Journal List > J Bacteriol Virol > v.43(4) > 1034099

TOOLS
Cho, Lee, Lee, Song, Lee, Baik, Rhee, Youn, Seo, and Kang: Comparison of Gene Expression Patterns between Helicobacter pylor 26695 and its Superoxide Dismutase Isogenic Mutant
Original Article

J Bacteriol Virol 2013;43(4):279-289.

Published online: 9 February 2013

DOI: https://doi.org/10.4167/jbv.2013.43.4.279

Comparison of Gene Expression Patterns between Helicobacter pylor 26695 and its Superoxide Dismutase Isogenic Mutant

Myung-Je Cho1, 3, Seung-Gyu Lee1, Kon-Ho Lee1, Jae-Young Song1, 3, Woo-Kon Lee1, 3, Seung-Chul Baik1, 3, Kwang-Ho Rhee1, 3, Hee-Shang Youn2, Ji-Hyun Seo2, Hyung-Lyun Kang1, 3, *

1Department of Microbiology, School of Medicine, Gyeongsang National University 816-15 Jinju-daero, Jinju, Gyeongnam, Korea

2Deaprtment of Pediatrics, School of Medicine, Gyeongsang National University 816-15 Jinju-daero, Jinju, Gyeongnam, Korea

3Helicobacter pylori Korean Type Culture Collection, Gyeongsang National University 816-15 Jinju-daero, Jinju, Gyeongnam, Korea

*Corresponding author: Hyung-Lyun Kang. Department of Microbiology, Gyeongsang National University School of Medicine, 816-15 Jinju-Daero, Jinju, Gyeongsangnam-do 660-751, KOREA. Phone: +82-55-772-8085, Fax: +82-55-772-8089, e-mail: kangssi@gnu.kr

** This Work (RPP-2009-053) was supported by the fund of Research Promotion Program, Gyeongsang National University, 2009.

Received 3 November 201322 November 2013       Accepted 28 November 2013

Copyright © 2013 Journal of Bacteriology and Virology

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Helicobacter pylori, a causative agent of gastroduodenal diseases, is a Gram-negative microaerophilic bacterium. Although H. pylori locates in the microaerophilic mucous layer, the bacteria would come into contact harmful reactive oxygen species generated by host immune system. It has been reported that H. pylori harbors various defense mechanisms which can protect bacterial cells from oxygen exposure. The change of the gene expression profile of sodB-negative isogenic mutant of H. pylori 26695 was analyzed by high resolution 2-DE followed by matrix assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) and tandem MS and microarray analysis. Eighteen genes and 41 genes were upregulated and downregulated respectively, either transcriptionally or translationally. Expression levels of three genes including trxB, yxjE and ribE that were changed both on a mRNA level and on a protein level were confirmed by RT-PCR analysis. However, change of expression levels of other major antioxidants such as KatA, AhpC and NapA were not detected, which means Sod is regulated by different way from that of KatA and AhpC. Mutant study of other antioxidant proteins may give us better understanding for the regulation of stress response in H. pylori.

