Proteome Analysis of a Catalase-deficient Isogenic Mutant of Helicobacter pylori 26695

Hyung-Lyun Kang; Seung-Gyu Lee; Jin-Sik Park; Jae-Young Song; Myung-Je Cho; Seung-Chul Baik; Hee-Shang Youn; Ji-Hyun Seo; Kwang-Ho Rhee; Woo-Kon Lee

doi:10.4167/jbv.2014.44.2.177

Journal List > J Bacteriol Virol > v.44(2) > 1034129

Go to TopGo to Top Go to BottomGo to Bottom

TOOLS

Kang, Lee, Park, Song, Cho, Baik, Youn, Seo, Rhee, and Lee: Proteome Analysis of a Catalase-deficient Isogenic Mutant of Helicobacter pylori 26695

Original Article

J Bacteriol Virol 2014;44(2):177-187.

Published online: 9 February 2014

DOI: https://doi.org/10.4167/jbv.2014.44.2.177

Proteome Analysis of a Catalase-deficient Isogenic Mutant of Helicobacter pylori 26695

Hyung-Lyun Kang^1,³, Seung-Gyu Lee^1,³, Jin-Sik Park¹, Jae-Young Song^1,³, Myung-Je Cho^1,³, Seung-Chul Baik^1,³, Hee-Shang Youn², Ji-Hyun Seo², Kwang-Ho Rhee^1,³, Woo-Kon Lee^1,^3,^*

¹Department of Microbiology, School of Medicine, Gyeongsang National University, Gyeongnam, Korea

²Deaprtment of Pediatrics, School of Medicine, Gyeongsang National University, Gyeongnam, Korea

³Research Institute of Life Science, Gyeongsang National University, Gyeongnam, Korea

^*Corresponding author: Woo-Kon Lee. Department of Microbiology, School of Medicine, Gyeongsang National University, 816-16 Jinju-daero, Jinju, Gyeongnam, 660-751, Korea. Phone: +82-55-772-8083, Fax: +82-55-772-8089, e-mail: wklee@gnu.kr

^** This research was supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (2009-0090129).

Received 2 March 201426 May 2014 Accepted 28 May 2014

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Helicobacter pylori, a gram-negative bacterium, is a causative agent of gastroduodenal diseases of human. Human immune system produces harmful reactive oxygen species to kill this bacterium that locates the microaerophilic mucous layer. H. pylori harbors various antioxidant enzymes including SodB, KatA and AhpC to protect the oxygen toxicity. We removed the catalase gene (katA) from H. pylori 26695 genome, and the change of profile of the gene expression of the mutant was analyzed by high resolution 2-DE followed by matrix assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS), tandem MS and microarray analysis. Eleven and 37 genes were upregulated and downregulated in the mutant respectively, either transcriptionally or translationally. Expression level of pfr and hp1588 that were decreased on protein level in the mutant was confirmed by RT-PCR analysis.

Keywords: Helicobacter pylori, Antioxidant, katA

REFERENCES

1). Marshall BJ, Warren JR. Unidentified curved bacilli in the stomach of patients with gastritis and peptic ulceration. Lancet. 1984; 1:1311–5.

2). Nomura A, Stemmermann GN, Chyou PH, Perez-perez GI, Blaser MJ. Helicobacter pylori infection and the risk for duodenal and gastric ulceration. Ann Intern Med. 1994; 120:977–81.

3). Nomura A, Stemmermann GN, Chyou PH, Kato I, Perez-perez GI, Blaser MJ. Helicobacter pylori infection and gastric carcinoma among Japanese Americans in Hawaii. N Engl J Med. 1991; 325:1132–6.

4). No authors listed. Schistosomes, liver flukes and Helicobacter pylori. IARC Working Group on the Evaluation of Carcinogenic Risks to Humans. Lyon, 7–14 June 1994. IARC monogr eval carcinog risks hum. 1994; 61:1–241.

5). Covacci A, Telford JL, Del Giudice G, Parsonnet J, Rappuoli R. Helicobacter pylori virulence and genetic geography. Science. 1999; 284:1328–33.

