Journal List > J Bacteriol Virol > v.40(4) > 1033973

TOOLS
Kim, Kwon, Kim, Lee, Jo, Hwang, and Chang: Characterization of Vancomycin-Resistant Enterococci Isolated from Stools and Their Acquisition of Vancomycin Resistance
Original Article

J Bacteriol Virol 2010;40(4):179-189.

Published online: 18 January 2010

DOI: https://doi.org/10.4167/jbv.2010.40.4.179

Characterization of Vancomycin-Resistant Enterococci Isolated from Stools and Their Acquisition of Vancomycin Resistance

Hee Jeong Kim†, Heun Young Kwon†, Kang Lim Kim, Hyo Jin Lee, Hyun Jung Jo, Soo Myung Hwang, Kyung Soo Chang∗

Department of Clinical Laboratory Science, Catholic University of Pusan, Busan, Korea

∗Corresponding author: Kyung Soo Chang. Department of Clinical Laboratory Science, Catholic University of Pusan, Busan 609-757, Korea. Phone: +82-51-510-0565, Fax: +82-51-510-0568 e-mail: kschang@cup.ac.kr

† These authors contributed equally to this work.

∗∗ This research was supported by the research fund of the Catholic University of Pusan.

      Revised 3 September 201028 October 2010       Accepted 2 November 2010

Copyright © 2010 Korean Society for Legal Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

We have isolated 6 vancomycin resistant (VR) Enterococcus faecium and 5 VR-E. gallinarum. Vancomycin resistant enterococcus (VRE) isolates were resistant to multi-drugs, but susceptible to linezolid and quinupristin/dalfopristin. VRE isolates showed 10 VanA phenotypes and 1 VanB phenotype (E. gallinarum). However, all of them showed vanA genotype. vanA gene was detected on both genomic and plasmid DNA from all VRE isolates. Almost of VR-E. faecium had IS1216V which is worldwide type and almost of VR-E. gallinarum had IS1542 which is European type. IS1216V and IS1542 genes were not related with antibiotic types of VRE. Copy numbers of vanA were decreased in VRE with IS1216V or IS1542 but not in VRE with both ISs in broth without vancomycin. The copy numbers of vanA were significantly decreased in VanB phenotype of VRE with IS1542 in broth without vancomycin. Copy numbers of vanA were recovered in the presence of vancomycin. Growth time of reference E. faecium is faster than that of reference E. faecalis when cultured in the broth containing vancomycin. Reference strains cultured in the broth containing vancomycin showed intermediate resistance or resistance to antibiotics without acquisition of van genes. Naturally, multidrug-resistant E. faecium might be fast adapted in the presence of vancomycin compared to E. faecalis. Taken together, VanA phenotype E. gallinarum as well as E. feacium have been increasing in nosocomial infection and showed acquired inducible resistance. E. faecium and E. faecalis showed intermediate resistance in long exposure of vancomycin without acquisition of vanA.

Keywords: Vancomycin resistant enterococci (VRE), E. faecium, E. gallinarum, E. faecalis, van gene, IS gene

