Methylation of p16 and E-cadherin in ameloblastoma

Chan-Woong Park; Hye-Kyoung Yoon; Sang-Jun Park

doi:10.5125/jkaoms.2010.36.6.453

Journal List > J Korean Assoc Oral Maxillofac Surg > v.36(6) > 1032429

Go to TopGo to Top Go to BottomGo to Bottom

TOOLS

Park, Yoon, and Park: Methylation of p16 and E-cadherin in ameloblastoma

Original Article

J Korean Assoc Oral Maxillofac Surg 2010;36(6):453-459.

Published online: 7 January 2010

DOI: https://doi.org/10.5125/jkaoms.2010.36.6.453

Methylation of p16 and E-cadherin in ameloblastoma

Chan-Woong Park¹, Hye-Kyoung Yoon², Sang-Jun Park¹

¹Department of Oral and Maxillofacial Surgery, College of Medicine, Inje University, Busan, Korea

²Department of Pathology, Pusan Paik Hospital, College of Medicine, Inje University, Busan, Korea

Sang-Jun Park Department of Oral and Maxillofacial Surgery, Pusan Paik Hospital, College of Medicine, Inje University 633-165 Gaegum-dong, Busanjin-gu, Busan, 614-735, Korea TEL: +82-51-890-6360 FAX: +82-51-896-6675 E-mail: ds5nki@hanmail.net

Received 16 July 201019 November 2010 Accepted 10 December 2010

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Introduction

Ameloblastic carcinoma is a rare malignant lesion, and may arise from either carcinoma ex-ameloblastoma or de novo carcinoma. Aberrant promoter hypermethylation of the tumor-associated genes leading to their inactivation is a common event in many cancer types. The p16/CDKN2/INK4A gene and p16 5 protein are involved directly in regulating the cell cycles. Cadherins are cell adhesion molecules that modulate the epithelial phenotype and regulate tumor invasion. The aim of this study was to evaluate the roles of p16 and E-cadherin methylation and loss of p16 and E-cadherin expression in the malignant transformation of an ameloblastoma.

Materials and Methods

Eight cases of ameloblastoma, including 4 benign ameloblastomas without recurrence, 2 benign ameloblastomas with recurrence and 2 carcinoma ex-ameloblastomas, were examined. The promoter hypermethylation profile of the p16 and E-cadherin genes was studied using methylation-specific polymerase chain reaction (MSP) and immunohistochemical staining for p16 and E-cadherin expression.

Results

1) Aberrant CpG island methylation of the p16 gene was detected in 3 of the 4 benign ameloblastomas without recurrence and 1 of the 2 benign ameloblastomas with recurrence.
2) Aberrant CpG island methylation of the E-cadherin gene was found in 1 of the 4 benign ameloblastomas without recurrence.
3) A loss of p16 expression was noted in 1 of 4 benign ameloblastomas without recurrence and 1 of 2 carcinoma ex-ameloblastomas.
4) A loss of E-cadherin expression was noted in 2 of the 4 benign ameloblastomas without recurrence, 1 of the 2 benign ameloblastomas with recurrence and 2 of the 2 carcinoma ex-ameloblastomas.
5) A loss of p16 expression was observed in 1 of the 4 cases showing aberrant methylation of the p16 gene.
6) A loss of E-cadherin expression was observed in 3 benign ameloblastoma case showing aberrant methylation of the E-cadherin gene.

Conclusion

These results suggest that loss of E-cadherin expression related to the other genetic pathway (not methylation) might be an adjuvant indicator predicting the malignant transformation of an ameloblastoma. However, the number of samples in this study was too small and the relationship between the treatment methods and clinical course were not defined. Therefore, further study will be needed.

Keywords: p16 genes, Cadherins, Methylation, Ameloblastoma

REFERENCES

1. Barnes L, Eveson JW, Reichart P, Sidransky D. World Health Organization classification of tumours: pathology and genetics of head and neck tumours. Lyon, France: International Agency for Research on Cancer Press. 2005.

2. Baylin SB, Esteller M, Rountree MR, Bachman KE, Schuebel K, Herman JG. Aberrant patterns of DNA methylation, chromatin formation and gene expression in cancer. Hum Mol Genet. 2001; 10:687–92.

3. French SW, Dawson DW, Miner MD, Doerr JR, Malone CS, Wall R, et al. DNA methylation profiling: a new tool for evaluating hematologic malignancies. Clin Immunol. 2002; 103:217–30.

4. Ho A, Dowdy SF. Regulation of G(1) cell-cycle progression by oncogenes and tumor suppressor genes. Curr Opin Genet Dev. 2002; 12:47–52.

5. Rush LJ, Plass C. Alterations of DNA methylation in hematologic malignancies. Cancer Lett. 2002; 185:1–12.

6. Kresty LA, Mallery SR, Knobloch TJ, Song H, Lloyd M, Casto BC, et al. Alterations of p16(INK4a) and p14(ARF) in patients with severe oral epithelial dysplasia. Cancer Res. 2002; 62:5295–300.

7. Viswanathan M, Tsuchida N, Shanmugam G. Promoter hypermethylation profile of tumor-associated genes p16, p15, hMLH1, MGMT and E-cadherin in oral squamous cell carcinoma. Int J Cancer. 2003; 105:41–6.

