Journal List > J Bacteriol Virol > v.38(2) > 1033918

TOOLS
Kang, Kim, Kim, and Chung: Usefulness of Bacteriological Tests and sspE PCR for Identification of Bacillus cereus Group
Original Article

J Bacteriol Virol 2008;38(2):61-75.

Published online: 18 February 2008

DOI: https://doi.org/10.4167/jbv.2008.38.2.61

Usefulness of Bacteriological Tests and sspE PCR for Identification of Bacillus cereus Group

Sung-Hoon Kang, Ki-Jeong Kim, Won-Yong Kim, Sang-In Chung∗,

Department of Microbiology, College of Medicine, Chung-Ang University, Seoul, 156-756, Republic of Korea

∗Corresponding author: Sang-In Chung. Department of Microbiology, College of Medicine, Chung-Ang University, Seoul, 156-756, Republic of Korea. Phone: +82-2-820-5661, Fax: +82-2-813-5495 e-mail: sichung@cau.ac.kr

∗∗ This work was supported in part by Chung-Ang University (2006).

Received 13 April 2008       Revised 22 April 2008       Accepted 29 April 2008

Copyright © 2008 Journal of Bacteriology and Virology

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

The Bacillus cereus group includes B. anthracis, B. cereus, B. thuringiensis, B. mycoides, B. weihenstephanensis, B. pseudomycoides. The members of B. cereus group shares strong degree of DNA sequence similarity. Even though the biochemical test and bacteriological test have been used to identify the B. cereus group, an accurate identification system of the B. cereus group is required. We have developed a highly specific PCR-based assay for the B. cereus group chromosome using a sequence motif found within a spore structural gene (sspE). Using the assay, we were able to discriminate B. anthracis from the other members of B. cereus group. We also tried to find a new system for the B. cereus group identification. Five bacteriological tests (hemolysis, motility, penicillin susceptibility, rhizoid growth, toxic crystal formation), API system (API 50CHB & API 20E), MLST and sspE PCR were performed on 28 strains of the B. cereus group. The dendrogram generated from API system and bacteriological tests revealed that B. cereus and B. thuringiensis are grouped into the same cluster. In combination of sspE PCR and bacteriological tests, the dendrogram showed that 4 strains of B. cereus clustered within the same group. B. thuringiensis formed the subgroup in the same cluster. All strains of B. mycoides were encompassed together. Another cluster only included B. anthracis. The best system was determined to be sspE PCR and bacteriological tests. It is concluded that sspE PCR and bacteriological tests could be used for rapid discrimination and identification of B. anthracis and provided an effective means of differentiation between the B. cereus group.

