Journal List > J Bacteriol Virol > v.44(1) > 1034156

TOOLS
Park, Choi, Shin, Choi, Kim, and Jang: Identification of Leptospira species of Korean Isolates using Phylogenetic Analysis of Polymerase Chain Reaction-amplified 16S rDNA and LipL32 Genes
Original Article

J Bacteriol Virol 2014;44(1):59-66.

Published online: 9 February 2014

DOI: https://doi.org/10.4167/jbv.2014.44.1.59

Identification of Leptospira species of Korean Isolates using Phylogenetic Analysis of Polymerase Chain Reaction-amplified 16S rDNA and LipL32 Genes

Kyung-Hee Park1, Yeon-Joo Choi1, 2, Sun-Hye Shin1, Min-Kyung Choi1, Yoon-Won Kim3, Won-Jong Jang1, 2, *

1Department of Microbiology, College of Medicine, Konkuk University, Seoul, Korea

2Institute of Glocal Disease Control, College of Medicine, Konkuk University, Seoul, Korea

3Department of Microbiology, College of Medicine, Hallym University, Chunchon, Kangwon-do, Korea

*Corresponding author: Won-Jong Jang. Department of Microbiology, College of Medicine, Konkuk University, 120 Neungdong-ro, Gwangjin-gu, Seoul, 143-701, Korea. Phone: +82-2-2030-7816, Fax: +82-2-2030-7845, e-mail: wjjang@kku.ac.kr

** This work was supported by the Konkuk University.

Received 28 December 201310 February 2014       Accepted 28 February 2014

Copyright © 2014 Journal of Bacteriology and Virology

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

In this study, we selected only serologically identified 15 Leptosira interrogans isolates in the past and analyzed and identified them by using molecular method. The partial 16S rDNA and LipL32 genes were amplified from the bacteria by polymerase chain reaction (PCR) and sequenced. Sizes of the PCR products were 529 bp and 819 bp respectively and analysis of the nucleotide sequence of 16S rDNA and LipL32 genes showed that 14 out the 15 Leptospira showed 99.4∼100% and 99.2∼99.9% similarity respectively to those of L. interrogans lai and one isolate named HS-7 showed 100% and 100% similarity to L. interrogans canicola. The phylogenetic tree based on the 16S rDNA and LipL32 genes obtained the study revealed that 14 of the Leptospira composed a cluster distinct to that of L. interrogans lai and HS-7 composed to L. interrogans canicola.

