Journal List > J Bacteriol Virol > v.39(4) > 1033948

TOOLS
Moon, Jeong, Choi, Kim, Seo, Shin, Song, Lee, Lee, Park, and Jang: Detection and Identification of the Spotted Fever Group Rickettsial Agents from Haemaphysalis Ticks in Jeju Island, Korea
Original Article

J Bacteriol Virol 2009;39(4):317-327.

Published online: 18 January 2009

DOI: https://doi.org/10.4167/jbv.2009.39.4.317

Detection and Identification of the Spotted Fever Group Rickettsial Agents from Haemaphysalis Ticks in Jeju Island, Korea

Bong-Chun Moon1, Jae-Hee Jeong2, Yeon-Joo Choi2, Jung-Eun Kim2, Hyun-Ji Seo2, E-Hyun Shin3, Bong-Gu Song3, Hee Il Lee4, Seung-Hyun Lee2, Kyung-Hee Park2, Won-Jong Jang∗, 2

1Institute of Environmental Resource Research of Jeju Special Self-Governing Province, Jeju, Korea

2Department of Microbiology, College of Medicine, Konkuk University, Seoul, Korea

3Department of Medical Entomology, Seoul, Korea

4Division of Biosafety Evaluation and Control, Korea Center for Disease Control and Prevention, Seoul, Korea

∗Corresponding author: Won-Jong Jang, Ph.D., Department of Microbiology, College of Medicine, Konkuk University, Gwangjin-Gu, Seoul 143-729, Korea. Phone: +82-2-2030-7816, Fax: +82-2-2030-7845 e-mail: wjjang@kku.ac.kr

      Revised 29 October 200919 November 2009       Accepted 23 November 2009

Copyright © 2009 Korean Society for Legal Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

This study investigated the presence of nucleic acids of various Rickettsial agents in ticks collected in Jeju Island, Korea from June 2007 to August 2008, through the nested polymerase chain reaction (PCR) and sequencing analysis of partial citrate synthase (gltA), Rickettsial outer membrane protein B (ompB), and 17-kDa genes. Examination of the 1,584 ticks showed that the subspecies distribution of Haemaphysalis longicornis was 99.81% (n=1,581) and H. flava was 0.19% (n=3). A total 224 out of 250 pools from one to 15 ticks were found to be positive in ompB-PCR assay (minimal infection rate 141 ticks/1,000 tested). From the positive samples, 26 were analyzed by gltA- and 17-kDa-PCR assays. The nucleotide sequences of the ompB- and gltA-PCR products showed a high degree of similarity with those of the Rickettsia japonica (98.7~99.2% and 98.7~99.3%, n=25) and R. monacensis (99% and 99.7%, n=1). However, analysis of the nucleotide sequences of the 17-kDa-PCR amplicons showed that the sequences of the 25 PCR amplicons were more close to R. marmionii (99.4~100%) than R. japonica (98.6~99.1%). These findings suggest that various rickettsial diseases could be transmitted via the bite of tick vectors in Jeju Island, Korea.

Keywords: Rickettsial agents, Tick, Polymerase chain reaction, gltA, ompB, 17-kDa gene