8. Abiko Y, Nagayasu H, Takeshima M, Yamazaki M, Nishimura M, Kusano K, et al. Ameloblastic carcinoma ex-ameloblastoma: report of a case-possible involvement of CpG island hypermethylation of the p16 gene in malignant transformation. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2007; 103:72–6.

9. Chen Q, Lipkina G, Song Q, Kramer RH. Promoter methylation regulates cadherin switching in squamous cell carcinoma. Biochem Biophys Res Commun. 2004; 315:850–6.

10. Pho SW, Kim YS, Park JY, Kim CH, Lee W, Park MK. The hypermethylation of E-cadherin gene in oral squamous cell carcinoma. J Korean Assoc Oral Maxillofac Surg. 2008; 34:135–40.

11. Auerkari EI. Methylation of tumor suppressor genes p16(INK4a), p7(Kip1) and E-cadherin in carcinogenesis. Oral Oncol. 2006; 42:5–13.

12. Sastre J, Muñoz M, Naval L, Adrados M. Ameloblastic carcinoma of the maxilla: report of a case. J Oral Maxillofac Surg. 2002; 60:102–4.

13. Verneuil A, Sapp P, Huang C, Abemayor E. Malignant ameloblastoma: classification, diagnostic and therapeutic challenges. Am J Otolaryngol. 2002; 23:44–8.

14. Thoma KH. Oral pathology: a histological, roentgenological, and clinical study of the diseases of the teeth, jaws, and mouth. 3rd ed.St. Louis: Mosby;1950.

15. Pindborg JJ, Kramer I, Torloni H. Histological typing of odontogenic tumors, jaw cysts, and allied lesions. Geneva, Switzerland: World Health Organization. 1972.

16. Slootweg PJ, Muller H. Malignant ameloblastoma or ameloblastic carcinoma. Oral Surg Oral Med Oral Pathol. 1984; 57:168–76.

17. Zhao Y, Zhang S, Fu B, Xiao C. Abnormalities of tumor suppressor genes P16 and P15 in primary maxillofacial squamous cell carcinomas. Cancer Genet Cytogenet. 1999; 112:26–33.

18. Nodit L, Barnes L, Childers E, Finkelstein S, Swalsky P, Hunt J. Allelic loss of tumor suppressor genes in ameloblastic tumors. Mod Pathol. 2004; 17:1062–7.

Fig. 1.

Bisulfite genomic sequencing result of 5'CpG island of the p16 gene.

Fig. 2.

SSCP analysis of the p16 gene in ameloblastoma. Lane 1, 3, 4, 5 show corresponding band to C+, C++ line. (BL: blank, C+, C++: positive cell line, N/C: negative control, SSCP: single strand conformational polymorphism)

Fig. 3.

Bisulfite genomic sequencing result of 5'CpG island of the E-cadherin gene.

Fig. 4.

SSCP analysis of the E-cadherin gene in ameloblastoma. Lane 2 shows corresponding band to C+ line. (BL: blank, C+: positive cell line, N/C: negative control, SSCP: single strand conformational polymorphism)

Fig. 5.

Loss of p16 expression in benign ameloblastoma without recurrence (upper) and with recurrence (middle), and carcinoma ex-ameloblastoma (lower).

Fig. 6.

Loss of E-cadherin expression in benign ameloblastoma without recurrence (1st lane) and with recurrence (2nd lane), and in carcinoma ex-ameloblastoma (3rd and 4th lane).

Table 1.

Oligonucleotide sequence used in methylation and unmethylation of 5′-UTR Promotor Region CpG island

Gene	Ori	Oligonucleotide sequence (5′ to 3′)	PCR products (bp)	Cancer cell-line
E-cadherin	MF	TGTAGTTACGTATTTTTTTTTAGTGGCGTC	112 bp	MIA-PACA2
E-cadherin	MR	CGAATACGATCGAATCGAACCG	112 bp	MIA-PACA2
p16	MF	TTATTAGAGGGTGGGGCGGATCGC	150 bp	T-24
p16	MR	GACCCCGAACCGCGACCGTAA	150 bp	T-24

(UTR: untranslated region, PCR: polymerase chain reaction)

Table 2.

Profiles of methylation specific PCR and immunohistochemical findings for p16 and E-cadherin in the ameloblastomas

	Case	Methylation specific PCR		Immunohistochemistry
	Case	p16	E-cadherin	p16	E-cadherin
Benign A. without recurrence	1	+	−	+	+/-
	2	−	+	−	+/-
	3	+	−	+	+
	4	+	−	+/-	+
Benign A. with recurrence	5	+	−	+	−
	6	−	−	+/-	+
Carcinoma ex-A.	7	−	−	−	−
	8	−	−	+	+/-

(PCR: polymerase chain reaction, A: ameloblastoma)

Table 3.

Comparison of methylation specific PCR and immunohistochemical findings for p16 and E-cadherin in the ameloblastomas

	n	p16			E-cadherin
		MSP	IHC		MSP	IHC
		MSP	Partial loss	Total loss	MSP	Partial loss	Total loss
Benign A. without recurrence	4	3	1	1	1	2	0
Benign A. with recurrence	2	1	1	0	0	0	1
Carcinoma ex-A.	2	0	0	1	0	1	1
Total	8	4	2	2	1	3	2

(PCR: polymerase chain reaction, MSP: methylation specific PCR, IHC: immunohistochemical staining, A: ameloblastoma)

TOOLS

Similar articles