Keywords: Leptospira interrogans, Serovar, Genospecies

REFERENCES

1). Yim EK, Kim YW, Lee JS, Chang IA, Baek LJ, Song JW, et al. Detection of leptospiral DNA from field rodents by PCR. J Bacteriol Virol. 2003; 33:177–81.
2). Bharti AR, Nally JE, Ricaldi JN, Matthias MA, Diaz MM, Lovett MA, et al. Leptospirosis: a zoonotic disease of global importance. Lancet Infect Dis. 2003; 3:757–71.
crossref
3). Kim MJ. Leptospirosis in the Republic of Korea: Historical Perspectives, Current Status and Future Challenges. Infect Chemother. 2013; 45:137–44.
crossref
4). Adler B, de la Peña Moctezuma A. Leptospira and leptospirosis. Vet Microbiol. 2010; 27:287–96.
5). Evangelista KV, Coburn J. Leptospira as an emerging pathogen: a review of its biology, pathogenesis and host immune responses. Future Microbiol. 2010; 5:1413–25.
6). Chang WH, Kim YW, Oh HB, Cho MK, Kee SH, Kim HJ. Serovar identification and genetic characterization of Leptospira isolates by arbitrarily primed PCR and ribotyping. J Korean Soc Microbiol. 1999; 34:409–21.
7). Cerqueira GM, Picardeau M. A century of Leptospira strain typing. Infect Genet Evol. 2009; 9:760–8.
8). Levett PN. Leptospirosis. Clin Microbiol Rev. 2001; 14:296–326.
crossref
9). Oh HB, Chang WH, Cho MK, Seong WK, Park KS. Identification of new serovar yeonchon and hongchon belonging to Leptospira interrogans Icterohaemorrhagiae serogroup. J Kor Soc Microbiol. 1991; 26:253–62.
10). Ramadass P, Jarvis BD, Corner RJ, Penny D, Marshall RB. Genetic characterization of pathogenic Leptospira species by DNA hybridization. Int J Syst Bacteriol. 1992; 42:215–9.
11). Turk N, Milas Z, Mojcec V, Ruzic-Sabljic E, Staresina V, Stritof Z, et al. Molecular analysis of Leptospira spp. isolated from humans by restriction fragment length polymorphism, real-time PCR and pulsed-field gel electrophoresis. FEMS Microbiol Lett. 2009; 300:174–9.
12). Morey RE, Galloway RL, Bragg SL, Steigerwalt AG, Mayer LW, Levett PN. Species-specific identification of Leptospiraceae by 16S rRNA gene sequencing. J Clin Microbiol. 2006; 44:3510–6.
13). La Scola B, Bui LT, Baranton G, Khamis A, Raoult D. Partial rpoB gene sequencing for identification of Leptospira species. FEMS Microbiol Lett. 2006; 263:142–7.
14). Thaipadungpanit J, Chierakul W, Wuthiekanun V, Limmathurotsakul D, Amornchai P, Boonslip S, et al. Diagnostic accuracy of real-time PCR assays targeting 16S rRNA and lipL32 genes for human leptospirosis in Thailand: a case-control study. PLoS One. 2011; 6:e16236.
crossref
15). Clarridge JE 3rd. Impact of 16S rRNA gene sequence analysis for identification of bacteria on clinical microbiology and infectious diseases. Clin Microbiol Rev. 2004; 17:840–62.
crossref
16). Boonyod D, Poovorawan Y, Bhattarakosol P, Chirathaworn C. LipL32, an outer membrane protein of Leptospira, as an antigen in a dipstick assay for diagnosis of leptospirosis. Asian Pac J Allergy Immunol. 2005; 23:133–41.
17). Faine S. Guidelines for the control of leptospirosis. WHO;1982.
18). Lane DJ, Pace B, Olsen GJ, Stahl DA, Sogin ML, Pace NR. Rapid determination of 16S rRNA sequences for phylogenetic analyses. Proc Natl Acad Sci U S A. 1985; 82:6955–9.
19). Cho MK, Kee SH, Song HJ, Kim KH, Song KJ, Baek LJ, et al. Infection rate of Leptospira interrogans in the field rodent, Apodemus agrarius, in Korea. Epidemiol Infect. 1998; 3:685–90.
20). Wuyts J, Van de Peer Y, Winkelmans T, De Wachter R. The European database on small subunit rRNA. Nucleic Acids Res. 2002; 30:183–5.
21). Haake DA, Suchard MA, Kelley MM, Dundoo M, Alt DP, Zuerner RL. Molecular evolution and mosaicism of leptospiral outer membrane proteins involves horizontal DNA transfer. J Bacteriol. 2004; 186:2818–28.
crossref
22). Haake DA, Chao G, Zuerner RL, Barnett JK, Barnett D, Mazel M, et al. The leptospiral major outer membrane protein LipL32 is a lipoprotein expressed during mammalian infection. Infect Immun. 2000; 68:2276–85.
crossref
23). Shang ES, Summers TA, Haake DA. Molecular cloning and sequence analysis of the gene encoding LipL41, a surface-exposed lipoprotein of pathogenic Leptospira species. Infect Immun. 1996; 64:2322–30.
24). Perez J, Goarant C. Rapid Leptospira identification by direct sequencing of the diagnostic PCR products in New Caledonia. BMC Microbiol. 2010; 10:325.
25). Mgode GF, Machang'u RS, Goris MG, Engelbert M, Sondij S, Hartskeerl RA. New Leptospira serovar sokoine of serogroup Icterohaemorrhagiae from cattle in Tanzania. Int J Syst Evol Microbiol. 2006; 56:593–7.
26). Yasuda PH, Steigerwalt AG, Sulzer KR, Kaufmann AF, Rogers F, Brenner DJ. Deoxyribonucleic acid relatedness between serogroups and serovars in the family Leptospiraceae with proposals for seven new Leptospira species. Int J Syst Evol Microbiol. 1987; 37:407–15.
27). Chang WH, Kee SH, Park KH, Kim SY, Kim IS, Choi MS. Antigenic analysis of Leptospira interrogans isolated in Korea using monoclonal antibodies and cross-agglutinin absorption test. J Kor Soc Microbiol. 1989; 24:165–73.
28). Park KH, Chang WH. Serovar identification of leptospiral strain HS-7 isolated in Korea by monoclonal antibodies. J Kor Soc Microbiol. 1988; 23:293–305.

