Journal List > J Bacteriol Virol > v.36(2) > 1033862

TOOLS
Cho, Kim, Lee, Park, Kwak, Kim, Kang, Kim, Kim, and Ku: Alteration in gyrA and parC Gene Associated with Fluoroquinolone Resistance of Enterococcus spp. Isolated from Feces of Chicken
Original Article

J Bacteriol Virol 2006;36(2):73-78.

Published online: 18 February 2006

DOI: https://doi.org/10.4167/jbv.2006.36.2.73

Alteration in gyrA and parC Gene Associated with Fluoroquinolone Resistance of Enterococcus spp. Isolated from Feces of Chicken

Jae-Keun Cho1, Ki-Seuk Kim2, Young-Ju Lee2, Cheong-Kyu Park2, Dong-Mi Kwak2, Ae-Ran Kim3, Min-Su Kang3, Jong-Wan Kim3, Byoung-Han Kim3, Bok-Kyung Ku3

1Daegu Metropolitan City Research Institute of Health & Environment, Daegu, 706-732, Korea

2College of Veterinary Medicine, Kyungpook National University, Daegu, 702-701, Korea

3National Veterinary Research and Quarantine Service, Anyang, 430-824, Korea

Received 4 May 2006       Accepted 15 June 2006

Copyright © 2006 Journal of Bacteriology and Virology

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

The purpose of this study was to investigate the fluoroquinolone resistance frequency of Enterococcus spp. from normal chicken feces and to analyse mutations of the gyrA and parC gene associated with fluoroquinolone resistance. Among 52 Enterococcus faecalis and 25 E. faecium isolates, 23 (44.2%) E. faecalis and 7 (28.0%) E. faecium were resistant to ciprofloxacin (CIP) by disc diffusion method. Genetic exchange in gyrA and parC gene among 2 CIP intermediate isolates and 15 CIP resistant isolates were found in the amino acid codon of Ser-83 and Asp-87, and Ser-80 and Glu-84, respectively. These mutants contained a change from Ser to Phe, Val, Tyr, Ile, Thr or Pro at codon 83 and from Glu to Gly or Leu at codon 87 in gyrA gene, and a change from Ser to Ile or Thr at codon 80 and from Glu to Asp or Lys at codon 84 in parC gene. The isolates with mutation in gyrA regardless of a mutation in parC showed high resistance (MIC ≥32 μg/ml) to CIP, enrofloxacin, norfloxacin and ofloxacin. These results suggested that gyrA gene is the primary target for 4 fluoroquinolones resistance in Enterococcus spp.