Keywords: Bacillus cereus group, Identification, sspE PCR, Bacteriological tests

References

1). 최철순, 김민희, 정상인, 양용태. 탄저균 병원성 및 약 독백신주의 유사 Bacillus species로부터 간이감별을 위 한 주요 배양 및 생물학적 성상. 대한미생물학회지. 27:93–102. 1992.
2). Anderson GL, Simchock JM, Wilson KH. Identification of a region of genetic variability among Bacillus anthracis strains and related species. J Bacteriol. 178:377–384. 1996.
3). Ash C, Collins MD. Comparative analysis of 23S ribosomal RNA gene sequences of Bacillus anthracis and emetic Bacillus cereus determined by PCR-direct sequencing. FEMS Microbiol Lett. 73:75–80. 1992.
4). Ash C, Farrow JA, Dorsch M, Stackebrandt E, Collins MD. Comparative analysis of Bacillus anthracis, Bacillus cereus, and related species on the basis of reverse transcriptase sequencing of 16S rRNA. Int J Syst Bacteriol. 41:343–346. 1991.
5). Logan NA, Carman JA, Melling J, Berkeley RC. Identification of Bacillus anthracis by API tests. J Med Microbiol. 20:75–85. 1985.
6). Bourque SN, Valero JR, Lavoie MC, Levesque RC. Comparative Analysis of the 16S to 23S Ribosimal Intergenic Spacer Sequence of Bacillus thuringiensis strains and Subspecies and of Closely Related Species. Appl Environ Microbiol. 61:1623–1626. 1995.
7). Feil EJ. How Stable Are the Core Genes of Bacterial Pathogen? ASM News. 69:234–239. 2003.
8). Gebhardt C, Murray P, Wood WA, Krig NR. Method for general and molecular bacteriology. American Society for Microbiology;Washington, D.C.: 1994.
9). Green BD, Battisti L, Koehler TM, Thorne CB, Ivins BE. Demonstration of capsule plasmid in Bacillus anthracis. Infect Immun. 49:291–297. 1985.
10). Harbottle H, White DG, McDermott PF, Walker RD, Zhao S. Comparison of multilocus sequence typing, pulsed-field gel electrophoresis, and antimicrobial susceptibility typing for characterization of Salmonella enterica serotype newport isolates. J Clin Microbiol. 44:2449–2457. 2006.
11). Helgason E, Tourasse NJ, Meisal R, Caugant DA, Kolst⊘ AB. Multilocus Sequence Typing Scheme for Bacteria of the Bacillus cereus Group. Appl Environ Microbiol. 70:191–201. 2004.
12). Jolley KA, Feil EJ, Chan MS, Maiden MC. Sequence type analysis and recombinational tests (START). Bioinformatics. 17:1230–1231. 2001.
crossref
13). Kaneko T, Nozaki R, Aizawa K. Dexoyribonucleic acid relatedness between Bacillus anthracis, Bacillus cereus and Bacillus thuringiensis. Microbiol Immunol. 22:639–641. 1978.
14). Kim K, Cheon E, Wheeler KE, Youn Y, Leighton TJ, Park C, Kim W, Chung S. Derermination of the Most Closely Related Bacillus Isolates to Bacillus anthracis by Multilocus Sequence Typing. Yale J Biol Med. 78:1–14. 2005.
15). Kim KJ, Seo JW, Wheeler K, Park CM, Kim DW, Park SJ, Kim WY, Chung SI, Leighton T. Rapid genotypic detection of Bacillus anthracis and the Bacillus cereus group by multiplex real- time PCR melting curve analysis. FEMS Immunol Microbiol. 43:301–310. 2005.
16). Kumar S, Tamura K, Jakobsen IB, Nei M. MEGA2: Molecular evolutionary genetics analysis software. Bioinformatics. 17:1244–1245. 2001.
crossref
17). Lechner S, Mayr R, Francis KP, Pruss BM, Kaplan T, Wiessner-Gunkel E, Stewart GS, Scherer S. Bacillus weihenstephanensis sp. nov. is a new psychrotolerant species of the Bacillus cereus group. Int J Syst Bacteriol. 48(Pt 4):1373–1382. 1998.
18). Logan NA, Berkeley RCW. Classification and identification fo members of the genus Bacillus using API tests. pp. p. 105–140. In. The Aerobic Endospore-forming Bacteria: Classification and Identification. Berkeley RCW, Goodfellow M, editors. (Ed),. Academic Press;London: 1981.
19). Logan NA, Berkeley RC. Identification fo Bacillus Strains Using the API System. J Gen Microbiol. 130:1871–1882. 1984.
20). Logan NA, Capel BJ, Melling J, Berkeley RC. Distinction between emetic and other strains of Bacillus cereus using the API SYSTEM and Numerical methods. FEMS Microbiology Letters. 5:373–375. 1979.
21). Marston CK, Gee JE, Popovic T, Hoffmaster AR. Molecular approaches to identify and differentiate Bacillus anthracis from phenotypically similar Bacillus species isolates. BMC Microbiol. 6:22. 2006.
crossref
22). Morgan U, Ochman H, Renaud F, Tibayrenc M. Population genetics and Population biology: What did they bring to the epidermiology of transmissible disease? Infect Genet Evol. 1:161–166. 2001.
23). Murray PR, Baron EJ. Manual of Clinical Microbiology. Sixth edition. pp. p. 349–356. ASM Press;1995.
24). Nakamura LK. Bacillus pseudomycoides sp. nov. Int J Syst Bacteriol. 48(Pt 3):1031–1035. 1998.
25). Patra G, Sylvestre P, Ramisse V, Thérasse J, Guesdon JL. Isolation of a specific chromosomic DNA sequence of Bacillus anthracis and its possible use in diagnosis. FEMS Immunol Med Microbiol. 15:223–231. 1996.
26). Rhodehamel EJ, Harmon SM. Chapter 14 Bacillus cereus. In. Bacteriological Analytical Manual online. 8th edition.US Department of Health and Human Services and US Food and Drug Administration;2001.
27). Seki T, Chung C, Mikami H, Oshima Y. Deoxyribonucleic acid homology and taxonomy of the genus Bacillus. Int J Syst Bacteriol. 28:182–189. 1978.
28). Sneath PH, Mair NS, Sharpe ME, Holt JG. Bergey's manual of Systematic bacteriology. Vol. 2:pp. p. 1105–1138. Williams & Wilkins;Baltimore, MD: 1986.
29). Turnbull PC, Hutson RA, Ward MJ, Jones MN, Quinn CP, Finnie NJ, Duggleby CJ, Kramer JM, Melling J. Bacillus anthracis but not always anthrax. J Appl Bacteriol. 72:21–28. 1992.
30). Yamada S, Ohashi E, Agata N, Venkateswaran K. Cloning and nucleotide sequence analysis of gyrB of Bacillus cereus, B. thuringiensis, B. mycoides, and B. anthracis and their application to the detection of B. cereus in rice. Appl Environ Microbiol. 65:1483–1490. 1999.