6). Tomb JF, White O, Kerlavage AR, Clayton RA, Sutton GG, Fleischmann RD, et al. The complete genome sequence of the gastric pathogen Helicobacter pylori. Nature. 1997; 388:539–47.

7). Alm RA, Ling LS, Moir DT, King BL, Brown ED, Doig PC, et al. Genomic-sequence comparison of two unrelated isolates of the human gastric pathogen Helicobacter pylori. Nature. 1999; 397:176–80.

8). Brown PO, Botstein D. Exploring the new world of the genome with DNA microarrays. Nat Genet. 1999; 21:33–7.

9). Seyler RW Jr, Olson JW, Maier RJ. Superoxide dismutase-deficient mutants of Helicobacter pylori are hypersensitive to oxidative stress and defective in host colonization. Infect Immun. 2001; 69:4034–40.

10). Ramarao N, Gray-Owen SD, Meyer TF. Helicobacter pylori induces but survives the extracellular release of oxygen radicals from professional phagocytes using its catalase activity. Mol Microbiol. 2000; 38:103–13.

11). Basu M1, Czinn SJ, Blanchard TG. Absence of catalase reduces long-term survival of Helicobacter pylori in macrophage phagosomes. Helicobacter. 2004; 9:211–6.

12). Wang G, Alamuri P, Maier RJ. The diverse antioxidant systems of Helicobacter pylori. Mol Microbiol. 2006; 61:847–60.

13). Cho MJ, Lee SG, Lee KH, Song JY, Lee WK, Baik SC, et al. Comparison of gene expression patterns between Helicobacter pylor 26695 and its superoxide dismutase isogenic mutant. J Bacteriol Virol. 2013; 43:279–89.

14). Alting-Mees MA, Short JM. pBluescript II: gene mapping vectors. Nucleic Acids Res. 1989; 17:9494.

15). Song JY, Park SG, Kang HL, Lee WK, Cho MJ, Park JU, et al. pHP489, a Helicobacter pylori small cryptic plasmid, harbors a novel gene coding for a replication initiation protein. Plasmid. 2003; 50:236–41.

16). Wang Y, Roos KP, Taylor DE. Transformation of Helicobacter pylori by chromosomal metronidazole resistance and by a plasmid with a selectable chloramphenicol resistance marker. J Gen Microbiol. 1993; 139:2485–93.

17). O'Farrell PH. High resolution two-dimensional electrophoresis of proteins. J Biol Chem. 1975; 250:4007–21.

18). Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976; 72:248–54.

19). Heukeshoven J, Dernick R. Improved silver staining procedure for fast staining in PhastSystem Development Unit. I. Staining of sodium dodecyl sulfate gels. Electrophoresis. 1988; 9:28–32.

20). Park JW, Song JY, Hwang HR, Park HJ, Youn HS, Seo JH, et al. Proteomic analysis of thiol-active proteins of Helicobacter pylori 26695. J Bacteriol Virol. 2012; 42:211–23.

21). Chuang SE, Daniels DL, Blattner FR. Global regulation of gene expression in Escherichia coli. J Bacteriol. 1993; 175:2026–36.

22). Tatusov RL, Koonin EV, Lipman DJ. A genomic perspective on protein families. Science. 1997; 278:631–7.

23). Harris AG, Hinds FE, Beckhouse AG, Kolesnikow T, Hazell SL. Resistance to hydrogen peroxide in Helicobacter pylori: role of catalase (KatA) and Fur, and functional analysis of a novel gene product designated ‘KatA-associated protein’, KapA (HP0874). Microbiology. 2002; 148:3813–25.

24). Yamada H, Shimizu S, Shimada H, Tani Y, Takahashi S, Ohashi T. Production of D-phenylglycine-related amino acids by immobilized microbial cells. Biochimie. 1980; 62:395–9.

25). Baik SC, Kim KM, Song SM, Kim DS, Jun JS, Lee SG, et al. Proteomic analysis of the sarcosine-insoluble outer membrane fraction of Helicobacter pylori strain 26695. J Bacteriol. 2004; 186:949–55.