Keywords: Enterococcus, fluoroquinolone, gyrA, parC

References

1). 송시욱, 정석찬, 김성일, 정명은, 김계희, 이지연, 임숙 경, 이영주, 조남인, 박종명, 박용호. 2003년도 국내 도 축장에서 분리한 세균의 항생제 감수성 조사 1. 도축장 의 식육으로부터 분리한 E. coli의 항생제 감수성. 한국 수의공중보건학회지. 28:215–221. 2004.
2). 이영주, 김애란, 정석찬, 송시욱, 김재홍. 닭 분변유래 E. coli 및 Salmonella spp.의 항생제 내성패턴. 대한수의 학회지. 45:75–83. 2005.
3). Bazile-Pham-Khac S, Truong QC, Lafont JP, Gutmann L, Zhou XY, Osman M, Moreau NJ. Resistance to fluoroquinolones in Escherichia coli isolated from poultry. Antimicrob Agents Chemother. 40:1504–1507. 1996.
4). Chaslus-Dancla E, Martel JL, Carlier C, Lafont JP, Courvalin P. Emergence of aminoglycoside 3-N-acetyltransferase IV in Escherichia coli and Salmonella typhimurium isolated from animals in France. Antimicrob Agents Chemother. 29:239–243. 1986.
5). Cheng S, McCleskey FK, Gress MJ, Petroziello JM, Liu R, Namdari H, Beninga K, Salmen A, DelVecchio VG. A PCR assay for identification of Enterococcus faecium. J Clin Microbiol. 35:1248–1250. 1997.
6). del Mar Lleo M, Tafi MC, Signoretto C, Dal Cero C, Canepari P. Competitive polymerase chain reaction for quantification of nonculturable Enterococcus faecalis cells in lake water. FEMS Microbiol Ecol. 30:345–353. 1999.
7). el Amin NA, Jalal S, Wretlind B. Alterations in gyrA and parC associated with fluoroquinolone resistance in Enterococcus faecium. Antimicrob Agents Chemother. 43:947–949. 1999.
8). Endtz HP, Ruijs GJ, van Klingeren B, Jansen WH, van der Reyden T, Mouton RP. Quinolone resistance in Campylobacter isolated from man and poultry following the introduction of fluoroquinolones in veterinary medicine. J Antimcirob Chemother. 27:199–208. 1991.
crossref
9). Ferrero L, Cameron B, Crouzet J. Analysis of gyrA and grlA mutations in stepwise-selected ciprofloxacin-resistant mutants of Staphylococcus aureus. Antimicrob Agents Chemother. 39:1554–1558. 1995.
10). Ferrero L, Cameron B, Manse B, Lagneaux D, Crouzet J, Famechon A, Blanche F. Cloning and primary structure of Staphylococcus aureus DNA topoisomerase IV: a primary target of fluoroquinolones. Mol Microbiol. 13:641–653. 1994.
11). Garau J, Xercavins M, Rodriguez-Carballeira M, Gomez-Vera JR, Coll I, Vidal D, Llovet T, Ruiz-Bremon A. Emergence and dissemination of quinolone-resistant Escherichia coli in the community. Antimicrob Agents Chemother. 43:2736–2741. 1999.
12). Gellert M, Mizuuchi K, O'Dea MH, Nash HA. DNA gyrase: an enzyme that introduces superhelical turns into DNA. Proc Natl Acad Sci USA. 73:3872–3876. 1976.
crossref
13). Hooper DC, Wolfson JS. Fluoroquinolone antimicrobial agents. N Engl J Med. 324:384–394. 1991.
crossref
14). Kanematsu E, Deguchi T, Yasuda M, Kawamura T, Nishino Y, Kawada Y. Alterations in the gyrA subunit of DNA gyrase and the parC subunit of DNA topoisomerase IV associated with quinolone resistance in Enterococcus faecalis. Antimicrob Agents Chemother. 42:433–435. 1998.
15). Kato J, Nishimura Y, Imamura R, Niki H, Hiraga S, Suzuki H. New topoisomerase essential for chromosome segregation in Escherichia coli. Cell. 63:393–404. 1990.
16). Korten V, Huang WM, Murray BE. Analysis by PCR and direct DNA sequencing of gyrA mutations associated with fluoroquinolone resistance in Enterococcus faecalis. Antimicrob Agents Chemother. 38:2091–2094. 1994.
17). Morrison AJ Jr, Wenzel RP. Nosocomial urinary tract infections due to Enterococcus Ten years experience at a university hospital. Arch Intern Med. 146:1549–1551. 1986.
crossref
18). Murray BE. The life and times of the Enterococcus. Clin Microbiol Rev. 3:46–65. 1990.
crossref
19). Na EY, Trucksis M, Hopper DC. Quinolone resistance mutations in topoisomerase IV: relationship to the flqA locus and genetic evidence that topoisomerase IV is the primary target and DNA gyrase is the secondary target of fluoroquinolones in Staphylococcus aureus. Antimicrob Agents Chemother. 40:1881–1888. 1996.
20). Onodera Y, Okuda J, Tanaka M, Sato K. Inhibitory activities of quinolones against DNA gyrase and topoisomerase IV of Enterococcus faecalis. Antimicrob Agents Chemother. 46:1800–1804. 2002.
21). Pan XS, Ambler J, Mehtar S, Fisher LM. Involvement of topoisomerase IV and DNA gyrase as ciprofloxacin targets in Streptococcus pneumoniase. Antimicrob Agents Chemother. 40:2321–2326. 1994.
22). Pan XS, Fisher LM. Targeting of DNA gyrase in Streptococcus pneumoniae by sparfloxacin: selective targeting of gyrase or topoisomerase IV by quinolones. Antimicrob Agents Chemother. 41:471–474. 1997.
23). Pitout JD, Thomson KS, Hanson ND, Ehrhardt AF, Coudron P, Sanders CC. Plasmid-mediated resistance to expanded-spectrum cephalosporins among Enterobacter aerogenes strains. Antimicrob Agents Chemother. 42:596–600. 1998.
24). Sylvain B, Fluit AC, Wagner U, Heisig P, Milatovic D, Verhoef J, Scheuring S, Kohrer K, Schmitz FJ. Association of alteration in parC and gyrA proteins with resistance of clinical isolates of Enterococcus faecium to nine different fluoroquinolones. Antimicrob Agents Chemother. 43:2513–2516. 1999.
25). Tankovic J, Mahjoubi F, Courvalin P, Duval J, Leclercq R. Development of fluoroquinolone resistance in Enterococcus faecalis and role of mutations in the DNA gyrase gyrA gene. Antimicrob Agents Chemother. 40:2558–2561. 1996.
26). Tankovic J, Perichon B, Duval J, Courvalin P. Contribution of mutations in gyrA and parC genes to fluoroquinolone resistance of mutants of Streptococcus pneumoniae obtained in vivo and in vitro. Antimicrob Agents Chemother. 40:2505–2510. 1996.