Keywords: Helicobacter pylori, Antioxidant, sodB

REFERENCES

1). Marshell BJ, Warren JR. Unidentified curved bacilli in the stomach of patients with gastritis and peptic ulceration. Lancet. 1984; 16:1311–5.
2). International Agency for Research on Cancer. Schistosomes, liver flukes and Helicobacter pylori. IARC monogr eval cacinog risks hum. 1994; 61:1–241.
3). Seo JH, Koo SI, Youn HS, Jun JS, Lim JY, Park CH, et al. Comparison of the antibiotic resistance of Helicobacter pylori isolated in Jinju over a 15-year period. J Bacteriol Virol. 2012; 42:305–12.
4). Tomb JF, White O, Kerlavage AR, Clayton RA, Sutton GG, Fleischmann RD, et al. The complete genome sequence of the gastric pathogen Helicobacter pylori. Nature. 1997; 388:539–47.
5). Alm RA, Ling LS, Moir DT, King BL, Brown ED, Doig PC, et al. Genomic sequence comparison of two unrelated isolates of the human gastric pathogen Helicobacter pylori. Nature. 1999; 397:176–80.
6). Brown PO, Botstein D. Exploring the new world of the genome with DNA microarrays. Nat Genet. 1999; 21:33–7.
crossref
7). Bukau B. Regulation of the Escherichia coli heat-shock response. Mol Microbiol. 1993; 9:671–80.
8). Park JW, Song JY, Hwang HR, Park HJ, Youn HS, Seo JH, et al. Proteomic analysis of thiol-active proteins of Helicobacter pylori 26695. J Bacteriol Virol. 2012; 42:211–23.
9). Homuth G, Domm S, Kleiner D, Schumann W. Transcriptional analysis of major heat shock genes of Helicobacter pylori. J Bacteriol. 2000; 182:4257–63.
10). Huesca M, Goodwin A, Bhagwansingh A, Hoffman P, Lingwood CA. Characterization of an acidic-pH-inducible stress protein (hsp70), a putative sulfatide binding adhesin, from Helicobacter pylori. Infect Immun. 1998; 66:4061–7.
11). Matsukawa Y, Asai Y, Kitamura N, Sawada S, Kurosaka H. Exacerbation of rheumatoid arthritis following Helicobacter pylori eradication: disruption of established oral tolerance against heat shock protein? Med Hypotheses. 2005; 64:41–3.
12). Chuang MH, Wu MS, Lin JT, Chiou SH. Proteomic analysis of proteins expressed by Helicobacter pylori under oxidative stress. Proteomics. 2005; 5:3895–901.
13). Seyler RW Jr, Olson JW, Maier RJ. Superoxide dismutase-deficient mutants of Helicobacter pylori are hypersensitive to oxidative stress and defective in host colonization. Infect Immun. 2001; 69:4034–40.
14). Joo JS, Park KC, Song JY, Kim DH, Lee KJ, Kwon YC, et al. A thin-layer liquid culture technique for the growth of Helicobacter pylori. Helicobacter. 2010; 15:295–302.
15). Park JW, Lee KJ, Kim KM, Joo JS, Kwon YC, Youn HS, et al. Analysis of low molecular weight proteome from H. pylori cell extract using the high performance liquid chromatography. J Bacteriol Virol. 2010; 40:67–75.
16). Alting-Mees MA, Short JM. pBluescript II: gene mapping vectors. Nucleic Acids Res. 1989; 17:9494.
crossref
17). Song JY, Park SG, Kang HL, Lee WK, Cho MJ, Park JU, et al. pHP489, a Helicobacter pylori small cryptic plasmid, harbors a novel gene coding for a replication initiation protein. Plasmid. 2003; 50:236–41.
18). Wang Y, Roos KP, Taylor DE. Transformation of Helicobacter pylori by chromosomal metronidazole resistance and by a plasmid with a selectable chloramphenicol resistance marker. J Gen Microbiol. 1993; 139:2485–93.
19). O'Farrell PH. High resolution two-dimensional electrophoresis of proteins. J Biol Chem. 1975; 250:4007–21.
20). Heukeshoven J, Dernick R. Improved silver staining procedure for fast staining in PhastSystem Development Unit. I. Staining of sodium dodecyl sulfate gels. Electrophoresis. 1988; 9:28–32.
crossref
21). Kim KM, Lee SG, Joo JS, Kwon YC, Bae DW, Song JY, et al. Proteomic analysis of Helicobacter pylori J99 outer membrane protein by tandem mass spectrometry. J Bacteriol Virol. 2008; 38:53–60.
22). Chuang SE, Daniels DL, Blattner FR. Global regulation of gene expression in Escherichia coli. J Bacteriol. 1993; 175:2026–36.
23). Tatusov RL, Koonin EV, Lipman DJ. A genomic perspective on protein families. Science. 1997; 278:631–7.
crossref
24). Wang G, Alamuri P, Maier RJ. The diverse antioxidant systems of Helicobacter pylori. Mol Microbiol. 2006; 61:847–60.
25). Olczak AA, Seyler RW Jr, Olson JW, Maier RJ. Association of Helicobacter pylori antioxidant activities with host colonization proficiency. Infect Immun. 2003; 71:580–3.