REFERENCES

1). Dumler JS., Barbet AF., Bekker CP., Dasch GA., Palmer GH., Ray SC., Rikihisa Y., Rurangirwa FR. Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and ‘HGE agent’ as subjective synonyms of Ehrlichia phagocytophila. Int J Syst Evol Microbiol. 2001. 51:2145–65.
2). Anacker RL., Pickens EG., Lackman DB. Details of the ultrastructure of Rickettsia prowazekii grown in the chick yolk sac. J Bacteriol. 1967. 94:260–2.
3). Pang H., Winkler HH. Analysis of the peptidoglycan of Rickettsia prowazekii. J Bacteriol. 1994. 176:923–6.
4). Silverman DJ., Wisseman CL Jr. Comparative ultrastructural study on the cell envelopes of Rickettsia prowazekii, Rickettsia rickettsii, and Rickettsia tsutsugamushi. Infect Immun. 1978. 21:1020–3.
5). Drancourt M., Raoult D. Taxonomic position of the rickettsiae: current knowledge. FEMS Microbiol Rev. 1994. 13:13–24.
crossref
6). Anderson BE., Tzianabos T. Comparative sequence analysis of a genus-common rickettsial antigen gene. J Bacteriol. 1989. 171:5199–201.
crossref
7). Fournier PE., Raoult D. Current knowledge on phylogeny and taxonomy of Rickettsia spp. Ann N Y Acad Sci. 2009. 1166:1–11.
8). Roux V., Raoult D. Phylogenetic analysis of the members of the genus Rickettsia using the gene encoding the outer-membrane protein rOmpB (ompB). Int J Syst Evol Microbiol. 2000. 50:1449–55.
9). Sekeyová Z., Fournier PE., Rehácek J., Raoult D. Characterization of a new spotted fever group Rickettsia detected in Ixodes ricinus (Acari: Ixodidae) collected in Slovakia. J Med Entomol. 2000. 37:707–13.
10). Williams SG., Sacci JB Jr., Schriefer ME., Andersen EM., Fujioka KK., Sorvillo FJ., Barr AR., Azad AF. Typhus and typhus like rickettsiae associated with opossums and their fleas in Los Angeles County, California. J Clin Microbiol. 1992. 30:1758–62.
11). Parola P., Raoult D. Ticks and tickborne bacterial diseases in humans: an emerging infectious threat. Clin Infect Dis. 2001. 32:897–928.
crossref
12). Raoult D., Roux V. Rickettsioses as paradigms of new or emerging infectious diseases. Clin Microbiol Rev. 1997. 10:694–719.
crossref
13). 김관천, 이진종, 김종선, 조영관. 위생곤충학. 파주: 신광문화사,. 2007.
14). 이순형, 채종일, 홍성태. 임상기생충학 개요. 서울: 고려과학. 1996.
15). 한국동물분류학회. 한국동물명집. 서울: 아카데미서적. 1997.
16). Noh YT. A Taxonomical Study on Ticks in Korea. 한국생물 상에 관한 연구. 과학기술처 R-72-82. 1972. 140–60.
17). Kim JE., Park HJ., Lee JY., Cho BK., Lee IY., Lee WK., Koh CJ. Three cases of tick bites by Haemophysalis longicornis. Korean J Dermatol. 2003. 41:1198–201.
18). Roh DK., Jang IG., Cho BK., Son SJ., Lee IY., Lee WK. Tick bite by Haemophysalis longicornis Neumann: Laboratory observation of the causative tick. Korean J Dermatol. 1999. 37:631–6.
19). Yoon SY., Kim KH., Suhr KB., Cho BK., Nam IH., Lee WK., Lee JH., Park JK. A case of tick bite caused by Haemophysalis flava. Korean J Dermatol. 1996. 34:326–30.
20). Unsworth NB., Stenos J., Graves SR., Faa AG., Cox GE., Dyer JR., Boutlis CS., Lane AM., Shaw MD., Robson J., Nissen MD. Flinders Island spotted fever rickettsioses caused by “marmionii” strain of Rickettsia honei, Eastern Australia. Emerg Infect Dis. 2007. 13:566–73.
21). Yamaguti N., Tipton VJ., Keegan H., Toshioka S. Ticks of Japan, Korea, and the Ryukyu islands. Brigham Young University Science Bulletin. 1971. 15:1–126.
22). Choi YJ., Lee SH., Park KH., Koh YS., Lee KH., Baik HS., Choi MS., Kim IS., Jang WJ. Evaluation of PCR-based assay for diagnosis of spotted fever group rickettsiosis in human serum samples. Clin Diagn Lab Immunol. 2005. 12:759–63.
crossref
23). Choi YJ., Jang WJ., Kim JH., Ryu JS., Lee SH., Park KH., Paik HS., Koh YS., Choi MS., Kim IS. Spotted fever group and typhus group rickettsioses in humans, South Korea. Emerg Infect Dis. 2005. 11:237–44.
crossref
24). Regnery RL., Spruill CL., Plikaytis BD. Genotypic identification of rickettsiae and estimation of intraspeecies sequence divergence for portions of two rickettsial genes. J Bacteriol. 1991. 173:1576–89.
25). Leitner M., Yitzhaki S., Rzotkiewicz S., Keysary A. Polymerase chain reaction-based diagnosis of Mediterranean spotted fever in serum and tissue samples. Am J Trop Med Hyg. 2002. 67:166–9.
crossref
26). Rolain JM., Maurin M., Vestris G., Raoult D. In vitro susceptibilities of 27 rickettsiae to 13 antimicrobials. Antimicrob Agents Chemother. 1998. 42:1537–41.
27). Gaywee J., Sunyakumthorn P., Rodkvamtook W., Ruang-areerate T., Mason CJ., Sirisopana N. Human infection with Rickettsia sp. related to R. japonica, Thailand. Emerg Infect Dis. 2007. 13:671–3.
28). Mahara F., Koga K., Sawada S., Taniguchi T., Shigemi F., Suto T., Tsuboi Y., Ooya A., Koyama H., Uchiyama T. The first report of the rickettsial infections of spotted fever group in Japan: three clinical cases. Kansenshogaku Zasshi. 1985. 59:1165–71.
crossref
29). Lee JH., Park HS., Jung KD., Jang WJ., Koh ES., Kang SS., Lee IY., Lee WJ., Kim BJ., Kook YH., Park KH., Lee SH. Identification of the spotted fever group rickettsiae detected from Haemaphysalis longicornis in Korea. Microbiol Immunol. 2003. 47:301–4.
30). Chung MH., Lee SH., Kim MJ., Lee JH., Kim ES., Lee JS., Kim MK., Park MY., Kang JS. Japanese spotted fever, South Korea. Emerg Infect Dis. 2006. 12:1122–4.
crossref
31). Weller SJ., Baldridge GD., Munderloh UG., Noda H., Simser J., Kurtti TJ. Phylogenetic placement of rickettsiae from the ticks Amblyomma americanum and Ixodes scapularis. J Clin Microbiol. 1998. 36:1305–17.
32). Dib L., Bitam I., Bensouilah M., Parola P., Raoult D. First description of Rickettsia monacensis in Ixodes ricinus in Algeria. Clin Microbiol Infect. 2009. May 27 [Epub ahead of print].
33). Jado I., Oteo JA., Aldámiz M., Gil H., Escudero R., Ibarra V., Portu J., Portillo A., Lezaun MJ., García-Amil C., Rodríguez-Moreno I., Anda P. Rickettsia monacensis and human disease, Spain. Emerg Infect Dis. 2007. 13:1405–7.
34). Unsworth NB., Stenos J., Faa AG., Graves SR. Three rickettsioses, Darnley Island, Australia. Emerg Infect Dis. 2007. 13:1105–7.
crossref
35). Graves S., Stenos J. Rickettsioses in Australia. Ann N Y Acad Sci. 2009. 1166:151–5.
crossref
36). Jang WJ., Kim JH., Choi YJ., Jung KD., Kim YG., Lee SH., Choi MS., Kim IS., Walker DH., Park KH. First serologic evidence of human spotted fever group rickettsiosis in Korea. J Clin Microbiol. 2004. 42:2310–3.
crossref