Table 1.
Primers sequences used for the amplification of gyrA and parC gene
Target genes F/R Primer sequence (5′→3′) Fragment size (bp)
gyrA Forward CGGGATGAACGAATTGGGTGTGA 241
  Reverse AATTTTACTCATACGTGCTTCGG  
parC Forward AATGAATAAAGATGGCAATA 191
  Reverse CGCCATCCATACTTCCGTTG  
Table 2.
Ciprofloxacin resistance frequency of 52 E. faecalis and 25 E. faecium isolates from chicken
Isolates No. (%) of isolates
Resistant Intermediate Susceptible Total
E. faecalis 23 (44.2) 23 (44.2) 6 (11.6) 52 (100)
E. faecium 7 (28.0) 12 (44.2) 6 (24.0) 25 (100)
Table 3.
Prevalence of mutations within gyrA and parC genes of 24 Enterococcus spp. isolates
Pattern against ciprofloxacin No. of isolates No. (%) of mutants in amino acid position
gyrA parC gyrA/parC
Ser83 Glu87 Ser80 Ser80 & Glu84a Ser83/Ser80b Ser83/Glu84c Ser83 & Glu87/Ser80d
Susceptible 7 1 (14.3)            
Intermediate 2     1 (50.0) 1 (50.0)      
Resistant 15 5 (33.3) 1 (6.7) 2 (13.3)   5 (33.3) 1 (6.7) 1 (6.7)
Total 24 6 (25.0) 1 (4.2) 3 (12.5) 1 (4.2) 5 (20.8) 1 (4.2) 1 (4.2)

a Mutation at Ser80 and Glu84 of parC gene.

b Mutation at Ser83 of gyrA and Ser80 of parC gene.

c Mutation at Ser83 of gyrA and Glu84 of parC gene.

d Mutation at Ser83 and Glu87 of gyrA, and Ser80 of parC gene

Table 4.
Minimal inhibitory concentration for fluoroquinolones and mutations in the gyrA and parC genes of 24 Enterococcus spp. isolates
Isolatesa CIP discb MIC (μg/ml)c Amino acid at positiond
CIP ENO NOR OFL gyrA parC
83 (Ser) 87 (Glu) 80 (Ser) 84 (Glu)
Efs 26 S 0.5 0.38 2 1.5        
Efs 31 S 0.5 0.5 1.5 1.5        
Efs 54 S 0.75 0.75 2 1.5        
Efs 9 S 0.75 0.75 2 2 Cys      
Efm 18 S 0.5 0.38 2 2        
Efm 24 S 0.5 1 1.5 3        
Efm 38 S 0.5 0.38 1.5 1.5        
Efs 20 I 3 3 16 4     Ile  
Efm 36 I 2 4 3 6     Ile Asp
Efs 47 R ≥32 ≥32 ≥32 ≥32 Phe      
Efs 51 R ≥32 ≥32 ≥32 ≥32 Phe      
Efs 33 R ≥32 ≥32 ≥32 ≥32 Val      
Efs 38 R ≥32 ≥32 ≥32 ≥32 Tyr      
Efs 39 R ≥32 ≥32 ≥32 ≥32 Ile      
Efs 40 R ≥32 ≥32 ≥32 ≥32   Gly    
Efs 4 R ≥32 ≥32 ≥32 ≥32     Ile  
Efs 6 R ≥32 12 ≥32 ≥32     Ile  
Efs 18 R ≥32 ≥32 ≥32 ≥32 Phe   Ile  
Efs 16 R ≥32 ≥32 ≥32 ≥32 Ile   Ile  
Efs 30 R ≥32 ≥32 ≥32 ≥32 Val   Ile  
Efs 56 R ≥32 ≥32 ≥32 ≥32 Tyr     Lys
Efm 29 R ≥32 ≥32 ≥32 ≥32 Phe   Thr  
Efm 10 R ≥32 ≥32 ≥32 ≥32 Thr   Ile  
Efm 28 R ≥32 ≥32 ≥32 ≥32 Pro Leu Ile  

a Efs, E. faecalis; Efm, E. faecium.

b S, susceptible; I, intermediate; R, resistant.

c CIP, ciprofloxacin; ENO, enrofloxacin; NOR, norfloxacin; OFL, ofloxacin.

d For those isolates with no amino acid shown, the codon is identical to that of the wild type isolates

TOOLS
Similar articles