26). Hochhauser SJ, Weiss B. Escherichia coli mutants deficient in deoxyuridine triphosphatase. J Bacteriol. 1978; 134:157–66.

27). Vicente JB, Ehrenkaufer GM, Saraiva LM, Teixeira M, Singh U. Entamoeba histolytica modulates a complex repertoire of novel genes in response to oxidative and nitrosative stresses: implications for amebic pathogenesis. Cell Microbiol. 2009; 11:51–69.

28). Halliwell B, Gutteridge JMC. Free Radicals in Biology and Medicine. Oxford: Clarendon Press;1989.

29). Slade D, Radman M. Oxidative Stress Resistance in Deinococcus radiodurans. Microbiol Mol Biol Rev. 2011; 75:133–91.

30). Skouloubris S, Labigne A, De Reuse H. Identification and characterization of an aliphatic amidase in Helicobacter pylori. Mol Microbiol. 1997; 25:989–98.

31). Dalle-Donne I, Rossi R, Colombo R, Giustarini D, Milzani A. Biomarkers of oxidative damage in human disease. Clin Chem. 2006; 52:601–23.

32). Bereswill S, Waidner U, Odenbreit S, Lichte F, Fassbinder F, Bode G, et al. Structural, functional and mutational analysis of the pfr gene encoding a ferritin from Helicobacter pylori. Microbiology. 1998; 144:2505–16.

33). Nakamura A, Park A, Nagata K, Sato EF, Kashiba M, Tamura T, et al. Oxidative cellular damage associated with transformation of Helicobacter pylori from a bacillary to a coccoid form. Free Radic Biol Med. 2000; 28:1611–8.

34). Wang G, Maier RJ. An NADPH quinone reductase of Helicobacter pylori plays an important role in oxidative stress resistance and host colonization. Infect Immun. 2004; 72:1391–6.

35). Waidner B, Greiner S, Odenbreit S, Kavermann H, Velayudhan J, Stähler F, et al. Essential role of ferritin Pfr in Helicobacter pylori iron metabolism and gastric colonization. Infect Immun. 2002; 70:3923–9.

Figure 1.

Construction of plasmids for knock-out mutant.

Figure 2.

Confirmation of katA deficiency. top, H. pylori 26695; bottom, katA mutant.

Figure 3.

Growth curve of H. pylori 26695 and isogenic mutants at thin layer culture condition.

Figure 4.

Comparison of normalized gel images of wild type and kat isogenic mutant. The proteins were separated on an IPG strip of pH 5.0∼8.0 and subsequently on a 12.5% SDS-PAGE and then detected by silver staining. The original gel size was 18×20×0.15. (A) Wild type. (B) kat isogenic mutant.

Figure 5.

Comparison of expression of genes in wild type H. pylori and in katA mutant. (A) RT-PCR analysis of pfr and hp1588. (B, C) expression of two genes. Levels were measured by 2-DE, microarray and RT-PCR.

Table 1.

Strains and plasmids used in this study

DNAs and strains	Genotype, phenotype and sequence	Reference
Strains
H. pylori 26695 wild type		6
H. pylori 26695 katA	katA-deficient mutant	this study
Plasmids
pBluescript II	ColEI ori; bla	14
pBkatA	pBluescipt II; katA	this study
pBkatK	pBluescipt II; katA::ahpA-III	this study
pBHP489KsK	E. coli-H. pylori shuttle vector containing kanamycine marker (aphA-III)	15
Oligomers (product size)
katA (1,513 bp)	F; aaccatggttaataaagatgtg R; cttttttgtgtggtgcatgtc	6
pfr (357 bp)	F; gattatcgctaccggtggta R; tcgcccttgatttcttccac	6
hp1588 (305 bp)	F; caacgcaggaaaggaaacca R; atcaattgatgcaccacgcc	6

Table 2.