Figure 1.
Dendrogram of 28 strains of B. cereus group constructed by UPGMA based on the bacteriological and API System (API 50CHB & API 20E). The clades are indicated by roman numerals. Clade II encompassed 4 strains of B. anthracis. The scale bars indicate the percentage of missmatches between biological and biochemical properties.
jbv-38-61f1.tif
Figure 2.
MLST Dendrograms were generated by UPGMA method from genetic distances. The scale bar indicate the percentages of allelic distances between STs for MLST. The MLST dendrogram shows that B. thuringiensis BGSC 4AJ1, 4AB1, 4CC1 were the most proximate to B. anthracis.
jbv-38-61f2.tif
Figure 3.
Agarose gel electrophoresis analysis of sspE gene polymerase chain reaction (PCR) on 28 strains of B. cereus group. Lane: M, 100-bp DNA size ladder; 1, B. anthracis Sterne 34-F2; 2, B. anthracis Pasteur No.2; 3, B. anthracis ATCC 14185; 4, B. anthracis ATCC 14186; 5, B. thuringiensis BGSC 4AB1; 6, B. thuringiensis BGSC 4AJ1; 7, B. thuringiensis BGSC 4AQ1; 8, B. thuringiensis BGSC 4AS1; 9, B. thuringiensis BGSC 4CC1; 10, B. thuringiensis DSM 2046; 11, B. cereus KCTC 3624; 12, B. cereus BGSC 6E1; 13, B. cereus KCTC 1014; 14, B. cereus KCTC 1094; 15, B. cereus KCTC 3062; 16, B. mycoides ATCC 10206; 17, B. mycoides ATCC 21929; 18, B. mycoides ATCC 23258; 19, B. mycoides KCCM 40260; 20, B. mycoides KCTC 3453; 21, Bacillus spp. IB; 22, Bacillus spp. 003; 23, Bacillus spp. 9727; 24, Bacillus spp. IV; 25, Bacillus spp. III; 26, Bacillus spp. III BL; 27, Bacillus spp. III BS; 28, Bacillus spp. Rho; 29, B. subtilis ATCC 6051; 30, negative water control (no template DNA).
jbv-38-61f3.tif
Figure 4.
Dendrogram of 28 strains of B. cereus group constructed by UPGMA based on the bacteriological and sspE gene PCR. The clades are indicated by roman numerals. Clade III encompassed 4 strains of B. anthracis. The scale bars indicate the percentage of missmatches between biological and sspE gene PCR results.
jbv-38-61f4.tif
Figure 5.
The Identification scheme of Bacillus cereus group. (First step) Gram stain, (Second step) Differenciation of Bacillus cereus group by sspE gene PCR, (Third step) Additional bacteriological tests and final identification
jbv-38-61f5.tif
Table 1.
The B. cereus group strains examined in this study
Species and strain Origin
B. anthracis (4 strains)  
B. anthracis Sterne 34-F2 vaccine strain (pXO1+ pXO2–)
B. anthracis Pasteur #2 vaccine strain (pXO1– pXO2–)
B. anthracis ATCC 14185 pXO1+ pXO2–
B. anthracis ATCC 14186 pXO1+ pXO2–
B. thuringiensis (6 strains)  
B. thuringiensis BGSC 4AB1 B. thuringiensis subsp. morrisoni
B. thuringiensis BGSC 4AJ1 B. thuringiensis subsp. monterrey
B. thuringiensis BGSC 4AQ1 B. thuringiensis subsp. seoulensis
B. thuringiensis BGSC 4AS1 B. thuringiensis subsp. oswaldocruzi
B. thuringiensis BGSC 4CC1 B. thuringiensis subsp. pulsiensis
B. thuringiensis DSM 2046 B. thuringiensis Berliner 1915AL
B. cereus (5 strains)  
B. cereus KCTC 3624 Type strain
B. cereus BGSC 6E1 Wild type isolate
B. cereus KCTC 1014 From turkey and chicken manure
B. cereus KCTC 1094 From soil, Japan
B. cereus KCTC 3062 From sheep rumen
B. mycoides (5 strains)  
B. mycoides ATCC 10206 B. mycoides Fiugge
B. mycoides ATCC 21929 From soil, New Guinea
B. mycoides ATCC 23258 From soil
B. mycoides KCCM 40260 From soil, New Guinea
B. mycoides KCTC 3453 From soil
Unknow Bacillus spp. (8 strain)  
Bacillus spp. IB Wild type isolate lraq
Bacillus spp. 003 Wild type isolate lraq
Bacillus spp. 9727 Wild type isolate Sarajevo
Bacillus spp. IV Wild type isolate
Bacillus spp. III Wild type isolate lraq
Bacillus spp. III BL Wild type isolate
Bacillus spp. III BS Wild type isolate
Bacillus spp. Rho Patient isolate, Korea 1988

