Abstract
We analyzed the occurrence of enteric viruses and bacteria at 22 places of drinkable groundwater (civil defense emergency water-supply facility), 8 places of the groundwater used for drinking water in group food services, and 10 places of spring-water. When the 40 concentrated samples were analyzed using nested RT-PCR and real-time RT PCR methods, norovirus and other enteric viruses were not detected in all samples tested. The detection percentages for total coliforms, Escherichia coli, Yersinia enterocolitica of fecal indicator were 57.5%, 22.5% and 7.5%, respectively. Colipages were not detected. These results suggest that high levels of fecal indicator bacteria in groundwater and spring-water are not directly related to occurrence of enteric viruses.
Go to : 

REFERENCES
1). Leclerc H, Edberg S, Pierzo V, Delattre JM. Bacteriophages as indicators of enteric viruses and public health risk in groundwaters. J Appl Microbiol. 2000; 88:5–21.


2). Lee HK, Jeong YS. Comparison of total culturable virus assay and multiplex integrated cell culture-PCR for reliability of waterborne virus detection. Appl Environ Microbiol. 2004; 70:3632–6.


3). Moore BE. Survival of human immunodeficiency virus (HIV), HIV-infected lymphocytes, and poliovirus in water. Appl Environ Microbiol. 1993; 59:1437–43.


4). Abbaszadegan M, LeChevallier M, Gerba C. Occurrence of viruses in US groundwaters. J Am Water Work Assoc. 2003; 95:107–20.


5). Barwick RS, Levy DA, Craun GF, Beach MJ, Calderon RL. Surveillance for waterborne-disease outbreaks–United States, 1997–1998. MMWR CDC Surveill Summ. 2000; 49:1–21.
6). Reynolds KA, Mena KD, Gerba CP. Risk of waterborne illness via drinking water in the United States. Rev Environ Contam Toxicol. 2008; 192:117–58.


7). Fout G, Schaefer F, Messer J, Dahling D, Stertler R. ICR microbial laboratory manual. Washington D.C.: US Environmental Protection Agency;1996.
8). Kim SH, Cheon DS, Kim JH, Lee DH, Jheong WH, Heo YJ, et al. Outbreaks of gastroenteritis that occurred during school excursions in Korea were associated with several waterborne strains of norovirus. J Clin Microbiol. 2005; 43:4836–9.


9). Noel JS, Lee TW, Kurtz JB, Glass RI, Monroe SS. Typing of human astroviruses from clinical isolates by enzyme immunoassay and nucleotide sequencing. J Clin Microbiol. 1995; 33:797–801.


10). Park BJ. Survey of Norovirus from groundwater of Busan, Ulsan. Gyeongnam: Pusan National University Thesis of Graduate School;2011.
11). Lee SG, Jheong WH, Suh CI, Kim SH, Lee JB, Jeong YS, et al. Nationwide groundwater surveillance of noroviruses in South Korea, 2008. Appl Environ Microbiol. 2011; 77:1466–74.


12). Park SH, Kim EJ, Yun TH, Lee JH, Kim CK, Seo YH, et al. Human Enteric Viruses in Groundwater. Food Environ Virol. 2010; 2:69–73.


13). Lee GC, Jee YS, Lee CH, Lee ST. Influence of physicochemical environmental factors on the occurrence of waterborne viruses in Korean surface water. J Bacteriol Virol. 2006; 36:279–85.


14). Stetler RE, Ward RL, Waltrip SC. Enteric virus and indicator bacteria levels in a water treatment system modified to reduce trihalomethane production. Appl Environ Microbiol. 1984; 47:319–24.


15). Borchardt MA, Bertz PD, Spencer SK, Battigelli DA. Incidence of enteric viruses in groundwater from household wells in Wisconsin. Appl Environ Microbiol. 2003; 69:1172–80.


16). Ando T, Noel JS, Fankhauser RL. Genetic classification of Norwalk-like viruses. J Infect Dis. 2000; 181:336–48.


17). Marzouk Y, Goyal SM, Gerba CP. Prevalence of enteroviruses in ground water of Israel. Ground Water. 1979; 17:487–91.


