Development and Verification of Nested PCR Assay for Detection of Tobacco rattle virus in Plant Quarantine

Siwon Lee; Jin-Young Lee; Yong-Gil Shin; Su-Heon Lee; Tae-Young Ahn

doi:10.4167/jbv.2015.45.1.54

Journal List > J Bacteriol Virol > v.45(1) > 1034203

Go to TopGo to Top Go to BottomGo to Bottom

TOOLS

Lee, Lee, Shin, Lee, and Ahn: Development and Verification of Nested PCR Assay for Detection of Tobacco rattle virus in Plant Quarantine

Communication

J Bacteriol Virol 2015;45(1):54-61.

Published online: 9 February 2015

DOI: https://doi.org/10.4167/jbv.2015.45.1.54

Development and Verification of Nested PCR Assay for Detection of Tobacco rattle virus in Plant Quarantine

Siwon Lee¹, Jin-Young Lee², Yong-Gil Shin², Su-Heon Lee^3,^*, Tae-Young Ahn^4,^*

¹Environmental Infrastructure Research Department, National Institute of Environmental Research, Incheon, Korea

²Incheon International Airport Regional Office, Animal and Plant Quarantine Agency, Incheon, Korea

³School of Applied Biosciences, Kyungpook National University, Daegu, Korea

⁴Department of Microbiology, College of Natural Sciences, Dankook University, Cheonan, Korea

^*Corresponding author: Su-Heon Lee. School of Applied Biosciences, Kyungpook National University, Daegu 702-701, Korea. Phone: +82-53-950-5763, Fax: +82-53-950-6758, e-mail: suheon@knu.ac.kr

^*Corresponding author: Tae-Young Ahn. Department of Microbiology, College of Natural Sciences, Dankook University, Cheonan 330-714, Korea. Phone: +82-41-550-3451, Fax: +82-41-550-3450, e-mail: ahnty@dankook.ac.kr

^** The present research was conducted by the Research Fund of Animal and Plant Quarantine Agency in 2006–2008.

Received 12 December 201422 February 2015 Accepted 27 February 2015

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Tobacco rattle virus (TRV) is a plant pathogen belonging to the Group IV positive-sense single-stranded RNA viruses. TRV causes disease in various plants (e.g., potato, tomato and tobacco), for which it was classified as a controlled quarantine virus in Korea. This study aimed to develop specific primer sets for the rapid detection of TRV. Two RT-PCR primer sets were developed for specific detection of TRV. Furthermore, nested primer sets were also developed, which is required for high sensitivity detection in plant quarantine. The RT-PCR and nested PCR products had the following sizes: set 5 (1,096→540 bp), and set 7 (878→756 bp), respectively. In addition, a modified positive-control plasmid was also developed for use as a positive control in TRV quarantine. The diagnostic system for TRV detection was verified using samples from Korean quarantine sites for the last five years (2009–2014). A total of 83 cases were detected among various import crops. This system for detection of TRV will continuously contribute to plant quarantine in the future.

Keywords: Tobacco rattle virus, Nested PCR, Quarantine

REFERENCES

1). Lee S, Kang EH, Heo NY, Kim SM, Kim YJ, Shin YG. Detection of Carnation necrotic fleck virus and Carnation ringspot virus using RT-PCR. Res Plant Dis. 2013; 19:36–44.

2). Lee S, Kang EH, Chu YM, Shin YG, Ahn TY. Development of PCR diagnosis system for plant quarantine seed-borne Wheat streak mosaic virus. Korean J Microbiol. 2013; 49:112–7.

3). Lee S, Shin YG. Development and practical use of RT-PCR for seed-transmitted Prune dwarf virus in quarantine. Plant Pathol J. 2014; 30:178–82.

4). Nicolaisen M, Bösze Z, Nielsen SL. Detection of Tobacco rattle virus in potato tubers using a simple RT-PCR procedure. Potato Research. 1999; 42:173–9.

5). Wei T, Lu G, Clover GRG. A multiplex RT-PCR for the detection of Potato yellow vein virus, Tobacco rattle virus and Tomato infectious chlorosis virus in potato with a plant internal amplification control. Plant Pathology. 2009; 58:203–9.

6). Pérez EE, Weingartner DP, Hiebert E, McSorley R. Tobacco rattle virus detection in potato tubers from northeast Florida by PCR and tissue blotting. Amer J of Potato Res. 2012; 77:363–8.

7). Riga E, Larsen R, Eastwell K, Guerra N, Guerra L, Crosslin JM. Rapid detection of Tobacco rattle tobravirus in Viruliferous paratrichodorus allius from greenhouse and field specimens. J Nematol. 2009; 41:60–3.

8). Kenyon DM, Handy CL, Thomas JE. Detection of Tobacco rattle virus in soil using real-time PCR. Aspects of Applied Biology. 2005; 76:77–9.

9). Yang JG, Wang FL, Chen DX, Shen LL, Qian YM, Liang ZY, et al. Development of a one-step immunocapture real-time RT-PCR assay for detection of Tobacco mosaic virus in soil. Sensors. 2012; 12:16685–94.

10). Xu H, Nie J. Molecular detection and identification of potato isolates of Tobacco rattle virus. Canadian J Plant Pathol. 2006; 28:271–9.

