Journal List > J Bacteriol Virol > v.43(2) > 1034078

TOOLS
Yoon, Han, Choi, Lee, Kim, and Choi: An Epidemiological Survey on Serological Diagnosis of Legionnella Infection in Seoul, Korea
Communication

J Bacteriol Virol 2013;43(2):140-144.

Published online: 9 February 2013

DOI: https://doi.org/10.4167/jbv.2013.43.2.140

An Epidemiological Survey on Serological Diagnosis of Legionnella Infection in Seoul, Korea

Yong-Tae Yoon*, Chang-Ho Han, Sung-Sun Choi, Jung-Mi Lee, Chang-Kyu Kim, Sung-Min Choi

Seoul Metropolitan Government Research Institute of Public Health and Environment, Gwacheon-si, Gyeongggi-do, Korea

*Corresponding author: Yong-Tae Yoon. Seoul Metropolitan Government Research Institute of Public Health and Environment, Gwacheon-si, Gyeongggi-do, 427-070, Korea. Phone: +82-2-570-3454, Fax: +82-2-570-3456, e-mail: yyttyoon@seoul.go.kr

Received 8 March 20135 April 2013       Accepted 6 May 2013

Copyright © 2013 Journal of Bacteriology and Virology

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Serological investigation of antibodies to Legionella species in 1,802 sera collected in seoul was conducted with indirect fluorescent antibody assay (IFA). With an antibody titer of ≥1:128 to be positive, 17 (0.9%) of these sera were positive and 6 (35.3%) of positive sera showed cross-reactions between Legionella species. The number of sera with antibody titers of ≥1:128 to L. pneumophila serogroup 1, L. pneumophila serogroup 4, L. pneumophila serogroup 5, L. bozemanii, L. micdadei, L. anisa were 6 (35.3%), 3 (17.6%), 3 (17.6%), 2 (11.8%), 1 (5.9%), 2 (11.8%) respectively. Among 17 positive sera, 10 (58.8%) sera were from male and 7 (41.2%) from female. An average age of them was 68.9 (±15.3; 27∼89). Except for one serum, 16 (94.1%) of positive sera were from those older than 50 years old. The result suggests that the aged over 50 years old should be more careful of Legionella infection.

Keywords: Legionella species, Indirect fluorescent antibody assay (IFA)

REFERENCES

1). Simmons G, Jury S, Thornley C, Harte D, Mohiuddin J, Taylor M. A legionnaires' disease outbreak: A water blaster and roof-collected rainwater systems. Water Res. 2008; 42:1449–58.
crossref
2). Ricci ML, Fontana S, Bella A, Gaggioli A, Cascella R, Cassone A, et al. a preliminary assessment of the occupational risk of acquiring legionnaire's disease for people working in telephone manholes, a new workplace environment for Legionella growth. Am J Infect Control. 2010; 38:540–5.
3). Abu Kwaik Y, Gao LY, Stone BJ, Harb OS. Stone invasion of mammalian and protozoan cells by Legionella pneumphila. Bull Inst Pasteur. 1998; 96:237–47.
4). Diederen BM. Legionella spp. and Legionnaires' disease. J Infect. 2008; 56:1–12.
5). Ozerol IH, Bayraktar M, Cizmeci Z, Durmaz R, Akbas E, Yildirim Z, et al. Legionnaire's disease: a nosocomial outbreak in turkey. J Hosp Infect. 2006; 62:50–7.
crossref
6). Declerck P, Behets J, Margineanu A, van Hoef V, De Keersmaecker B, Ollevier F. Replication of Legionella pneumophila in biofilms of water distribution pipes. Microbiol Res. 2009; 164:593–603.
7). Lee HK, Woo MK, Ju YI, Baek SJ, Song HJ, Choi JS, et al. Prevalence of antibodies in response to Legionella species, analysis of a healthy population from Jeollanam-do province, Korea. J Microbiol. 2008; 46:160–4.
8). Song HS, Suh JH, Ahn JH, Yoon BI, Lee SJ, Lee MG, et al. The etiological role of Legionella pneumphila in patients with community-acquired pneumonia in Korea. Tuberc Respir Dis. 2001; 50:409–14.
9). Lyu JW, Song JW, Choi CM, Oh YM, Lee SD, Kim WS, et al. Comparative study of pneumonia caused by Streptococcus pnuemoniae and Legionella pneumophila. Tuberc Respir Dis. 2010; 68:74–9.
10). Verdon J, Berjeaud JM, Lacombe C, Héchard Y. Characterization of anti-Legionella activity of warnericin RK and delta-lysin I from Staphylococcus warneri. Peptides. 2008; 29:978–84.
11). Triassi M, Di Popolo A, Ribera D'Alcalà G, Albanese Z, Cuccurullo S, Montegrosso S, et al. Clinical and environmental distribution of Legionella pneumophila in a university hospital in Italy: efficacy of ultraviolet disinfection. J Hosp Infect. 2006; 62:494–501.
12). Lück PC, Freier T, Steudel C, Knirel YA, Lüneberg E, Zähringer U, et al. A point mutation in the active site of Legionella pneumophila O-acetyltransferase results in modified lipopolysaccharide but does not influence virulence. Int J Med Microbiol. 2001; 291:345–52.
13). Jeon SJ, Jung JH, Jin YH, Lee JK, Oh YH, Choi SM. Molecular epidemiology of Legionella pneumophila isolated from bath facilities of public establishments in Seoul. J Bacteriol Virol. 2011; 41:295–300.
14). Morozova I, Qu X, Shi S, Asamani G, Greenberg JE, Shuman HA, et al. Comparative sequence analysis of the icm/dot genes in Legionella. Plasmid. 2004; 51:127–47.
15). Cianciotto NP. Pathogenicity of Legionella pneumophila. Int J Med Microbiol. 2001; 291:331–43.
16). Di Stefano F, Verna N, Di Gioacchino M. Cavirary Legionella pneumonia in a patient with immunodeficiency due to hyper-IgE syndrome. J Infect. 2007; 54:121–3.
17). Remen T, Mathieu L, Hautemaniere A, Deloge-Abarkan M, Hartemann P, Zmirou-Navier D. Pontiac fever among retirement home nurses associated with airborne Legionella. J Hosp Infect. 2011; 78:269–73.
18). Schoen ME, Ashbolt NJ. An in-premise model for Legionella exposure during showering events. Water Res. 2011; 45:5826–36.
19). Maiwald M, Helbig JH, Luck PC. Laboratory methods for the diagnosis of Legionella infections. J Microbiol Methods. 1998; 33:59–79.
20). Welti M, Jaton K, Altwegg M, Sahli R, Wenger A, Bille J. Development of a multiplex real-time quantitative PCR assay to detect Chlamydia pneumoniae, Legionella pneumophila and Mycoplasma pneumoniae in respiratory tract secretions. Diagn Microbiol Infect Dis. 2003; 45:85–95.
21). Ngeow YF, Suwanjutha S, Chantarojanasriri T, Wang F, Saniel M, Alejandria M, et al. An asian study on the prevalence of atypical respiratory pathogens in community-acquired pneumonia. Int J Infect Dis. 2005; 9:144–53.
crossref
22). Korea Ministry of Health & Wellfare. Case Definitions for National Notifiable Infectious Diseases. Seoul: KMW;Notification No. 2010-136. 2010.
23). Fields BS, Benson RF, Besser RE. Legionella and legionnaires' disease: 25 years of investigation. Clin Microbiol Rev. 2002; 15:506–26.
24). Ditommaso S, Giacomuzzi M, Gentile M, Zotti CM. Antibody detection and cross-reactivity among species and serogroups of Legionella by indirect immunofluorescence test. J Microbiol Methods. 2008; 75:350–3.