Figure 1.
Dendrogram representing phylogenetic relationships between partial 16S rDNA sequences (the size of about 323 bp) of reference Leptospira strains and 16S rDNA PCR products of isolates. The phylogram was generated by neighbor-joining analysis with 1,000 bootstrapped replicates.
jbv-44-59f1.tif
Figure 2.
Dendrogram representing phylogenetic relationships between partial LipL 32 sequences (the size of about 727 bp) of reference Leptospira strains and LipL 32 PCR products of isolates. The phylogram was generated by neighbor-joining analysis with 1,000 bootstrapped replicates.
jbv-44-59f2.tif
Table 1.
Local Leptospira strains isolated in Korea for molecular typing using nucleotide sequences of 16S rDNA and LipL32 genes
Strain Source Area of isolation Year
WH-20 Human Wonju 1984
18R Wild rodent Hongchon 1985
30R Wild rodent Hongchon 1985
HS-7 Human Kongju 1985
HM3 Human Yeonchun 1985
AP33 Rat Yeoju 1987
CH88-12 Human Choonsung 1988
CH88-19 Human Whachun 1988
KH-1 Human Choongju 1989
KH-2 Human Choongju 1989
HK-12 Human Kosung 1990
A-15 Apodemus agrarius Choongju 1993
A-19 Apodemus agrarius Choongju 1993
M06 Apodemus agrarius Choongju 2001
M07 Apodemus agrarius Choongju 2001
Table 2.
Nucleotide sequences of primers and conditions for PCR used in this study
Target genes Primer Nucleotide sequence (5′ → 3′) Products size (bp)
16S rDNA 27Fa AGAGTTTGATCMTGGCTCAG 529
518Ra,b GTATTACCGCGGCTGCTGG
lipL32 LipL32Fa ATGAAAAAACTTTCGATTTTG 819
LipL32Ra,b TTACTTAGTCGCGTCAGAAGC

a Primers used for amplification and sequencing

b reverse primers

Table 3.
The similarity between partial 16S rDNA sequences of various reference Leptospira strains and isolates
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19
1 *** 100 100 100 100 100 99.7 97.8 97.8 99.7 98.5 97.2 97.8 97.8 99.4 99.7 99.7 100 99.7
2 *** 100 100 100 100 99.7 97.8 97.8 99.7 98.5 97.2 97.8 97.8 99.4 99.7 99.7 100 99.7
3 *** 100 100 100 99.7 97.8 97.8 99.7 98.5 97.2 97.8 97.8 99.4 99.7 99.7 100 99.7
4 *** 100 100 99.7 97.8 97.8 99.7 98.5 97.2 97.8 97.8 99.4 99.7 99.7 100 99.7
5 *** 100 99.7 97.8 97.8 99.7 98.5 97.2 97.8 97.8 99.4 99.7 99.7 100 99.7
6 *** 99.7 97.8 97.8 99.7 98.5 97.2 97.8 97.8 99.4 99.7 99.7 100 99.7
7 *** 97.5 97.5 99.4 98.1 96.9 97.5 97.5 99.1 99.4 99.4 99.7 100
8 *** 96.9 98.1 97.5 97.2 98.8 99.1 97.2 97.5 97.5 97.8 97.5
9 *** 98.1 98.8 96.9 96.9 97.5 97.2 97.5 97.5 97.8 97.5
10 *** 98.8 97.5 98.1 98.1 99.1 99.4 99.4 99.7 99.4
11 *** 97.8 97.5 98.1 97.8 98.1 98.1 98.5 98.1
12 *** 96.6 97.5 96.6 96.9 96.9 97.2 96.9
13 *** 99.1 97.2 97.5 97.5 97.8 97.5
14 *** 97.2 97.5 97.5 97.8 97.5
15 *** 99.1 99.1 99.4 99.1
16 *** 99.4 99.7 99.4
17 *** 99.7 99.4
18 *** 99.7
19 *

