Evaluation of the Genotypes of the Lewis Blood Group in a Korean Population Using Direct Sequencing

Seo Young Song; Seong Soo An; Sook Won Ryu; Jang Soo Kim; In Bum Suh

doi:10.5045/kjh.2008.43.1.34

Journal List > Korean J Hematol > v.43(1) > 1032800

Go to TopGo to Top Go to BottomGo to Bottom

TOOLS

Song, An, Ryu, Kim, and Suh: Evaluation of the Genotypes of the Lewis Blood Group in a Korean Population Using Direct Sequencing

Original Article

Korean J Hematol 2008;43(1):34-42.

Published online: 19 January 2008

DOI: https://doi.org/10.5045/kjh.2008.43.1.34

Evaluation of the Genotypes of the Lewis Blood Group in a Korean Population Using Direct Sequencing

Seo Young Song, M.D., Seong Soo An, M.D., Ph.D.², Sook Won Ryu, M.D.^1,^4,⁵, Jang Soo Kim, M.D.³, In Bum Suh, M.D.^1,^4,^5,

Departments of Internal Medicine, Korea

¹Laboratory Medicine, College of Medicine, Kangwon National University, Chuncheon, Korea

²Gachon Bionano Research Institute, Kyungwon University, Seongnam, Korea

³Department of Laboratory Medicine, College of Medicine, Korea University, Seoul, Korea

⁴Korea Clinical Medicine Center, Korea

⁵Institute of Medical Science, Kangwon National University, Chuncheon, Korea

Correspondence to：In Bum Suh, M.D. Department of Laboratory Medicine, College of Medicine, Kangwon National University 192-1, Hyoja 2-dong, Chuncheon 200-701, Korea Tel: ＋82-33-258-2446, Fax: ＋82-33-242-1329 E-mail: bloodmd@kangwon.ac.kr

Received 24 October 2008 Revised 28 February 2008 Accepted 5 March 2008

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background:

The FUT2 and FUT3 genes determine the Lewis phenotype of red blood cells (RBCs). Recently, the Lewis genes, the secretor genes, and several mutations that cause Lewis negative and nonsecretor phenotypes have been identified. The purpose of this study was to analyze the gene frequency of FUT2 and FUT3 in a Korean population by comparing the use of the direct sequencing method to the use of the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method for mutation detection in the FUT2 and FUT3 genes.

Methods:

RBCs and peripheral blood leukocytes were obtained from 225 apparently healthy volunteers to determine the phenotype and genotype of the FUT2 and FUT3 genes. Lewis phenotypes were determined on K₃EDTA-stablized fresh blood samples using the column agglutination method. Lewis blood group genotyping was performed by use of the direct sequencing method. For the detection of T59G, C357T, and A385T mutations, the PCR-RFLP method was performed.

Results:

The frequencies of the Lewis blood group phenotype were 12.4% for Le(a＋b−), 70.7% for Le(a−b＋), 11.1% for Le(a−b−) and 5.8% for Le(a＋b＋), respectively. Direct Sequencing of the FUT2 gene identified 92.2% C357T, 56.9% A385T, 0.4% G244A mutations and 1.8% del396. Direct Sequencing of the FUT3 gene identified 46.9% T59G, 30.4% G508A, 1.1% T202C, 1.1% C314T, 0.7% A1029G, 3.0% T1067A and 13.3% G1242A mutations. The PCR-RFLP method results were discordant in nine cases (1 case for C357T, 4 cases for A385T and 2 cases for T59G) as compared to the direct sequencing method results.

Conclusion:

We have determined the frequencies of FUT2 and FUT3 gene mutations in a Korean population. The use of the direct sequencing method was more accurate than the use of the PCR-RFLP method for the determination of the genotype of the FUT2 and FUT3 genes.

Keywords: FUT2 gene, FUT3 gene, Lewis blood group, Phenotype, Genotype, Direct sequencing, PCR-RFLP

REFERENCES

1). McCurley RS., Recinos A 3rd., Olsen AS, et al. Physical maps of human alpha(1,3)fucosyltransferase genes FUT3-FUT6 on chromosomes 19p13.3 and 11q21. Genomics. 1995. 26:142–6.