Figure 1.
Strategy for construction of plasmid for knock-out mutant
jbv-43-279f1.tif
Figure 2.
Localization of SodB spot on the 2-DE gel
jbv-43-279f2.tif
Figure 3.
Growth of H. pylori 26695 and its isogenic mutant at thin layer culture condition
jbv-43-279f3.tif
Figure 4.
Comparative proteome analysis of wild type and sodB isogenic mutant of H. pylori 26695. (A) wild type (B) sodB mutant. Numbers on the gel are spot numbers.
jbv-43-279f4.tif
Figure 5.
Comparison of expression of genes in wild type and sodB mutant. (A) RT-PCR analysis of trxB, yxjE, ribE (B) (C) (D) expression of three genes. Expression levels were measured by either 2-DE analysis or microarray. RT-PCR was used to confirm the results.
jbv-43-279f5.tif
Table 1.
Strains and plasmids used in this study
DNAs and strains Genotype, phenotype and sequence Reference
Strains
 H. pylori 26695 wild type 4
 H. pylori 26695 sodB sodB-defective mutant this study
Plasmids
 pBluescript II ColEI ori; bla 16
 pBsod pBluescipt II, sodB this study
 pBsodC pBluescipt II, sodB::cat this study
 pBHP489CM16 Kanamycine marker in pBHP489K was replaced by chloramphenicol acetyltransferas (cat) 17
Oligomers (product size)
 sodB (630 bp) F; atgtttacattacgagagttgcct
R; atgcaccaactcattgatgtagt		 4
 trxB (305 bp) F; gattatcgctaccggtggta
R; tcgcccttgatttcttccac		 4
 yxjE (314 bp) F; caacgcaggaaaggaaacca
R; atcaattgatgcaccacgcc		 4
 ribE (306 bp) F; catcgcgcttcaatcatatc
R; atattgtccgtggtcagcac		 4
Table 2.
Lists of up or down-regulated proteins of H. pylori 26695 sodB defective mutant identified by MALDI-TOF
SSP no Protein Accession no Mol wt pI Amino acid sequence Score HP no
Increased
0001 Inorganic pyrophosphatase (Ppa) gi:15645244 19,260 4.8 KYELDKESGALMVDR.V
R.LVGVLNMEDESGMDEK.L		 70
74		 0620
2701 GTP-binding protein, FusA-homolog (YihK) gi:15645108 66,634 5.0 R.GTLFINPQTK.V
K.INIIDTPGHADFGGEVER
K.QLDFPVVYAAAR.D		 19
42
55		 0480
4101 Elongation factor P (Ef-P) gi:15644806 20,657 5.3 K.IELGGVPYR.I
K.AISVDVPQVVALK.I		 33
53		 0177
4302 Recombinase A (RecA) gi:15644782 37,555 5.5 K.ALADEITLK.I
R.SGGIDLVVVDSVAALTPK.A
K.AEIDGDMGDQHVGLQAR.L		 30
59
75		 0153
5102 Ferredoxin oxidoreductase, gamma subunit (OorC) gi:2313709 20,244 5.3 K.VDILLDRDEIIFPYAK.E
K.QGGIVVIDPNLVTPTK.E
R.FTGVGGQGVLLAGEILAEAK.I		 32
45
77		 0591
9101 Modulator of drug activity (Mda66) gi:15645254 21,474 7.1 K.QGLPGLDLIIFPEYSTHGIMYDR.Q
K.NPQVEQYLNSLTTHLR.Q		 44
24		 0630
Decreased
0101 Urease accessory protein (UreG) gi:15644698 21,824 4.7 K.TALIEALTR.H
R.EDASMNLEAVEEMHGR.F
K.IDLAPYVGADLK.V
K.DYDMAVITNDIYTK.E		 45
52
50
47		 0068
0102 Urease accessory protein (UreG) gi:15644698 21,824 4.7 R.AKEGLDDVIAWIK.R
K.IDLAPYVGADLK.V		 33
55		 0068
1103 Adenylate kinase (Adk) gi:15645243 21,230 5.0 K.GIILIDGYPR.S
R.VFLDFLGEIQNFYK.N		 49
60		 0618
1401 ATP synthase subunit B (AtpF) gi:15645746 51,446 5.0 R.AIAMDMTEGLVR.N 30 1132
Table 3.
Lists of up or down-regulated proteins of H. pylori 26695 sodB-defective mutant identified by tandem MS
SSP no Protein Accession no Mol wt pI HP no
Increased
 3910 3-oxoadipate coA-transferase subunit B (YxjE) gi:15645880 94,099 5.1 HP1266
 7203 Thioredoxin reductase (TrxB) gi:15645444 33,407 6.2 HP0825