REFERENCES

1). Sood S., Malhotra M., Das BK., Kapil A. Enterococcal infections & antimicrobial resistance. Indian J Med Res. 2008. 128:111–21.
2). Schaberg DR., Culver DH., Gaynes RP. Major trends in the microbial etiology of nosocomial infection. Am J Med. 1991. 91:72S–5S.
crossref
3). Livornese LL Jr., Drus S., Samel C. Hospital-acquired infection with vancomycin-resistant Enterococcus faecium transmitted by electronic thermometers. Ann Intern Med. 1992. 117:112–6.
4). Murray BE., Singh KV., Lopardo HA., Patterson JE., Zervos MJ, et al. Evidence for clonal spread of a single strain of β-lactamase-producing Enterococcus faecalis to six hospitals in five states. J Infect Dis. 1991. 163:780–5.
5). Murray BE., Lopardo HA., Rubeglio EA., Frosolono M., Singh KV. Intrahospital spread of single gentamicin-resistant, β-lactamase-producing strain of Enterococcus faecalis in Argentina. Antimicrob Agents Chemother. 1992. 36:230–2.
6). Porwancher R., Sheth A., Remphrey S., Taylor E., Hinkle C., Zervos M. Epidemiological study of hospital-acquired infection with vancomycin-resistant Enterococcus faecium: possible transmission by an electronic ear-probe thermometer. Infect Control Hosp Epidemiol. 1997. 18:771–3.
7). Leclercq R., Derlot E., Duval J., Courvalin P. Plasmid-mediated resistance to vancomycin and teicoplanin in Enterococcus faecium. N Engl J Med. 1988. 319:157–61.
8). Arthur M., Courvalin P. Genetics and mechanisms of glycopeptide resistance in enterococci. Antimicrob Agents Chemother. 1993. 37:1563–71.
crossref
9). Leclercq R., Derlot E., Weber M., Duval J., Courvalin P. Transferable vancomycin and teicoplanin resistance in Enterococcus faecium. Antimicrob Agents Chemother. 1989. 33:10–5.
10). Noble WC., Virani Z., Cree RGA. Co-transfer of vancomycin and other resistance gens from Enterococcus faecalis NCTC 12201 to Staphylococcus aureus. FEMS Microbiol Lett. 1992. 72:195–8.
11). Brown AR., Townsley AC., Amyes SG. Diversity of Tn1546 elements in clinical isolates of glycopeptide-resistant enterccocci from Scottish hospitals. Antimicrob Agents Chemother. 2001. 45:1309–11.
12). Darini AL., Palepou MF., Woodford N. Nucleotide sequence of IS1542, an insertion sequence identified within VanA glycopeptide resistance elements of enterococci. FEMS Microbiol Lett. 1999. 173:341–6.
13). Handwerger S., Skoble J., Discotto LF., Pucci MJ. Heterogeneity of the vanA gene cluster in clinical isolates of enterococci from the Northeastern United States. Antimicrob Agents Chemother. 1995. 39:362–8.
14). Huh JY., Lee WG., Lee K., Shin WS., Yoo JH. Distribution of insertion sequences associated with Tn1546-like elements among Enterococcus faecium isolates from patients in Korea. J Clin Microbiol. 2004. 42:1897–902.
15). Jensen LB., Ahrens P., Dons L., Jones RN., Hammerum AM., Aarestrup FM. Molecular analysis of Tn1546 in Enterococcus faecium isolated from animals & humans. J Clin Microbiol. 1998. 36:437–42.
16). Simonsen GS., Myhre MR., Dahl KH., Olsvik O., Sundsfjord A. Type ability of Tn1546-like elements in vancomycin-resistant enterococci using long-range PCRs and specific analysis of polymorphic regions. Microb Drug Resist. 2000. 6:49–57.
17). Arthur M., Molinas C., Courvallin P. The VanS VanR two-component regulatory system controls synthesis of depsipeptide peptidoglycan precursors in Enterococcus faecium BM4147. J Bacteriol. 1992. 174:2582–91.
18). Hashimoto Y., Tanimoto K., Ozawa Y., Murata T., Ike Y. Amino acid substitutions in the VanS sensor of the VanA type vancomycin resistant enterococcus strains result in high-level vancomycin resistance and low-level teicoplanin resistance. FEMS Microbiol Lett. 2000. 185:247–54.
19). Lee WG., Huh JY., Cho SR., Lim YA. Reduction in glycopeptide resistance in vancomycin-resistant enterococci as a result of vanA cluster rearrangements. Antimicrob Agents Chemother. 2004. 48:1379–81.
20). Arias CA., Martín-Martinez M., Blundell TL., Arthur M., Courvalin P., Reynolds PE. Characterization and modelling of VanT: a novel, membrane-bound, serine racemase from vancomycin-resistant Enterococcus gallinarum BM4174. Mol Microbiol. 1999. 31:1653–64.
21). Park IJ., Lee WG., Shin JH., Lee KW., Woo GJ. VanB phenotype-vanA genotype Enterococcus faecium with heterogeneous expression of teicoplanin resistance. J Clin Microbiol. 2008. 46:3091–3.
22). Henrique PM., Palazzo IC., Zanella RC., Darini AL. Molecular characterization of enterococci harboring genotype and phenotype incongruence related to glycopeptide resistance isolated in Brazilian hospitals. Mem Inst Oswaldo Cruz. 2008. 103:301–5.
crossref
23). Baptista M., Depardieu F., Courvalin P., Arthur M. Specificity of induction of glycopeptide resistance genes in Enterococcus faecalis. Antimicrob Agents Chemother. 1996. 40:2291–5.
24). Loeb M., Salama S., Armstrong-Evans M., Capretta G., Olde J. A case-control study to detect modifiable risk factors for colonization with vancomycin-resistant enterococci. Infect Control Hosp Epidemiol. 1999. 20:760–3.
crossref
25). Ratanasuwan W., Iwen PC., Hinrichs SH., Rupp ME. Bacteremia due to motile Enterococcus species: clinical features and outcomes. Clin Infect Dis. 1999. 28:1175–7.