18). Goyal SM, Gerba CP, Bittonn G. Distribution of coliphages in the environment: General considerations of Phage Ecology. New York: Wiley-Interscience;1987. p. 87–123.
19). Jung JH, Yoo CH. Koo ES, Kim HM, Na Y, Jheong WH, et al. Occurrence of norovirus and other enteric viruses in untreated groundwaters of Korea. J Water Health. 2011; 9:544–55.
Go to : 

Table 1.
Analysis items and instruments
Table 2.
Primers used for the detection of enteric viruses using conventional RT-PCR
Genogroup | Primer | Primer Sequence (5′-3′)a | Polarityb | Product size (bp) | Reference |
---|---|---|---|---|---|
Norovirus GI |
GI-F1M GI-R1M GI-F2 |
CTGCCCGAATTYGTAAATGATGAT CCAACCCARCCATTRTACATYTG ATGATGATGGCGTCTAAGGACGC |
F R SF |
314 | Kim et al. (8) |
Norovirus GII |
GII-F1M GII-R1M GII-F3 |
GGGAGGGCGATCGCAATCT CCRCCIGCATRICCRTTRTACAT TGTGAATGAAGATGGCGTCGART |
F R SF |
313 | Kim et al. (8) |
Pan-Enterovirus |
EV1 EV2 EV3 |
CAAGCACTTCTGTTTCCCGG ATTGTCACCATAAGCAGCCA CTTGCGCGTTACGAC |
F R SR |
362 | Lee & Jeong (2) |
Astrovirus |
Mon269 Mon270 |
CAACTCAGGAAACAGGGTGT TCAGATGCATTGTCATTGGT |
F R |
449 | Noel JS et al. (9) |
Table 3.
Kind of bacteria and antibiotic used for coliphage test
Coliphage | Host bacteria | Antibiotic solution |
---|---|---|
Somatic coliphage (X174) | E. coli Famp | Ampicilin/streptomycin sulfate (1.5 mg/mL) |
Male-specific coliphage (MS2) | E. coli C | Nalidixic acid (10 mg/mL) |
Table 4.
Characteristics of sampling sites
Sample type | Item (unit) | Min | Max | Mean | S.D.a |
---|---|---|---|---|---|
Groundwater (n=30) | Sampled volume of water (liter) | 150 | 1500 | 762.0 | 465.7 |
Turbidity (NTU) | 0.10 | 1.27 | 0.30 | 0.30 | |
Temperature (°C) | 10.0 | 26.0 | 18.0 | 3.9 | |
pH | 6.3 | 7.8 | 7.2 | 0.4 | |
Depth to aquifer (meter) | 45 | 400 | 142 | 65.6 | |
Elapsed time after developing (month) | 36 | 324 | 211 | 62.9 | |
Daily capacity (ton) | 52 | 300 | 131 | 77.0 | |
Spring-water (n=10) | Sampled volume of water (liter) | 85 | 509 | 248 | 158.0 |
Turbidity (NTU) | 0.30 | 1.73 | 0.75 | 0.50 | |
Temperature (°C) | 8.0 | 21.2 | 13.2 | 4.4 | |
pH | 6.1 | 7.7 | 6.9 | 0.6 | |
Daily capacity (ton) | 1.5 | 3.0 | 2.4 | 0.7 | |
Elapsed time after developing (month) | 84 | 432 | 272 | 12.0 | |
Daily visitors (people) | 50 | 200 | 140 | 46.9 |
Table 5.
Detection of viral pathogens and fecal indicators
Virus and Indicator |
No. positivea (%) |
|||
---|---|---|---|---|
Groundwater (n=30) | Spring-water (n=10) | Overall (n=40) | ||
Viral pathogen | Norovirus | 0 (0.0) | 0 (0.0) | 0 (0.0) |
Pan-enterovirus | 0 (0.0) | 0 (0.0) | 0 (0.0) | |
Rotavirus | 0 (0.0) | 0 (0.0) | 0 (0.0) | |
Adenovirus | 0 (0.0) | 0 (0.0) | 0 (0.0) | |
Astrovirus | 0 (0.0) | 0 (0.0) | 0 (0.0) | |
Fecal indicator | TCC bacteria | 14 (46.7) | 8 (80.0) | 22 (55.0) |
Total coliforms | 14 (46.7) | 9 (90.0) | 23 (57.5) | |
E. coli | 2 (6.7) | 7 (70.0) | 9 (22.5) | |
Yersinia enterocolitica | 0 (0.0) | 3 (30.0) | 3 (7.5) | |
Somatic coliphage | 0 (0.0) | 0 (0.0) | 0 (0.0) | |
Male-specific coliphage | 0 (0.0) | 0 (0.0) | 0 (0.0) | |
Nitrate nitrogen (NO3-N) | 4 (13.3) | 0 (0.0) | 4 (10.0) | |
Ammonia nitrogen (NH3-N) | 0 (0.0) | 0 (0.0) | 0 (0.0) | |
Turbidity | 3 (10.0) | 5 (50.0) | 8 (20.0) |
Table 6.
Distribution of indicator bacteria of groundwater and spring water