16 16 16
K01-OTH-06-167 4 4 4 4 4
Piperacillin /tazobactam K01-OTH-06-119 >256:4 128:4 >256:4 >256:4 >256:4
K01-OTH-06-167 8:4 8:4 16:4 8:4 8:4
Ceftazidime K01-OTH-06-119 2 2 2 2 2
K01-OTH-06-167 2 2 2 2 2
Tigecycline K01-OTH-06-119 4 2 4 8 4
K01-OTH-06-167 0.5 0.5 0.5 2 0.5

TMP-SXT, trimethoprim-sulfamethoxazole; CCCP, carbonyl cyanide-m-chlorophenylhydrazone; DNP, 2,4-dinitrophenol; PAβN, phenyl-arginine-β-naphthylamide.

TOOLS
Similar articles