Figure 1.
Map of Jeju Island, Korea showing the geographic distribution of ticks collected from 2007 to 2008. Dots indicate the collection area of the H. longicornis and squares indicate the collection area of H. longicornis and H. flava.
jbv-39-317f1.tif
Figure 2.
Electrophoresis analysis on 1.2% agarose gel of DNAs amplified by PCR targeted ompB (panel A), gltA (panel B), and the 17-kDa (panel C) antigen gene. (A) The size of amplified ompB product was about 407 bp. Lane 1, positive control (R. japonica); lane 2~4, each number of the amplified ompB products. (B) The size of amplified gltA product was about 330 bp. Lane 1, positive control (R. japonica); lane 2~3, each number of the amplified gltA products. (C) The size of amplified 17-kDa product was about 360 bp. Lane 1, positive control (R. japonica); lane 2~3, each number of the amplified 17-kDa products. Lane M, 100 bp DNA ladder; lane N, negative control. The number on the left indicates the molecular size (in base pairs) of the amplified PCR products.
jbv-39-317f2.tif
Figure 3.
Dendrogram representing phylogenetic relationships between partial ompB gene sequences (the size of about 407 bp) of various Rickettsial strain and PCR-amplified ompB products from tick. Phylograms were generated by neighbor-joining analysis with 1,000 bootstrapped replicates.
jbv-39-317f3.tif
Figure 4.
Dendrogram representing phylogenetic relationships between partial gltA gene sequences (the size of about 330 bp) of various Rickettsial strains and PCR-amplified gltA products from tick. Phylograms were generated by neighbor-joining analysis with 1,000 bootstrapped replicates.
jbv-39-317f4.tif
Figure 5.
Dendrogram representing phylogenetic relationships between partial 17-kDa gene sequences (the size of about 360 bp) of various Rickettsial strain and PCR-amplified 17-kDa products from tick. Phylograms were generated by neighbor-joining analysis with 1,000 bootstrapped replicates.
jbv-39-317f5.tif
Table 1.
Nucleotide sequences of PCR primers and conditions used in this study
Ta rget genea Primer Nucleotide sequence (5′→3′) Products size PCR condition References
Denaturation c Annealingc Extensionc Cycles
ompB WJ77 OF GTAACCGGAAGTAATCGTTTCGTAA 500 bp 94 54 72 40  
  WJ80b OR GCTTTATAACCAGCTAAACCACC            
  WJ79 SFG IF GTTTAATACGTGCTGCTAACCAA SFG 407 bp 94 56 72 35 23
  WJ83 TG IF AAGATCCTTCTGATGTTGCAACA TG 231 bp          
  WJ78b SFG/TG IR GGTTTGGCCCATATACCATAAG            
gltA RpCS.877p OF GGGGGCCTGCTCACGGCGG 381 bp 94 52 72 35  
  RpCS.1,258nb OR ATTGCAAAAAGTACAGTGAACA            
  RpCS.896p IF GGCTAATGAAGCAGTGATAA 330 bp 94 54 72 30  
  RpCS.1,233nb IR GCGACGGTATACCCATAGC            
17-kDa Rr17k. 1p OF TTTACAAAATTCTAAAACCAT 540 bp 94 47 72 35  
  Rr17k. 539nb OR TCAATTCACAACTTGCCATT            
  Rr17k. 90p IF GCTCTTGCAACTTCTATGTT 360 bp 94 47 72 30  
  Rr17k. 417nb IR TTTCCGCCTATTACAACTGTT            

