Lipopolysaccharide (LPS) was purchased from Sigma (St. Louis, USA). Cell culture media DMEM, antibiotic-penicillin/streptomycin solution, and fetal bovine serum (Hyclone, Logan, USA) were used for the cell culture.

Cultures of fruiting bodies of Cordyceps militaris were supplied by CM Biotec, Kangnung, Korea and identified by Professor Jae-Mo Sung (Department of Agricultural Biology of Kangwon National University). The dried cultured fruit bodies were extracted with distilled deionized water (DDW) for 6 hrs at 60℃. The water extracts were concentrated with a vacuum evaporator at 70℃ then lyophilized. Cordyceps militaris extract (CME) was included the cordycepin (3'-deoxyadenosine) 1.3 ng/mg which was purchased from Sigma (St. Louis. MO, USA).

RAW264.7 mouse macrophage cells (American Type Culture Collection) were maintained in Dulbecco's Modified Eagle's Medium (DMEM), supplemented with 10% heat-inactivated fetal bovine serum (FBS; Hyclone, USA), 100 U/ml of penicillin, and 100 g/ml of streptomycin (Hyclone, USA) at 37℃ in a 5% CO₂ incubator. Primary macrophages were collected from the peritoneal cavities of mice (8-week-old male ICR mice) after an intraperitoneal (i.p.) injection of 3 ml of 3% thioglycolate broth (Sigma, St. Louis, MO) 4 days before harvesting. The peritoneal macrophages were then washed with 1×PBS (Ca2+- and Mg2+-free) and plated with DMEM containing 10% FBS, 100 U/ml of penicillin, and 100 U/ml of streptomycin at 37℃ in a 5% CO₂ incubator.

A commercially-available cell viability assay was employed to evaluate the cytotoxic effect of cordycepin using thiazolyl blue tetrazolium bromide (Sigma, St. Louis, USA). RAW264.7 cells (2×10⁵ cells/well) were plated with various concentrations of CME in 96-well microtiter plates (Nunc, Roskilde, Denmark) and were then cultured overnight at 37℃ in a 5% CO₂ incubator. Afterwards, 50 µl of MTT solution was added to each well, and the cells were then cultured for 4 hrs at 37℃ in a 5% CO₂ incubator. 100 µL of solubilized solution were added to each well. The plate was allowed to stand overnight in the incubator after evaluation for complete solubilization of the purple formazan crystals and measurement of the optical density (OD) at 560 nm by a microplate reader (Molecular Devices corporation, Sunnyvale, USA).

The amount of nitrite and PGE₂ produced by mouse macrophages was measured in cell culture supernatant. The cells were plated at a density of 1×10⁶ cells in a flat-bottomed, 96-well plates with the 200 µl of culture medium. They were then treated with various concentrations (12.5~200 µg/ml) of CME in the absence of LPS (10 ng/ml) and incubated for overnight. NO production was determined according to the method reported by Stuehr and Nathan (21). The amount of nitrite was measured using the Griess reagent (stock-I: 0.2% N-(1-naphthyl) ethylenediamine-HCl, stock-II: 2% sulfanilamide in 5% H₂PO₄) and the amount of PGE₂ produced was measured using an enzyme-linked immunosorbent assay (ELISA) kit (R&D system, Minneapolis, MI, USA), according to the manufacturer's instructions.

The amount of TNF-α, IL-1β, and IL-6 in the cell culture supernatant were measured using an ELISA kit (eBioscience, San Diego, CA, USA). RAW 264.7 cells were cultured in DMEM with 10% FBS in 12-well, flat-bottomed plates at a density of 5×10⁵ cells/well. The cells were treated with various concentrations (12.5, 25, 50, 100, 200 µg/ml) of CME in the absence or presence of LPS (50 ng/ml) at 37℃ for 48 hrs in humidified air with 5% CO₂. Subsequently, the culture supernatant was collected and assayed according to the manufacturer's instructions.