Figure 1.
Number of indirect fluorescent antibody assay positive sera by month.
jbv-43-140f1.tif
Table 1.
Primers used in this study
Pimer Sequence (5′→3′) Product size
16rRNA F: AGGGTTGATAGCTTAAGAGG
R: CAACAGCTAGTTGACATGG		 386 bp
mip F: GGTGACTGCGGCTGTTATGG
R: GGCCAATAGGTCCGCCAACG		 630 bp
Table 2.
Number of serums used in this study by sex and age
Age 0∼9 10∼19 20∼29 30∼39 40∼49 50∼59 60∼69 70∼79 80∼89 90∼99 Total
Male 2 35 63 88 73 162 211 250 93 11 988
Female 0 36 79 99 81 150 138 139 82 10 814
Total 2 71 142 187 154 312 349 389 175 21 1,802
Table 3.
Sera of indirect fluorescent antibody assay antibody titers ≥1:128 in response to Legionella species
Age Sex Number Species Antibody titers
20∼29 Female 1 L. bozemanii IgG 1:128, IgM <1:32
L. anisa IgG 1:128, IgM <1:32
50∼59 Male 1 L. pneumophila sg 1 IgG 1:128, IgM 1:64
1 L. pneumophila sg 4 IgG 1:128, IgM <1:32
2 L. pneumophila sg 5 IgG 1:128, IgM <1:32
Female L. pneumophila sg 1 IgG 1:128, IgM <1:32
3 L. pneumophila sg 4 IgG 1:128, IgM <1:32
L. feeleii sg 2 IgG 1:128, IgM <1:32
60∼69 Male 1 L. pneumophila sg 1 IgG 1:128, IgM <1:32
Female 1 L. pneumophila sg 5 IgG 1:128, IgM <1:32
70∼79 Male 1 L. pneumophila sg 1 IgG 1:128, IgM <1:32
2 L. pneumophila sg 4 IgG 1:128, IgM <1:32
L. pneumophila sg 4 IgG 1:128, IgM <1:32
3 L. pneumophila sg 5 IgG 1:128, IgM <1:32
4 L. bozemanii IgG 1:128, IgM <1:32
5 L. longbeachae sg 1 IgG 1:128, IgM <1:32
6 L. anisa IgG 1:128, IgM <1:32
80∼89 Male 1 L. micdadei IgG 1:128, IgM <1:32
L. busanenesis IgG 1:128, IgM <1:32
2 L. pneumophila sg 5 IgG 1:128, IgM <1:32
L. anisa IgG 1:128, IgM <1:32
Female 1 L. longbeachae sg 1 IgG 1:128, IgM <1:32
L. pneumophila sg 5 IgG 1:128, IgM <1:32
2 L. busanenesis IgG 1:128, IgM <1:32
Total 17
TOOLS
Similar articles