ATCC, American Type Culture Collection, Manassas, VA, USA

BGSC, Bacillus Genetic Stock Center, Department of Biochemistry, The Ohio State University, Columbus, OH, USA

DSM, Deutsche Sammlungvon Mikroorganismenund Zelkulturen, Braunschweig, Gemany

Table 2.
Nucleotide sequences of the primers for the sspE gene PCR in this study
Loci Primers Products (bp)a Sequence (5′ → 3′)
sspE sspE-F1 188, 71 GAGAAAGATGAGTAAAAAACAACAA
(Chromosome) sspE-R1   CATTTGTGCTTTGAATGCTAG

a Boldface, B. anthracis specific amplicons,

b Calculated by the nearest-neighbormethod

∗ Source of primers originated from our previous report (Kim et al., 2005)

Table 3.
Cultural and biological properties of B. cereus group in this study
    Hemoysis Penicillin Rhizoid growth Motility Toxin crystals
  Sterne 34 F2 – + (19.2 mm) – – –
B. anthracis Pasteure #2 – + (18.0 mm) – – –
  ATCC14185 – + (19.8 mm) – – –
  ATCC14186 – + (20.2 mm) – – –
  BGSC 4AB1 + – – + +
  BGSC 4AJ1 + – – + +
B. thuringiensis BGSC 4AQ1 + – – + +
  BGSC 4AS1 + – – + +
  BGSC 4CC1 + – – + +
  DMS 2046 + – – + +
  KCTC 3624 + – – + –
  BGSC 6E1 + – – + –
B. cereus KCTC 1014 + – – + –
  KCTC 1094 + – – – –
  KCTC 3062 + – – + –
  ATCC 10206 + + (14.2 mm) + – –
  ATCC 21929 + – + – –
B. mycoides ATCC 23258 + – + – –
  KCCM 40260 + – + – –
  KCTC 3453 + – + – –
  Bacillus spp. 18 + – – + –
  Bacillus spp. 003 + – – + –
  Bacillus spp. 9727 + – – + –
Unknow Bacillus spp. IV + – – + –
Bacillus spp. Bacillus spp. III + – – + –
  Bacillus spp. III BL + – – + –
  Bacillus spp. III BS + – – + –
  Bacillus spp. Rho – – – – –
Table 4.
Identification Result of 28 strains by API system
Strain Using API 50CHB Using API 50CHB and API 20E
Identification % ID T Index Identification % ID T Index
  Sterne 34 F2 B. cereus 1 57.6 1 B. cereus 1 43.8 0.92
    B. anthracis 32.9 0.97 B. anthracis 43.5 0.89
  Pasteure #2 B. cereus 1 89.0 0.68 B. cereus 1 82.2 0.66
    B. mycoides 9.9 0.57 B. mycoides 16.3 0.62
  ATCC14185 B. cereus 1 57.6 1 B. cereus 1 43.8 0.92
    B. anthracis 32.9 0.97 B. anthracis 43.5 0.89
  ATCC14186 B. cereus 1 57.6 1 B. cereus 1 43.8 0.92
    B. anthracis 32.9 0.97 B. anthracis 43.5 0.89
  BGSC 4AB1 B. cereus 1 97.4 0.99 B. cereus 1 98.4 0.94
  BGSC 4AJ1 B. cereus 1 99.0 0.95 B. cereus 1 98.0 0.85