a ompB, specific outer membrane protein B gene; gltA, Rickettsial citrate synthase gene; 17-kDa, Rickettsia genus-specific outer membrane antigen gene,

b Reverse orientation

c Temperature (°C).

Table 2.
Tick collected at Jeju Island, Korea, 2007~2008
Species Stages Collection No. ticks No. pools
2007 2008
June July August April May June July August
  Larvaea 0 0 3 0 0 0 0 0 3 1
H. longicornis Nymphb 614 223 36 26 130 115 20 9 1,173 104
  Adults malec 44 77 14 0 4 33 3 4 179 65
  Adults femalec 49 99 26 0 1 36 8 7 226 77
  Larvaea 0 0 0 0 0 0 0 0 0 0
H. flava Nymphb 0 0 0 0 0 0 0 0 0 0
  Adults malec 1 0 0 0 0 0 0 0 1 1
  Adults femalec 0 0 0 0 1 0 0 1 2 2
  Total 708 399 79 26 136 184 31 21 1,584 250

a 1~5 larvae/pool

b 1~15 nymphs/pool

c 1~5 adults/pool

Table 3.
Similarity matrix between partial ompB gene sequence of various Rickettsial strains and nested PCR ompB products
  1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
1 – 92.9 99.2 95.4 94.2 99 94.9 95.2 95.4 94.9 95.2 95.4 95.4 95.4 95.4 93.2
2   – 92.9 89.8 91.9 92.1 89.3 89.5 89.8 89.3 89.5 89.8 89.8 89.8 89.8 90.6
3     – 95.7 94.8 98.7 95.2 95.4 95.7 95.2 95.4 95.7 95.7 95.7 95.7 93.7
4       – 91.7 95.4 98.7 98.9 99.2 98.7 98.9 99.2 99.2 99.2 99.2 90.3
5         – 93.7 91.2 91.4 91.7 91.2 91.4 91.7 91.7 91.7 91.7 99
6           – 94.6 95.2 95.4 94.9 95.2 95.4 95.4 95.4 95.4 92.7
7             – 99.2 99.5 98.9 99.2 99.5 99.5 99.5 99.5 90.9
8               – 99.7 99.2 99.5 99.7 99.7 99.7 99.7 91.2
9                 – 99.5 99.7 100 100 100 100 91.4
10                   – 99.2 99.5 99.5 99.5 99.5 90.9
11                     – 99.7 99.7 99.7 99.7 91.2
12                       – 100 100 100 91.4
13                         – 100 100 91.4
14                           – 100 91.4
15                             – 91.4
16                             – –