List of up or down-regulated proteins of katA isogenic mutant of H. pylori 26695 by using tandem MS

SSP no	Protein name	Accession no	mw	pI	Amino acid seq	Score	HP no
0102^b	Urease accessory protein (UreG)	gi:15644698	21,824	4.7	R.EAFNLIFKPGFSTAK.V R.AKEGLDDVIAWIK.R K.IDLAPYVGADLK.V	45 33 55	0068
0903^b	Histidine kinase (CheA)	gi:15645020	89,704	4.7	K.NGDKIPDAILVDIEMPK.M K.ITPDIMDVVLR.S K.VNITTLMNESENTK.S	26 26 27	0903
1003^b	Biotin carboxyl carrier protein (FabE)	gi:15644999	17,122	5.2	K.VVSVEVGDAQPVEYGTK.L K.EDFVLSPMVGTFYHAPSPGAEPYVK.V	75 19	0371
1101^b	Adenylate kinase (Adk)	gi:15645243	21,230	5.0	K.GIILIDGYPR.S R.VFLDPLGEIQNFYK.N	39 53	0618
1102^b	Biotin carboxyl carrier protein (FabE)	gi:15644999	17,122	5.2	K.VVSVEVGDAQPVEYGTK.L K.EDFVLSPMVGTFYHAPSPGAEPYVK.V	64 44	0371
1103^b	Adenylate kinase (Adk)	gi:15645243	21,230	5.0	K.ADMVEVFNFR.V K.GIILIDGYPR.S R.VFLDFLGEIQNFYK.N	37 49 66	0618
2201^a	Hydrogenase expression/formation protein (HypB)	gi:15645518	27,179	5.2	R.GTLFINPQTK.V K.TTMLENLADFK.D K.EGLYVLNFMSSPGSGK.T	19 17 68	0900
2701^a	GTP-binding protein, fusA-homolog (YihK)	gi:15645108	66,634	5.0	K.ALADEITLK.I K.INIIDTPGHADFGGEVER K.QLDFPVVYAAAR.D	30 42 55	0480
4302^a	Recombinase A (RecA)	gi:15644782	37,555	5.5	R.GLSLAGNQVLTR.T R.SGGIDLVVVDSVAALTPK.A K.AEIDGDMGDQHVGLQAR.L	63 59 75	0153
5201^b	Hypothetical protein HP1588	gi:15646195	28,287	5.2	K.LLPGNEVIGPAIVESDATTFVIPK.G R.QALSAATLTLFK.M R.SSSQLLYSEIIVAGR.V	33 46 67	1588
8701^a	Hydantoin utilization protein A (HyuA)	gi:15645318	78,483	6.9	R.GVVATQKPVIPVEK.E R.TIVSGPIGGVIGSK.L R.LVLSLPLVAMDSVGAGAGSFVR.I K.IIQDAWDELTLK.V	24 31 26 24	0695
8703^a	Hydantoin utilization protein A (HyuA)	gi:15645318	78,483	6.9	K.YDDPLIPLKR.I R.TIVSGPIGGVIGSK.L	44 59	0695

^a) Increased protein spots in katA isogenic mutant.

^b) Decreased protein spots in kat isogenic mutant. SSP no, standard spot number; mw, molecular weight; pI,; HP no, gene number of H. pylori 26695.

Table 3.

List of up or down-regulated proteins under katA isogenic mutant of H. pylori 26695 by using MALDI-TOF

SSP no	Protein name	Accession no	mw	pI	HP no
4002^b	Nonheme iron-containing ferritin (Pfr)	gi:15645277	19,155	5.49	0653
4403^b	Pyruvate: ferredoxin oxidoreductase, alpha Subunit (PorA)	gi:15645724	44,613	5.81	1110
5302^b	GTP-binding protein (Gtp1)	gi:15645194	40,444	5.53	0569
7009^b	Co-chaperone (GroES)	gi:15644644	12,860	6.59	0011
8108^b	Adhesin-thiol peroxidase (TagD)	gi:15645018	18,161	8.18	0390
9509^a	Fumarase (FumC)	gi:15645938	50,844	7.29	1325

^a) Increased protein spots in katA isogenic mutant.

^b) Decreased protein spots in kat isogenic mutant. SSP no, standard spot number; mw, molecular weight; pI,; HP no, gene number of H. pylori 26695.

