Journal List > J Bacteriol Virol > v.43(2) > 1034077

TOOLS
Choi, Jeong, Yun, Kim, Park, and Jung: Study of the Detection of Enteric Viruses and Bacteria in Spring-water and Groundwater in Busan (10∼11)
Original Article

J Bacteriol Virol 2013;43(2):131-139.

Published online: 9 February 2013

DOI: https://doi.org/10.4167/jbv.2013.43.2.131

Study of the Detection of Enteric Viruses and Bacteria in Spring-water and Groundwater in Busan (10∼11)

Seoung-Hwa Choi1, *, Jae-Eun Jeong1, Na-Na Yun1, Nam-Ho Kim1, Yon-Koung Park1, Eun-Young Jung2

1Busan Metropolitan City Institute of Health & Environment, Busan, Korea

2Water Quality Institute, Water Works HQ of Busan Metropolitan City, Kyoungnam, Korea

*Corresponding author: Seoung-Hwa Choi. Busan Metropolitan City Institute of Health & Environment, 120, Hambakbong-ro 140 beon-gil, Buk-gu, Busan, 616-842, Korea. Phone: +82-51-309-2919, Fax: +82-51-309-2969, e-mail: csw95@korea.kr

Received 19 Feburay 20133 May 2013       Accepted 9 May 2013

Copyright © 2013 Journal of Bacteriology and Virology

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

We analyzed the occurrence of enteric viruses and bacteria at 22 places of drinkable groundwater (civil defense emergency water-supply facility), 8 places of the groundwater used for drinking water in group food services, and 10 places of spring-water. When the 40 concentrated samples were analyzed using nested RT-PCR and real-time RT PCR methods, norovirus and other enteric viruses were not detected in all samples tested. The detection percentages for total coliforms, Escherichia coli, Yersinia enterocolitica of fecal indicator were 57.5%, 22.5% and 7.5%, respectively. Colipages were not detected. These results suggest that high levels of fecal indicator bacteria in groundwater and spring-water are not directly related to occurrence of enteric viruses.