2). Rouquier S., Lowe JB., Kelly RJ., Fertitta AL., Lennon GG., Giorgi D. Molecular cloning of a human genomic region containing the H blood group alpha(1,2)fucosyltransferase gene and two H locus-related DNA restriction fragments. Isolation of a candidate for the human Secretor blood group locus. J Biol Chem. 1995. 270:4632–9.

3). Hammer L., Månsson S., Rohr T, et al. lewis phenotype of erythrocytes and Le^b-active actine glycolipid in serum of pregnant women. Vox Sang. 1981. 40:27–33.

4). Stigendal L., Olsson R., Rydberg L., Samuelsson BE. Blood group Lewis phenotype on erythrocytes and in saliva in alcoholic pancreatitis and chronic liver disease. J Clin Pathol. 1984. 37:778–82.

5). Liu TC., Chang JG., Lin SF, et al. Lewis (FUT3) genotypes in Taiwanese, Thai, and Filipino populations. Ann Hematol. 2000. 79:599–603.

6). Larson G., Svensson L., Hynsjӧ L., Elmgren A., Rydberg L. Typing for the human lewis blood group system by quantitative fluorescence-activated flow cytometry: large differences in antigen presentation on erythrocytes between A(1), A(2), B, O phenotypes. Vox Sang. 1999. 77:227–36.

7). Chang JG., Yang TY., Liu TC, et al. Molecular analysis of secretor type alpha(1,2)-fucosyltransferase gene mutations in the Chinese and Thai populations. Transfusion. 1999. 39:1013–7.

8). Costache M., Cailleau A., Fernandez-Mateos P., Oriol R., Mollicone R. Advances in molecular genetics of alpha-2- and alpha-3/4-fucosyltransferases. Transfus Clin Biol. 1997. 4:367–82.

9). Serpa J., Almeida R., Oliveira C, et al. Lewis enzyme (alpha1-3/4 fucosyltransferase) polymorphisms do not explain the Lewis phenotype in the gastric mucosa of a Portuguese population. J Hum Genet. 2003. 48:183–9.

10). Ogilvie EM., Fife MS., Thompson SD, et al. The -174G allele of the interleukin-6 gene confers susceptibility to systemic arthritis in children: a multi-center study using simplex and multiplex juvenile idiopathic arthritis families. Arthritis Rheum. 2003. 48:3202–6.

11). Buono P., Pasanisi F., Nardelli C, et al. Six novel mutations in the proopiomelanocortin and melano-cortin receptor 4 genes in severely obese adults living in southern Italy. Clin Chem. 2005. 51:1358–64.

12). Andersson B., Ying JH., Lewis DE., Gibbs RA. Rapid characterization of HIV-1 sequence diversity using denaturing gradient gel electrophoresis and direct automated DNA sequencing of PCR products. PCR Methods Appl. 1993. 2:293–300.

13). Suh IB., Kim YK. Relationship of Helicobacter pylori IgG seroprevalence with Lewis (a,b) blood group phenotype/genotype. Korean J Blood Transfus. 2001. 12:35–45.

14). Napierala D., Garcia-Rojas X., Sam K, et al. Mutations and promoter SNPs in RUNX2, a transcriptional regulator of bone formation. Mol Genet Metab. 2005. 86:257–68.

15). Cowles JW., Cox A., McMican A., Blumberg N. Comparison of monoclonal antisera with conventional antisera for Lewis blood group antigen determination. Vox Sang. 1987. 52:83–4.

16). Young WW Jr., Johnson HS., Tamura Y, et al. Characterization of monoclonal antibodies specific for the Lewis a human blood group determinant. J Biol Chem. 1983. 25: 258:4890–4.

17). Rouger P., Noizat-Pienne F., Le Pennec PY. Advances in the use of monoclonal antibodies for blood group testing. Transfus Clin Biol. 1997. 4:345–9.

18). Good AH., Yau O., Lamontagne LR., Oriol R. Serological and chemical specificities of twelve monoclonal anti-Le^a and anti-Le^b antibodies. Vox Sang. 1992. 62:180–9.

19). Ameno S., Ameno K., Kinoshita H., Tanaka N., Ijiri I. Lewis genotyping by the PCR-RFLP method in a Japanese population and its evaluation in forensic analysis. Int J Legal Med. 1997. 110:232–4.

20). Nishihara S., Narimatsu H., Iwaski H, et al. Molecular genetic analysis of the human Lewis histo-blood group system. J Biol Chem. 1994. 269:29271–8.