Table 4.

List of genes whose expression was increased over two-fold in kat isogenic mutant compared with wild type H. pylori 26695

HP No.	Increasing level (fold)^*	Gene name
HP0686	2.018	Iron (III) dicitrate transport protein (fecA)
HP0810	2.056	Conserved hypothetical protein
HP0865	2.452	Deoxyuridine 5′-triphosphate nucleotidohydrolase (dut)
HP0870	2.457	Flagellar hook (flgE)
HP0871	3.109	CDP-diglyceride hydrolase (cdh)
HP1174	2.982	Glucose/galactose transporter (gluP)

^* Genes of which increasing level was not higher than 2 folds were not shown in this list. Bold, also increased in sodB-deficient mutant.

Table 5.

List of genes whose expression was decreased over twofold in katA isogenic mutant compared with wild type H. pylori 26695

HP No.	Decreasing level (fold)^*	Gene name
HP0004	0.392	Carbonic anhydrase (icfA)
HP0102	0.330	Conserved hypothetical protein
HP0119	0.431	Hypothetical protein
HP0373	0.481	Conserved hypothetical protein
HP0408	0.450	Hypothetical protein
HP0415	0.463	Conserved hypothetical integral membrane protein
HP0439	0.442	Hypothetical protein
HP0503	0.162	Hypothetical protein
HP0513	0.431	Hypothetical protein
HP0653	0.543	Nonheme iron-containing ferritin (Pfr)
HP0587	0.377	Aminodeoxychorismate lyase (pabC)
HP0600	0.351	Multidrug resistance protein (spaB)
HP0603	0.469	Hypothetical protein
HP0614	0.466	Hypothetical protein
HP0689	0.397	Hypothetical protein
HP0702	0.365	Hypothetical protein
HP0704	0.440	Hypothetical protein
HP0712	0.185	Hypothetical protein
HP0767	0.499	Hypothetical protein
HP0784	0.490	Hypothetical protein
HP0889	0.397	Iron (III) dicitrate ABC transporter permease protein (fecD)
HP0981	0.481	Exonuclease VII-like protein (xseA)
HP1142	0.420	Hypothetical protein
HP1227	0.477	Cytochrome c553
HP1238^a	0.421	Aliphatic amidase (amiE)
HP1390	0.287	Hypothetical protein
HP1426	0.478	Conserved hypothetical protein
HP1534	0.469	IS605 transposase (tnpB)
HP1588	0.577	Hypothetical protein

^a Genes of which decreasing level was not lower than 0.6 were not shown in this list. Bold, also decreased in sodB-deficient mutant. a, increased in sodB-deficient mutant.

Table 6.

Clusters of orthologous groups of genes (COGs) of 32 genes 2-fold changes in expression levels of katA mutants compared with wild type H. pylori 26695.

Gene function classification	Gene code
Cell envelope biogenesis, outer membrane proteins	HP0102	HP0415
Cell motility and secretion	HP0870
Inorganic ion transport and metabolism	HP0686	HP0889
Intracellular trafficking, secretion, and vesicular transport	HP0439
Defense mechanisms	HP0600
DNA replication, recombination and repair	HP0689	HP0810	HP0981	HP1534
Energy production and conversion	HP1227
General function prediction only	HP1238
Carbohydrate transport and metabolism	HP1174
Function unknown	HP0513	HP0712	HP1142	HP1426	HP1588
Not in COGs	HP0004	HP0119	HP0373	HP0408	HP0503
	HP0587	HP0603	HP0614	HP0702	HP0704
	HP0767	HP0784	HP1390

Table 7.

Tentative annotation of 7 hypothetical proteins by the clustering analysis.

HP No.	Tentative annotation
HP0439	Ribosomal protein
HP0102	tRNA synthetase
HP0689	tRNA synthetase
HP0712	Purine-nucleoside phosphorylase
HP0810	Lipid A disaccharide synthetase
HP1142	Signal recognition particle protein
HP1588	Riboflavin synthase beta chain

TOOLS

Similar articles