Figure 1.
Detection of vanA gene in genomic and plasmid DNA of VRE isolates from patients by PCR using vanA primer set. Amplified PCR products were analyzed by 1% agarose gel electrophoresis. A, B: Genomic DNA, C, D: plasmid DNA. vanA was detected in both genomic and plasmid DNA from all of VRE isolates except for reference Enterococcus faecium (R; ATCC 19434). M: 100 bp plus ladder DNA molecular size marker, R: reference Enterococcus faecium (ATCC 19434).
jbv-40-179f1.tif
Figure 2.
Detection of IS1216V and IS1542 gene in plasmid DNA of VRE isolates from patients by PCR using specific primer set. The amplified PCR products were analyzed by 1% agarose gel electrophoresis. Plasmid DNA was extracted by using LaboPass Plasmid Mini Purification kit. IS1216V was detected strongly in plasmids from VRE1-5 and 7-8 except for reference Enterococcus faeciem (ATCC 19434), 6, 10-11. The gene was weakly amplified in those from VRE9. IS1542 was detected in VRE2, 3, 5, 7 and 9-11. M: 100 bp plus ladder DNA molecular size marker, R: reference Enterococcus faecium (ATCC 19434), VRE, vancomycin-resistant enterococci.
jbv-40-179f2.tif
Figure 3.
Change of vanA gene in plasmid of VRE isolates through serial passage using BHI broth without vancomycin. vanA was detected weakly in plasmids from VRE 7 and 9, which are E. gallinarum isolates, but not changed in those from VRE 4 and 11, Enterococcus faecium isolates. VRE 2 & 4: VR-E. faecium, VRE10 & 11: VR-E. gallinarum, VRE2: vanA phenotype with IS1216V and IS1542, VRE4: vanA phenotype with only IS1216V, VRE10: vanA phenotype with only IS1542, VRE11: vanB phenotype with only IS1542. M: 100 bp plus ladder DNA molecular size marker, VRE, vancomycin-resistant enterococci. p10: 10th passaged VRE in normal growth media. p11: changed media to broth with 10 μg/ml of vancomycin
jbv-40-179f3.tif
Table 1.
Sequences of primers used for determination of genotypes of vancomycin-resistant enterococci
Genotypes Primer sequence Product length (bp)
vanA S: TAGCGTCCCAACGAACAC AS: GCAAGCGTTGCGTGATAC 1164
vanB S: TGGCATCCCAACGAACAC AS: GCTGCGAGATACCACAGA 1155
vanC S: GACAACAGGAAGACCGCA AS: TCGTACGAGTCGTTCCCA 1104
IS1216V S: GATGAACGCTCTCATCATGC AS: CCTGAGAAAACAGTGCTTCA 689
IS1542 S: ACTGTAATGGCTGGTGTTAAC AS: CATAGTTATCACCCCTTTCAC 462
Table 2.
Difference of antimicrobial susceptibility among six isolated VR-E. faecium
Antibiotics VR-E. faecium isolate types
1 2, 5 3, 4 6
Chloramphenicol I S S S
Gentamicin R R S R
Nitrofuantoin R R I I
Streptomycin S S S R
Tetracycline S R S S
Teicoplanin R R R R
Vancomycin R R R R
Van phenotype VanA VanA VanA VanA
van genotype vanA vanA vanA vanA

Antibiotic resistant range in CLSI guidelines: ≥15~16 mm to vanomycin and ≥11~13 mm to teicoplanin.

R; resistant, S; susceptible, I; intermediate

Table 3.
Difference of antimicrobial susceptibility among five isolated VR-E. gallinarum
Antibiotics VR-E. gallinarum isolate types
7, 9, 10 8 11
Chloramphenicol S S I
Streptomycin S R S
Tetracycline S R S
Teicoplanin R R S
Vancomycin R R R
Van phenotype VanA VanA VanB
van genotype vanA vanA vanA

Antibiotic resistant range in CLSI guidelines: ≥15~16 mm to vanomycin and ≥11~13 mm to teicoplanin.

R; resistant, S; susceptible, I; intermediate

Table 4.
Changes of growth time of reference E. faecalis and E. faecium in BHI broth with different concentration of vancomycin
Enterococci Concentration of vancomycin (μg/ml) Passage number
1 2 3 4 5 6 16 20
E. faecalis 4 72a 72 48 48 24 24 24 24
E. faecium 4 144 48 24 24 24 24 24 24
E. faecalis 10 240 360 144 72 72 72 48 48
E. faecium 10 312 96 96 96 72 72 48 48

a hours taken to grow up to McFarland #2

Table 5.
Results by GPI, GPS-451 and disk diffusion test to final passaged reference E. faecalis and E. faecium in broth with 4 and 10 μg/ml of vancomycin
Antibiotics Concentration (μg/ml) E. faecalis E. faecium
Vitek GPS-451 Disk diffusion (mm) Vitek GPS-451 Disk diffusion (mm)
  0 S S (19) S S (22)
Vancomycin 4 R I (15) R R (14)
  10 R I (16) R R (14)
  0 S S (23) S S (23)
Teicoplanin 4 S S (15) S S (15)
  10 S S (17) S S (20)

Vancomycin resistant and sensitive in CLSI Guidelines: ≥32 μg/mL and ≤2 μg/mL of MIC to vancomycin and teicoplanin in Vitek GPS-451 is resistant, respectively, Antibiotic resistant range in CLSI Guidelines: ≥15~16 mm to vancomycin and ≥11~13 mm to teicoplanin.

Table 6.
Comparison of antimicrobial susceptibility between reference E. faecium and E. faecalis
Antibiotics Reference Enterococcus spp
E. faecium E. faecalis
Ampicillin R S
Chloramphenicol R S
Gentamicin R S
Imipenem R S
Penicillin-G R S
Streptomycin R S
Teicoplanin S S
Vancomycin S S

R; resistant, S; sensitive, I; intermediate

TOOLS
Similar articles