  BGSC 4AQ1 B. cereus 1 99.6 0.75 B. cereus 1 99.8 0.74
B. thuringiensis BGSC 4AS1 B. cereus 1 90.7 0.77 B. cereus 1 B. mycoides 91.1 6.2 0.73 0.65
  BGSC 4CC1 B. cereus 1 88.2 0.81 B. cereus 1 84.7 0.76
    B. mycoides 16.2 0.72 B. mycoides 15.0 0.71
  DMS 2046 B. cereus 1 Low discrimination 51.6 0.44 B. cereus 1 good identification 98.9 0.49
    B. lentus 34.7 0.73      
  KCTC 3624 B. cereus 1 57.6 1 B. cereus 1 86.8 0.92
    B. anthracis 32.9 0.97 B. mycoides 12.5 0.87
  BGSC 6E1 B. cereus 1 B. anthracis 91.2 8.2 0.87 0.75 B. cereus 1 B. anthracis 85.7 13.3 0.81 0.71
B. cereus KCTC 1014 B. cereus 1 B. anthracis 93.3 6.4 0.94 0.82 B. cereus 1 93.8 0.75
  KCTC 1094 B. cereus 1 99.0 0.95 B. cereus 1 99.3 0.68
  KCTC 3062 B. cereus 1 94.7 0.95 B. cereus 1 B. mycoides 90.5 9.4 0.79 0.73
  ATCC 10206 B. mycoides 67.7 0.78 B. mycoides 99.0 0.76
    B. cereus 2 30.9 0.76      
  ATCC 21929 B. mycoides 46.3 0.94 B. mycoides 51.6 0.92
    B. anthracis 30.7 0.93 B. anthracis 33.5 0.86
B. mycoides ATCC 23258 B. mycoides 46.3 0.94 B. mycoides 51.6 0.92
    B. anthracis 30.7 0.93 B. anthracis 33.5 0.86
  KCCM 40260 B. mycoides 46.3 0.94 B. mycoides 51.6 0.92
    B. anthracis 30.7 0.93 B. anthracis 33.5 0.86
  KCTC 3453 B. mycoides 46.3 0.94 B. mycoides 46.5 0.74
    B. anthracis 30.7 0.93 B. anthracis 26.3 0.67
  Bacillus spp. 1B B. cereus 1 72.3 0.78 B. cereus 1 87.6 0.74
    B. anthracis 18.6 0.72 B. mycoides 6.5 0.66
  Bacillus spp. 003 B. anthracis 45.1 0.79 B. cereus 1 58.2 0.74
    B. cereus 1 32.5 0.79 B. mycoides 27.2 0.73
  Bacillus spp. 9727 B. cereus 1 99.1 0.96 B. cereus 1 99.2 0.88
  Bacillus spp. IV B. cereus 1 72.3 0.78 B. cereus 1 87.6 0.74
    B. anthracis 18.6 0.72 B. mycoides 6.5 0.66
Unknown Bacillus spp. Bacillus spp. III B. cereus 1 72.3 0.78 B. cereus 1 87.6 0.74
    B. anthracis 18.6 0.72 B. mycoides 6.5 0.66
  Bacillus spp. III BL B. cereus 1 72.3 0.78 B. cereus 1 87.6 0.74
    B. anthracis 18.6 0.72 B. mycoides 6.5 0.66
  Bacillus spp. III BS B. cereus 1 72.3 0.78 B. cereus 1 87.6 0.74
    B. anthracis 18.6 0.72 B. mycoides 6.5 0.66
  Bacillus spp. Rho B. cereus 1 85.8 0.99 B. cereus 1
Low discrimination		 76.7 0.91
    B. mycoides 12.7 0.89 B. mycoides 20.2 0.88
TOOLS
Similar articles