11). Holeva R, Phillips MS, Neilson R, Brown DJF, Young V, Boutsika K, et al. Real-time PCR detection and quantification of vector trichodorid nematodes and Tobacco rattle virus. Mol Cell Probes. 2006; 20:203–11.

12). Mumford RA, Walsh K, Barker I, Boonham N. Detection of Potato mop top virus and Tobacco rattle virus using a multiplex real-time fluorescent reverse-transcription polymerase chain reaction assay. Phytopathology. 2000; 90:448–53.

13). Shin YG, Rho JY. Development of a PCR diagnostic system for Iris yellow spot tospovirus in quarantine. Plant Pathol J. 2014; 30:440–4.

14). Animal, Plant and Fisheries Quarantine and Inspection Agency. List of plant quarantine viruses in Korea newly revised in 2013. Res Plant Dis. 2013; 19:67–75.

15). Shin YG. An advanced quarantine system for the inspection of seed-borne viruses in Korea. 2009.

16). Lee S, Kang EH, Shin YG, Lee SH. Development of RT-PCR and nested PCR for detecting four quarantine plant viruses belonging to Nepovirus. Res Plant Dis. 2013; 19:220–5.

Figure 1.

Map of primer design for detection of TRV

Figure 2.

Results of selection of TRV RT-PCR primer sets. Panel (A), First selection of specific RT-PCR primer sets for the detection of TRV. M, 100 bp step DNA Ladder maker (Genepia, Korea); dot, selected PCR primer set; Lane number, primer set for detection of TRV. Panel (B), Second selection of specific RT-PCR primer sets for the detection of TRV. Lane M, 100 bp step DNA Ladder maker (Genepia); lane AM, Alfalfa mosaic virus; lane Ar, Arabis mosaic virus; lane CM, Cucumber mosaic virus; lane Pe, Pepper mottle virus; lane PY, Potato virus Y; lane RM, Ribgrass mosaic virus; lane TG, Tobacco mild-green mosaic virus; lane TM, Tobacco mosaic virus; lane To, Tomato mosaic virus; lane TS, Tomato spotted wilt virus.

Figure 3.

RT-PCR sensitivity test on the selective primer sets for TRV.

Figure 4.

Result of selected RT-PCR and nested-PCR products for the detection of TRV. Lane M, 100 bp step DNA Ladder; lane 1, final selected primer set #5 (1,096 bp); lane 2, nested-PCR product from primer set #5 (543 bp); lane 3, final selected primer set #7 (880 bp); lane 4, nested-PCR product from primer set #7 (760 bp).

Figure 5.

BamH I sequence insertion of the TRV genetically modified-positive control plasmids.

Table 1.

RT-PCR amplification sets and product size for the detection of TRV

Set	Forward primer (location)	Reverse primer (location)	Product size (bp)
1	TRV-N50 (6,233∼6,257)	TRV-C10 (6,572∼6,593)	340
2	TRV-N40 (4,998∼5,021)	TRV-C20 (5,246∼5,270)	273
3	TRV-N30 (4,540∼4,561)	TRV-C20 (5,246∼5,270)	731
4	TRV-N30 (4,540∼4,561)	TRV-C30 (4,995∼5,019)	480
5	TRV-N20 (2,782∼2,805)	TRV-C40 (3,857∼3,877)	1,096
6	TRV-N10 (1,459∼1,481)	TRV-C50 (2,459∼2,477)	1,019
7	TRV-N10 (1,459∼1,481)	TRV-C60 (2,314∼2,338)	880

Table 2.

Final selection of RT-PCR and nested primer sets for the detection of TRV

Primer		Sequence (5′→3′)	Product size (bp)
Set 5	TRV-N20 TRV-C40 TR-N22	CGCGGTCGAAAGGATGAGTGATTA TCCCGGAAACAAAGCGTCGTA GTAAGTCGACAATGATTGTC	1,096
Nested primer of set 5	TR-C45	GAAGGAAAGTTATGTACTGAG	543
Set 7	TRV-N10 TRV-C60 TR-N11	GGCCGTGAAGAACAAGCAAAGTG TTGTACCGCTTGTTTCCCCTCTT GATTCTCGAGATTTACAGTTG	880
Nested primer of set 7	TR-C62	TGCTCCATGATCTCCTCATC	760

Table 3.

Results of detection for TRV from plant quarantine sites in 2009–2014

Item	Year (number of detection)						Total
Item	2009	2010	2011	2012	2013	2014	Total
Bulb (119 cases)
Gladiolus					5		5
Nectaroscordum				1			1
Dahlia				1			1
Leucocoryne				1		2	3
Ranunculus						1	1
Garlic	1						1
Druce						1	1
Poison						1	1
Lily				1		1	2
Narcissus	3	11	1	2	6	15	38
Snowflake						1	1
Anemone	1	2			4	8	15
Amaryllis						1	1
Iris						1	1
Alium	1				12	5	18
Alstromeria						1	1
Ornithogalum						1	1
Orange Daylily						1	1
Calochortus				1			1
Crocus	1			1		4	6
Tulip						3	3
Puschkinia						1	1
Ornamental Plants Etc.	1					4	5
Hemerocalis						1	1
Hyacinth		5			1	3	9
Seed (16 cases)
Hot pepper				3		3	6
Iceland Poppy			1	1			2
Tomato	1		1	1		3	6
Paprika				1		1	2
Etc. (1 case)
Shallot		1					1
Total	9	19	3	14	28	63	136

TOOLS

Similar articles