1, partial ompB of R. africae (AF123706); 2, R. akari (AF123707); 3, R. conorii (AF149110); 4, R. japonica (AB003681); 5, R. monacensis (EF380356); 6, R. sibirica (AF123722); 7, ompB PCR clone 1; 8, clone 5; 9, clone 14; 10, clone 35; 11, clone 45; 12, clone 81; 13, clone 85; 14, clone 97; 15, clone 100; 16, clone 226

Table 4.
Similarity matrix between partial gltA gene sequence of various Rickettsial strains and nested PCR gltA products
  1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17
1 – 94.6 99.3 99.3 100 96 100 98.3 98 98.7 98.3 98.3 98.3 98.7 98.7 98.7 95.7
2   – 93.6 94.6 94.6 96 94.6 93.6 94 94 93.6 93.6 93.6 94 94 94 96.3
3     – 98.7 99.3 95 99.3 97.7 97.3 98 97.7 97.7 97.7 98 98 98 94.6
4       – 99.3 96 99.3 99 98.7 99.3 99 99 99 99.3 99.3 99.3 95.7
5         – 96 100 98.3 98 98.7 98.3 98.3 98.3 98.7 98.7 98.7 95.7
6           – 96 95 94.6 95.3 95 95 95 95.3 95.3 95.3 99.7
7             – 98.3 98 98.7 98.3 98.3 98.3 98.7 98.7 98.7 95.7
8               – 99 99.7 99.3 99.3 99.3 99.7 99.7 99.7 94.6
9                 – 99.3 99 99 99 99.3 99.3 99.3 94.3
10                   – 99.7 99.7 99.7 100 100 100 95
11                     – 99.3 99.3 99.7 99.7 99.7 94.6
12                       – 99.3 99.7 99.7 99.7 94.6
13                         – 99.7 99.7 99.7 94.6
14                           – 100 100 95
15                             – 100 95
16                               – 95
17                                 –

1, partial gltA of R. africae (RAU59733); 2, R. akari (RAU59717); 3, R. conorii (RCU59730); 4, R. japonica (RJU59724); 5, R. marmionii (AY737684) 6, R. monacensis (DQ100163); 7, R. sibirica (RSU59734); 8, gltA PCR clone 1; 9, clone 5; 10, clone 14; 11, clone 35; 12, clone 45; 13, clone 81; 14, clone 85; 15, clone 97; 16, clone 100; 17, clone 226

Table 5.
Similarity matrix between partial 17-kDa gene sequence of various Rickettsial strains and nested PCR 17-kDa products
  1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
1 – 93.6 99.1 98.3 98 94.2 99.1 97.4 98 98 98 98 98 98 98 98
2   – 94.2 93.9 93.9 93.3 94.2 93.3 93.9 93.9 93.9 93.9 93.9 93.9 93.9 93.9
3     – 98.6 98.3 94.8 99.4 97.4 98.3 98.3 98.3 98.3 98.3 98.3 98.3 98.3
4       – 99.1 94.5 98.6 98.6 99.1 99.1 99.1 99.1 99.1 99.1 99.1 99.1
5         – 94.2 98.3 99.4 100 100 100 100 100 100 100 100
6           – 94.8 93.6 94.2 94.2 94.2 94.2 94.2 94.2 94.2 94.2
7             – 97.7 98.3 98.3 98.3 98.3 98.3 98.3 98.3 98.3
8               – 99.4 99.4 99.4 99.4 99.4 99.4 99.4 99.4
9                 – 100 100 100 100 100 100 100
10                   – 100 100 100 100 100 100
11                     – 100 100 100 100 100
12                       – 100 100 100 100
13                         – 100 100 100
14                           – 100 100
15                             – 100
16                               –

1, partial 17-kDa of R. africae (AF445383); 2, R. akari (AF445383) 3, R. conorii (AE008675); 4, R. japonica (RIR17KGCA); 5, R. marmionii (AY737683); 6, R. monacensis (EF380355) 7, R. sibirica (AF445384); 8, 17-kDa PCR clone 1; 9, clone 5; 10, clone 14; 11, clone 35; 12, clone 45; 13, clone 81; 14, clone 85; 15, clone 97; 16, clone 100

TOOLS
Similar articles