Total RNA was extracted from RAW264.7 cells using the RNeasy Mini kit (QIAGEN, USA) in an RNase-free environment. RNA was quantified by reading the absorbance at 260 nm as previously described (14). The reverse transcription of 1 µg RNA was carried out using M-MLV reverse transcriptase (Promega, USA), oligo (dT) 16 primer, dNTP (0.5 µM), and 1 U RNase inhibitor. After incubation at 65℃ for 5 min and 37℃ for 60 min, M-MLV reverse transcriptase was inactivated by heating at 70℃ for 15 min. The polymerase chain reaction (PCR) was performed in 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl₂, and 2.5 mM dNTPs with 5 units of Taq DNA polymerase and 10 pM of each primer set for iNOS, PGE₂, IL-1β, IL-6, and PGE₂. The cDNA was amplified by 35 cycles of denaturing at 94℃ for 45 s, annealing at 62℃ for 45 s, and extension at 72℃ for 1 min. Final extension was performed at 72℃ for 5 min. The PCR products were electrophoresed on a 1.5% agarose gels and stained with ethidium bromide. The primers used were 5' AGCTCCTCCCA GGACCACAC 3' (forward) and 5' ACGCTGAGTACCTCATTGGC 3' (reverse) for iNOS, 5' CAGGATGAGACATGACACC 3' (forward) and 5' CTCTGCAGACTCAAACTCCAC 3' (reverse) for IL-1β, 5' GTACTCCAGAAGACCAGAGG 3' (forward) and 5' TGCTGGTGACAACCACGGCC 3' (reverse) for IL-6, 5' TTGACCTCAGCGCTGAGTTG 3' (forward) and 5' CCTGTAGCCCACGTCGTAGC 3' (reverse) for TNF-α, 5' AAGAAGAAAGTTCATTCCTGATCCC 3' (forward) and 5' TGACTGTGGGAGGATACATCTCTC 3' (reverse) for COX-2, and 5' GTGGGCCGCCCTAGGACCAG 3' (forward) and 5' GGAGGAAGAGGATGCGGCAGT 3' (reverse) for β-actin. β-actin was used as an internal control.

After cultured cells were collected and washed twice with cold PBS, they were resuspended in hypotonic buffer (10 mM HEPES, pH 7.9, 10 mM KCl, 1.5 mM MgCl₂, 0.2 mM PMSF, 0.5 mM DTT, 10 µg/ml aportinin). After 15 min incubation on ice, the cells were lysed by the addition of 0.1% NP-40 and vigorous vortexing for 1 min. The nuclei were pelleted by centrifugation at 12,000×g for 1 min at 4℃ and resuspended in high salt buffer (20 mM HEPES, pH 7.9, 25% glycerol, 400 mM KCl, 1.5 mM MgCl₂, 0.2 mM EDTA, 0.5 mM DTT, 1 mM NaF, 1 mM sodium orthovanadate). The supernatant fluid was stored in aliquots at -70℃.

RAW 264.7 cells were washed with phosphate-buffered saline (PBS) and lysed by lysis buffer (1% SDS, 1.0 mM sodium vanadate, 10 mM Tris-Cl buffer, pH 7.4) for 5 min. 20 µg of protein from the cell lysates was applied to 8~12% SDS-polyacrylamide gels and then transferred to nitrocellulose membranes. The membranes were blocked with 5% skim milk in PBST solution for 1 hr. They were then incubated with anti-IL-1β, anti-IL-6, anti-TNF-α, anti-i-NOS, anti-COX-2, and anti-NF-κB monoclonal antibodies (Santa Cruz Biotechnology Inc., Santa Cruz, California, USA) for 2 hrs and washed 3 times with PBST. After incubation with an alkaline phosphatase-labeled secondary antibody (Abcam, Cambridge, USA) for 2 hrs, the bands were visualized using a Western Blot Kit with alkaline phosphatase substrate (Vector, Burlingame, USA).