Keywords: Enteric viruses, Bacteria, Norovirus, Groundwater, Spring-water

REFERENCES

1). Leclerc H, Edberg S, Pierzo V, Delattre JM. Bacteriophages as indicators of enteric viruses and public health risk in groundwaters. J Appl Microbiol. 2000; 88:5–21.
crossref
2). Lee HK, Jeong YS. Comparison of total culturable virus assay and multiplex integrated cell culture-PCR for reliability of waterborne virus detection. Appl Environ Microbiol. 2004; 70:3632–6.
crossref
3). Moore BE. Survival of human immunodeficiency virus (HIV), HIV-infected lymphocytes, and poliovirus in water. Appl Environ Microbiol. 1993; 59:1437–43.
crossref
4). Abbaszadegan M, LeChevallier M, Gerba C. Occurrence of viruses in US groundwaters. J Am Water Work Assoc. 2003; 95:107–20.
crossref
5). Barwick RS, Levy DA, Craun GF, Beach MJ, Calderon RL. Surveillance for waterborne-disease outbreaks–United States, 1997–1998. MMWR CDC Surveill Summ. 2000; 49:1–21.
6). Reynolds KA, Mena KD, Gerba CP. Risk of waterborne illness via drinking water in the United States. Rev Environ Contam Toxicol. 2008; 192:117–58.
crossref
7). Fout G, Schaefer F, Messer J, Dahling D, Stertler R. ICR microbial laboratory manual. Washington D.C.: US Environmental Protection Agency;1996.
8). Kim SH, Cheon DS, Kim JH, Lee DH, Jheong WH, Heo YJ, et al. Outbreaks of gastroenteritis that occurred during school excursions in Korea were associated with several waterborne strains of norovirus. J Clin Microbiol. 2005; 43:4836–9.
crossref
9). Noel JS, Lee TW, Kurtz JB, Glass RI, Monroe SS. Typing of human astroviruses from clinical isolates by enzyme immunoassay and nucleotide sequencing. J Clin Microbiol. 1995; 33:797–801.
crossref
10). Park BJ. Survey of Norovirus from groundwater of Busan, Ulsan. Gyeongnam: Pusan National University Thesis of Graduate School;2011.
11). Lee SG, Jheong WH, Suh CI, Kim SH, Lee JB, Jeong YS, et al. Nationwide groundwater surveillance of noroviruses in South Korea, 2008. Appl Environ Microbiol. 2011; 77:1466–74.
crossref
12). Park SH, Kim EJ, Yun TH, Lee JH, Kim CK, Seo YH, et al. Human Enteric Viruses in Groundwater. Food Environ Virol. 2010; 2:69–73.
crossref
13). Lee GC, Jee YS, Lee CH, Lee ST. Influence of physicochemical environmental factors on the occurrence of waterborne viruses in Korean surface water. J Bacteriol Virol. 2006; 36:279–85.
crossref
14). Stetler RE, Ward RL, Waltrip SC. Enteric virus and indicator bacteria levels in a water treatment system modified to reduce trihalomethane production. Appl Environ Microbiol. 1984; 47:319–24.
crossref
15). Borchardt MA, Bertz PD, Spencer SK, Battigelli DA. Incidence of enteric viruses in groundwater from household wells in Wisconsin. Appl Environ Microbiol. 2003; 69:1172–80.
crossref
16). Ando T, Noel JS, Fankhauser RL. Genetic classification of Norwalk-like viruses. J Infect Dis. 2000; 181:336–48.
crossref
17). Marzouk Y, Goyal SM, Gerba CP. Prevalence of enteroviruses in ground water of Israel. Ground Water. 1979; 17:487–91.
crossref
18). Goyal SM, Gerba CP, Bittonn G. Distribution of coliphages in the environment: General considerations of Phage Ecology. New York: Wiley-Interscience;1987. p. 87–123.
19). Jung JH, Yoo CH. Koo ES, Kim HM, Na Y, Jheong WH, et al. Occurrence of norovirus and other enteric viruses in untreated groundwaters of Korea. J Water Health. 2011; 9:544–55.
20). Lee H, Kim M, Lee J, Lim M, Kim M, Kim JM, et al. Investigation of norovirus occurrence in groundwater in metropolitan Seoul, Korea. Sci Total Environ. 2011; 409:2078–84.
crossref

Table 1.
Analysis items and instruments
Items Instruments
pH pH Meter (HACH, USA)
Residual Chlorine, Turbidity Multiparameter (Hanna Instruments, Woonsoket, USA)
Ammonia nitrogen (NH3-N) UV-Vis Spectrophotometer (Varian, Cary3, USA)
Nitrate nitrogen (NO3-N) Ion Chromatograph (IC-3000, Dionex, USA)
Table 2.
Primers used for the detection of enteric viruses using conventional RT-PCR
Genogroup Primer Primer Sequence (5′-3′)a Polarityb Product size (bp) Reference
Norovirus GI GI-F1M
GI-R1M
GI-F2		 CTGCCCGAATTYGTAAATGATGAT
CCAACCCARCCATTRTACATYTG
ATGATGATGGCGTCTAAGGACGC		 F
R
SF		 314 Kim et al. (8)
Norovirus GII GII-F1M
GII-R1M
GII-F3		 GGGAGGGCGATCGCAATCT
CCRCCIGCATRICCRTTRTACAT
TGTGAATGAAGATGGCGTCGART		 F
R
SF		 313 Kim et al. (8)
Pan-Enterovirus EV1
EV2
EV3		 CAAGCACTTCTGTTTCCCGG
ATTGTCACCATAAGCAGCCA
CTTGCGCGTTACGAC		 F
R
SR		 362 Lee & Jeong (2)
Astrovirus Mon269
Mon270		 CAACTCAGGAAACAGGGTGT
TCAGATGCATTGTCATTGGT		 F
R		 449 Noel JS et al. (9)

a Y=C/T, R=A/G, I=C/G/A/T

b F, forward primer; R, reverse primer; SF, seminested forward primer; SR, seminested reverse primer