 7205 Translation elongation factor EF-Ts (Tsf) gi:15646162 39,564 6.5 HP1555
Decreased
 0011 50S ribosomal protein L7/L12 gi:15645813 13,182 4.9 HP1199
 1002 Riboflavin synthase beta chain (RibE) gi:15644636 16,912 4.9 HP0002
 1101 Adenylate kinase (Adk) gi:15645243 21,230 5.0 HP0618
 1504 ATP synthase F1, subunit beta (AtpD) gi:15645746 51,347 5.0 HP1132
 2103 NADH-ubiquinone oxidoreductase, NQO3 subunit (Nqq3) gi:15645315 22,132 5.3 HP0692
 7009 Co-chaperone (GroES) gi:15644644 12,860 6.5 HP0011
 8108 Adhesin-thiol peroxidase (TagD) gi:15645018 18,161 8.1 HP0390
Table 4.
List of genes of which expression is increased or decreased over 2-fold in sodB isogenic mutant compared with H. pylori 26695
HP no Fold Gene
Increased
 HP0294 3.773 Aliphatic amidase (amiE)
 HP0650 2.189 Hypothetical protein
 HP0693 2.425 Conserved hypothetical integral membrane protein
 HP0696 2.166 N-methylhydantoinase
 HP0874 2.118 Hypothetical protein
 HP1174 2.900 Glucose/galactose transporter (gluP)
 HP1182 2.471 Conserved hypothetical protein
 HP1291 2.286 Conserved hypothetical protein
 HP1407 2.003 Conserved hypothetical integral membrane protein
Decreased
 HP0004 0.379 Carbonic anhydrase (icfA)
 HP0101 0.472 Hypothetical protein
 HP0102 0.348 Conserved hypothetical protein
 HP0119 0.435 Hypothetical protein
 HP0297 0.479 Ribosomal protein L27 (rpl27)
 HP0408 0.370 Hypothetical protein
 HP0415 0.459 Conserved hypothetical integral membrane protein
 HP0439 0.378 Hypothetical protein
 HP0503 0.127 Hypothetical protein
 HP0513 0.395 Hypothetical protein
 HP0531 0.444 cag pathogenicity island protein (cag11)
 HP0537 0.480 cag pathogenicity island protein (cag16)
 HP0600 0.337 Multidrug resistance protein (spaB)
 HP0603 0.455 Hypothetical protein
 HP0614 0.448 Hypothetical protein
 HP0698 0.386 Hypothetical protein
 HP0702 0.310 Hypothetical protein
 HP0712 0.183 Hypothetical protein
 HP0889 0.490 iron(III) dicitrate ABC transporter permease protein (fecD)
 HP0937 0.366 Hypothetical protein
 HP0989 0.449 IS605 transposase (tnpB)
 HP1142 0.464 Hypothetical protein
 HP1227 0.480 Cytochrome c553
 HP1334 0.485 Hypothetical protein
 HP1390 0.261 Hypothetical protein
 HP1397 0.419 Hypothetical protein
 HP1426 0.435 Conserved hypothetical protein
 HP1469 0.477 Outer membrane protein (omp31)
 HP1530 0.465 Purine nucleoside phosphorylase (punB)
 HP1534 0.432 IS605 transposase (tnpB)
 HP1557 0.476 Flagellar basal-body protein (fliE)
 HP1588 0.435 Conserved hypothetical protein
Table 5.
Clusters of orthologous groups of genes (COGs) of 24 genes 2-fold changes in expression levels of sodB mutants compared with wild type H. pylori 26695.
Gene function classification Gene code
Cell envelope biogenesis, outer membrane proteins HP0102 HP0415
Intracellular trafficking, secretion, and vesicular transport HP0439
DNA replication, recombination and repair HP0650↑
Cell division and chromosome partitioning HP1182↑
Coenzyme metabolism HP1291↑
Lipid metabolism HP0693↑
Function unknown HP0513 HP1407↑ HP1142 HP1334
HP1397 HP1426 HP1588
Not in COGs HP0101 HP0119
HP0408 HP0503 HP0937
HP0537 HP0603
HP0698 HP0702 HP1390
TOOLS
Similar articles