RAW 264.7 cells (1×10⁶ cells/ml) were cultured in Petridishes. The cells were treated with various concentrations (12.5, 50, 200 µg/ml) of CME in the absence or presence of LPS (100 ng/ml). the dishes were incubated at 37℃ for 24 hrs in humidified 5% CO₂ incubator under standard conditions. The cells were then washed with PBS. The washed cells were blocked with staining buffer containing 10% normal mouse serum (NMS) for 20 min on ice. The blocked cells were incubated with co-stimulatory molecules such as ICAM-1, B7-1 and B7-2 antibody (BD Biosciences, San Jose, USA) for 20 min on ice. The incubated cells were washed three times with staining buffer and then fixed by 1% paraformaldehyde in PBS. The fixed cells were measured by flow cytometry (Beckman coulter, Brea, USA).

Data are expressed as mean±standard deviation. Statistical significance between the groups was determined by a paired t-test and one-way ANOVA for repeated measures. Results of p<0.05 were considered statistically significant. Data were assessed using SPSS (version 15.0, SPSS Inc., Chicago, Illinois).

To analyze the potential proinflammatory properties of CME, we used murine macrophages, which produces NO and PGE₂. Nitric oxide is known to represent toxic and proinflammatory mediators in acute and chronic inflammatory diseases as well as in normal defense reactions. In the current study, macrophages did not release NO in response to the medium alone; LPS (10 ng/ml) was used as a positive control for macrophage activation (Fig. 1A and B). When various concentrations of CME (12.5, 25, 50, 100, 200 µg/ml) were added to the culture media at the time of cell stimulation (18 hrs), NO production increased in a CME concentration-dependent manner (Fig. 1A and B). Further, CME was also found to dose-dependently increase PGE₂ production (Fig. 1C and D). The potential cytoxicity of CME was evaluated by MTT assay after incubating cells for 24 hrs in the absence or presence of LPS. Results revealed that viability was unaffected at the concentrations used to enhance NO and PGE₂ (data not shown). Thus, the immune enhancement was not attributable to a cytotoxic effect.

RT-PCR and western blot analyses were performed to determine whether CME had a direct effect on proinflammatory mediators (NO and PGE₂) related to modulation of the expression of iNOS and COX-2. As shown in Fig. 2A, iNOS and COX-2 protein expression was markedly induced in macrophage cells after treatment both with CME and LPS. This induction was increased by CME treatment in a dose-dependently manner. Furthermore, RT-PCR analysis revealed that the expression of the COX-2 gene was correlated with their protein levels (Fig. 2B).

To determine whether CME had a direct effect on cytokine production, IL-1β, IL-6, and TNF-α secretion were measured in the macrophage cell line using cytokine ELISA kits. IL-1β, IL-6, and TNF-α, are the major proinflammatory cytokines produced by monocytes and macrophages. As shown in Fig. 3, CME dose-dependently increased cytokine production. Interestingly, CME also strongly increased IL-1β and IL-6 production.

To further investigate the important role of CME on immune response, inducing RAW 264.7 cells for 24 hours with LPS or CME resulted in the production of proinflammatory cytokines. As shown in Fig. 4A, CME concentration-dependently induced the expression of IL-1β, IL-6, and TNF-α protein and mRNA (Fig. 4B).

Further to evaluate whether CME influences the phenotypic maturation of macrophages were cultured with CME or LPS for 24 h and then analyzed for any surface expression of ICAM-1, B7-1, and B7-2 molecules. As shown in Fig. 5, CME similarly to LPS, induced dramatic up-regulation of ICAM-1 and B7-1/-2 molecules.

It has been shown that NF-κB activation is a critical factor for the expression of various cytokines, iNOS, and COX-2 in macrophages in response to LPS. In an unstimulated cell, NF-κB resides in the cytoplasm as an inactive NF-κB/IκB complex. Under stimuli, IκBα is phosphorylated and subsequently degraded, allowing NF-κB to translocate into the nucleus (13). To investigate whether CME could affect nuclear translocation of NF-κB, a western blot analysis for NF-κB p65 was carried out with cell lysate in macrophages (Fig. 6). The amount of NF-κB p65 markedly increased upon exposure to LPS alone; CME also increased NF-κB p65.