1, partial 16S rDNA of L. interrogans Lai 56601 (NR074481); 2, L. interrogans Coppenhageni (JQ988857); 3, L. interrogans Autumnalis Akiyami A (FJ154557); 4, L. Interrogans Icterohaemorrhagiae RGA (FJ154549); 5, L. interrogans Kremastos (FJ154564); 6, L. interrogans Medanesis (DQ991471); 7, L. interrogans Canicola DB34 (JQ988855); 8, L. alexanderi Manhao (AY631880); 9, L. meyeri (LM16sRDNX); 10, L. kirschneri Grippotyphosa (JQ988856); 11, L. noguchii Panama CZ214K (AY631886); 12, L. santarosai Georgia LT117 (AY996805); 13, L. weilii Celledoni (AY631877); 14, L. borgpetersenii Hardjobovis (AM050569); 15, 30R; 16, AP33; 17, A-15; 18, M06; 19, HS-7.

Table 4.
The similarity between partial lipL32 sequences of various reference Leptospira strains and isolates
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
1 *** 100 99.9 99.9 100 100 99.7 99.7 99.4 98.3 95.2 96.1 95.9 99.9 99.2 99.7
2 *** 99.9 99.9 100 100 99.7 99.7 99.4 98.3 95.2 96.1 95.9 99.9 99.2 99.7
3 *** 100 99.9 99.9 99.6 99.6 99.3 98.5 95 96 95.7 100 99.3 99.6
4 *** 99.9 99.9 99.6 99.6 99.3 98.5 95 96 95.7 100 99.3 99.6
5 *** 100 99.7 99.7 99.4 98.3 95.2 96.1 95.9 99.9 99.2 99.7
6 *** 99.7 99.7 99.4 98.3 95.2 96.1 95.9 99.9 99.2 99.7
7 *** 99.7 99.4 98.3 95.2 96.1 95.9 99.6 98.9 99.7
8 *** 99.4 98.3 95.2 96.4 96.1 99.6 98.9 100
9 *** 98.6 95.2 96.4 96.1 99.3 98.6 99.4
10 *** 94.5 95.6 95.5 98.5 97.8 98.3
11 *** 96.3 96 95 94.4 95.2
12 *** 99.7 96 95.3 96.4
13 *** 95.7 95 96.1
14 *** 99.3 99.6
15 *** 98.9
16 ***

1, partial lipL32 of L. interrogans Lai (AY568679); 2, L. interrogans Autumnalis (JN210551); 3, L. interrogans 56601 (AY461908); 4, L. interrogans Hardjoprajitno (AY461905); 5, L. interrogans Akiyami (AY461902); 6, L. interrogans RGA (AY461909); 7, L. interrogans Pomona RZ11 (AY461910); 8, L. interrogans Canicola RTCC 2824 (KC800990); 9, L. kirschneri 5621 (AY461917); 10, L. noguchii 1011 (AY461918); 11, L. santarosai HS-616 (AY461926); 12, L. weilii LT89-68 (AY461930); 13, L. borgpetersenii 1409 (AY461893); 14, 30R; 15, KH-1; 16, HS-7.

TOOLS
Similar articles