21). Yazawa S., Oh-kawara H., Nakajima T., Hosomi O., Akamatsu S., Kishi K. Histo-blood group Lewis genotyping from human hairs and blood. Jpn J Hum Genet. 1996. 41:177–88.

22). Kukowska-Latallo JF., Larsen RD., Nair RP., Lowe JB. A cloned human cDNA determines expression of a mouse stage-specific embryonic antigen and the Lewis blood group alpha(1,3/1,4)fucosyltransferase. Genes Dev. 1990. 4:1288–303.

23). Kelly RJ., Rouquier S., Giorgi D., Lennon GG., Lowe JB. Sequence and expression of a candidate for the human secretor blood group alpha(1,2)fucosyltrans-ferase gene (FUT2). Homozygosity for an enzyme-inactivating nonsense mutation commonly correlates with the non-secrector phenotype. J Biol Chem. 1995. 270:4640–9.

24). Kudo T., Iwasaki H., Nishihara S, et al. Molecular genetic analysis of the human Lewis histo-bood group system. II. Secrector gene inactivation by a novel single missense mutation A385T in Japanese nonsecretor individuals. J Biol Chem. 1996. 271:9830–7.

25). Liu Y., Koda Y., Soejima M., Uchida N., Kimura H. PCR analysis of Lewis-negative gene mutations and the distribution of Lewis alleles in a Japanese population. J Forensic Sci. 1996. 41:1018–21.

Fig. 1

Chromatograms of direct sequencing for FUT2 gene mutations. (A) C357T heterozygote mutant. (B) G385A heterozygote mutant. (C) G244A wild type. (D) del396 mutant.

Fig. 2

Chromatograms of direct sequencing for FUT3 gene mutations. (A) T1067A heterozygote mutant. (B) T202C heterozygote mutant. (C) G1242A heterozygote mutant. (D) C314T heterozygote mutant.

Fig. 3

(A) Electrophoresis pattern for the detection of FUT2 gene mutation (C357T) using AseI restriction enzyme. Lane M-20bp DNA ladder; lane 1,3-wild type; lane 2,4,5,6,7,8het-erozygote mutants. (B) Electrophoresis pattern for the detection of FUT2 gene mutation (A385T) using AluI restriction enzyme. Lane M-20bp DNA ladder; lane 1,4-wild type; lane 2,3,5,6,7,8-heterozygote mutants.

Fig. 4

Electrophoresis pattern for the detection of FUT3 gene mutation (T59G) using MspI restriction enzyme. Lane M-20bp DNA ladder; lane 6-wild type; lane 1,3,4,5,8-heterozygote mutants; lane 7-homozygotic mutants.

Table 1.

Primers and PCR conditions in FUT2 and FUT3 gene

Gene	Name	Primers (5'∼3')	Annealing temperature (^oC) Fragment sizes (bp)
FUT2	tk1	GGGCCTCCATCTCCCAGCTAAC	65	1,153
	tk2	TGCTTCTCATGCCCGGGCACTC
FUT3	sn1	TAAGCAGGAGATTGTCATCAATGACC	60	1,615
	sn2	GTGCAGAGAGATCATCACGGCACG

Table 2.

Primers for nested PCR and direct sequencing in FUT2 and FUT3 gene

Gene	Name	Primers (5'∼3')	Locations (U17894, AY870341) Locations (Sec2, Le)
FUT2	f	GGGCCTCCATCTCCCAGCTAAC	15∼36	−81∼−60
	1f	CCTTCATCCCGGCCCAGAT	341∼360	245~264
	2r	AACGACTGGATGGAGGAGGAA	451∼471	355∼375
	3f	CGCTACAGCTCCCTCATCTT	760∼780	664∼684
	r	TGCTTCTCATGCCCGGGCACTC	1,146∼1,167	1,050∼1,071
FUT3	f	TAAGCAGGAGATTGTCATCAATGACC	8,382∼8,407	−63∼−38
	1f	ACTGCCGACCGCAAGGTGTACC	8,725∼8,746	280∼301
	1r	GCAGCGCTGGATCTGGTTCAA	8,832∼8,852	387∼407
	2f	TGGTGCCTGGGCTGCCGGGA	9,542∼9,561	1,097∼1,116
	2r	TCTCTCTTACCTGGGACCTCACACGCTGG	9,619∼9,639	1,174∼1,194
	r	GTGCAGAGAGATCATCACGGCACG	9,973∼9,996	1,518∼1,551

Table 3.