Table 3.
Kind of bacteria and antibiotic used for coliphage test
Coliphage Host bacteria Antibiotic solution
Somatic coliphage (X174) E. coli Famp Ampicilin/streptomycin sulfate (1.5 mg/mL)
Male-specific coliphage (MS2) E. coli C Nalidixic acid (10 mg/mL)
Table 4.
Characteristics of sampling sites
Sample type Item (unit) Min Max Mean S.D.a
Groundwater (n=30) Sampled volume of water (liter) 150 1500 762.0 465.7
Turbidity (NTU) 0.10 1.27 0.30 0.30
Temperature (°C) 10.0 26.0 18.0 3.9
pH 6.3 7.8 7.2 0.4
Depth to aquifer (meter) 45 400 142 65.6
Elapsed time after developing (month) 36 324 211 62.9
Daily capacity (ton) 52 300 131 77.0
Spring-water (n=10) Sampled volume of water (liter) 85 509 248 158.0
Turbidity (NTU) 0.30 1.73 0.75 0.50
Temperature (°C) 8.0 21.2 13.2 4.4
pH 6.1 7.7 6.9 0.6
Daily capacity (ton) 1.5 3.0 2.4 0.7
Elapsed time after developing (month) 84 432 272 12.0
Daily visitors (people) 50 200 140 46.9

a S.D.: standard deviation, b NTU: nephalometric turbidity unit

Table 5.
Detection of viral pathogens and fecal indicators
Virus and Indicator No. positivea (%)
Groundwater (n=30) Spring-water (n=10) Overall (n=40)
Viral pathogen Norovirus 0 (0.0) 0 (0.0) 0 (0.0)
Pan-enterovirus 0 (0.0) 0 (0.0) 0 (0.0)
Rotavirus 0 (0.0) 0 (0.0) 0 (0.0)
Adenovirus 0 (0.0) 0 (0.0) 0 (0.0)
Astrovirus 0 (0.0) 0 (0.0) 0 (0.0)
Fecal indicator TCC bacteria 14 (46.7) 8 (80.0) 22 (55.0)
Total coliforms 14 (46.7) 9 (90.0) 23 (57.5)
E. coli 2 (6.7) 7 (70.0) 9 (22.5)
Yersinia enterocolitica 0 (0.0) 3 (30.0) 3 (7.5)
Somatic coliphage 0 (0.0) 0 (0.0) 0 (0.0)
Male-specific coliphage 0 (0.0) 0 (0.0) 0 (0.0)
Nitrate nitrogen (NO3-N) 4 (13.3) 0 (0.0) 4 (10.0)
Ammonia nitrogen (NH3-N) 0 (0.0) 0 (0.0) 0 (0.0)
Turbidity 3 (10.0) 5 (50.0) 8 (20.0)

a Positive; TCC (total colony counts) bacteria ≥100 CFU/ml, total coliforms and E. coli ≥1 CFU/100 ml, Somatic coliphage and male-specific coliphage ≥1 PFU/ml, NO3-N ≥10 mg/ml, NH3-N ≥0.5 mg/l, Turbidity ≥1 NTU

Table 6.
Distribution of indicator bacteria of groundwater and spring water
Item (unit) Grounwater (n=40)
 Spring-water (n=10)
Min Max Mean S.D. Min Max Mean S.D.
TCC bacteria (CFU/ml) 1 2500 358.5 595.3 15 2500 760.3 716.8
Total coliforms (CFU/100 ml) 0 95 12.8 24.7 0 1600 320.7 498.7
E. coli (CFU/100 ml) 0 23 1.2 4.7 0 700 77.3 207.6
TOOLS
Similar articles