PCR primers of the nested PCR reaction for the RFLP analysis of FUT2 and FUT3 gene

Gene	Primer name	Primer sequences (5'∼3')	Annealing temperature (^oC)	Product sizes (bp)
FUT2	tk3	CAGGATCCCCTGGCAGAACTACCACA∗TT∗AA	65	98
	tk4	AGCAGGGGTAGCCGGTGAAGCGGACGTACT
	tk5	AACGACTGGATGGAGGAGGAATACCGCA∗G∗C	65	80
	tk6	AGGTCCAGGAGCAGGGGTAGCCGGTGAAG
FUT3	sn3	CCATGGCGCCGCTGTCTGGCCGCC∗C	65	93
	sn4	AGTGGCATCGTCTCGGGACACACG

∗Artificially changed bases to create restriction enzyme site.

Table 4.

Restriction enzymes for the detection of FUT2 and FUT3 gene mutations

Gene	Primer pairs	Mutations	Restriction enzyme	Restriction site	Reaction buffer	Fragment sizes (bp)
Gene	Primer pairs	Mutations	Restriction enzyme	Restriction site	Reaction buffer	Wild-type	Mutated
FUT2	tk3/4	C357T	AseI	AT/TAAT	M	98	70＋28
	tk5/6	A385T	AluI	AG/CT	L	80	51＋29
FUT3	sn3/4	T59G	MspI	C/CGG	M	93	68＋25

Abbreviations: M, medium concentrated reaction buffer included Tris-HCl 10mM (pH 7.5), MgCl₂ 10mM, Dithiothreitol 1mM and NaCl 50mM; L, low concentrated reaction buffer included Tris-HCl 10mM (pH 7.5), MgCl₂ 10mM and Dithiothreitol 1mM.

Table 5.

The distribution of ABO blood group and Lewis phenotype

Blood group	Le(a＋b＋)	Le(a−b＋)	Le(a＋b−)	Le(a−b−)	Total
A	1	48	12	7	68 (30.2%)
B	1	43	10	6	60 (26.7%)
O	11	54	3	7	75 (33.3%)
AB	0	14	3	5	22 (9.8%)
Total (%)	13 (5.8%)	159 (70.7%)	28 (12.4%)	25 (11.1%)	225 (100%)

Table 6.

The frequencies of FUT2 and FUT3 base substitutions in Korean

Gene name	Nucleotide substitution	Allele frequency (%)∗	Type	Frequency (%)^†
FUT2	C357T	415 (92.2)	W	7 (3.1)
			H	21 (9.3)
			M	197 (87.6)
	A385T	256 (56.9)	W	58 (25.8)
			H	78 (34.7)
			M	89 (39.6)
	G244A	2 (0.4)	W	223 (99.1)
			H	2 (0.9)
			M	0 (0)
	del396	4 (1.8)
FUT3	T59G	211 (46.9)	W	69 (30.7)
			H	101 (44.9)
			M	55 (24.4)
	G508A	137 (30.4)	W	113 (50.2)
			H	87 (38.7)
			M	25 (11.1)
	T202C	5 (1.1)	W	220 (97.8)
			H	5 (2.2)
			M	0 (0)
	C314T	5 (1.1)	W	220 (97.8)
			H	5 (2.2)
			M	0 (0)
	T1067A	14 (3.1)	W	211 (93.8)
			H	12 (5.3)
			M	1 (0.4)
	A1029G	3 (0.7)	W	222 (98.7)
			H	3 (1.3)
			M	0 (0)
	G1242A	60 (13.3)	W	167 (74.2)
			H	56 (24.9)
			M	2 (0.9)

∗Total number is 450 alleles,

^† Total number is 225 cases. Abbreviations: W, wild-type; H, mutant heterozygotes; M, mutant homozygotes.

Table 7.

Comparison of direct sequencing and PCR-RFLPfor the detection of FUT2 and FUT3 gene mutation

	FUT2		FUT3
	C357T	A385T	T59G
Direct sequencing	92.2% (415/450)	56.9% (256/450)	46.9% (211/450)
PCR-RFLP	93.6% (421/450)	57.8% (260/450)	47.2% (212/450)

TOOLS

Similar articles