For endometrial stromal cell (ESC) cultures, endometrial samples were obtained from fertile women who were diagnosed with intramural leiomyoma at the time of hysterectomy, had no evidence of endometrial abnormalities, adenomyosis, or pelvic endometriosis, and had not taken any hormonal medication in the preceding 3 months. The endometrial samples were placed in Hank's balanced salt solution and transported to the laboratory for ESC isolation and culture. Peritoneal fluids were obtained from a total of five patients in whom advanced-stage endometriosis had been confirmed via laparoscopy before any surgical manipulation during the proliferative phase. Peritoneal fluids were centrifuged and stored at -80℃ until in vitro treatments. Written informed consent was obtained from each patient using consent forms and protocols approved by the Review Board for Human Research of Asan Medical Center.

For immunohistochemical staining, endometrial sections were obtained from a total of 32 women with carcinoma in situ (CIS) of the uterine cervix as well as a total of 39 women with histological evidence of endometriosis. All of the recruited women had regular menstrual cycles and had undergone hysterectomies via either transabdominal or laparoscopic methods. Women with an endometrial abnormality, adenomyosis, or pelvic endometriosis were excluded from the control group, and all of the women in the endometriosis group were surgically confirmed as having advanced-stage endometriosis. In the endometriosis group, the extent of disease was staged according to the American Society for Reproductive Medicine criteria.12 The date of the menstrual cycle was classified as proliferative (days 1–13), early-secretory (days 14–19), mid-secretory (days 20–23), or late-secretory (days 24–28) phase via endometrial histology using the criteria of Noyes, et al.13 Sections of endometrioma were also obtained from 28 nulliparous women in whom ovarian cystectomy was performed due to ovarian endometrioma. The clinical characteristics, the menstrual phases of each group, and the stages of endometriosis are summarized in Table 1. We did not need additional informed consent to use the specimens in this study, as only archived material was used. The Review Board for Human Research in our hospital approved this project.

TNF-α, IL-1β, and Ishikawa cell line (a well-differentiated endometrial adenocarcinoma cell line) were purchased from Sigma-Aldrich (St. Louis, MO, USA).

ESCs were separated and maintained in a monolayer culture as described previously.14 ESCs after first passage were assayed immunocytochemically using specific cell-surface markers, and we previously showed that the purity of isolated ESCs was more than 95%.14 We utilized only the cells after the first passage in all of the experiments using ESCs.

When Ishikawa cells and ESCs were grown to 70% confluence, they were treated with serum-free, phenol red-free media (Sigma-Aldrich) for 18 h before treatment. Afterwards, cell cultures were treated with either vehicle (control), TNF-α (10 ng/mL and 25 ng/mL) or IL-1β (10 ng/mL and 25 ng/mL) for 1 h and 6 h, respectively. For treatment with peritoneal fluid, 1×10⁵ cells were seeded in six-well plates, and when 80% confluence was reached, the cells were starved in serum-free, phenol red-free media (Sigma-Aldrich) overnight. Afterwards, either vehicle or 25% peritoneal fluid was added, and RNA was extracted 1 h and 6 h after the addition of peritoneal fluid.

Total RNA was extracted from the isolated cells using an Easy-blue^TM Total RNA extraction kit (Intron Biotechnology, Seoul, Korea). RNA was measured using a Nanodrop instrument and stored at -80℃. For reverse transcription, 1 µg total RNA, 1 µL oligo d(T)15 (100 pmol/µL), and 2 µL 100 mM dithiothreitol were mixed and incubated at 70℃ for 5 min. After adding 8 µL RT-&GO^TM mastermix 2.5×C (MP Biomedical, Santa Ana, CA, USA), the reverse transcripts were incubated at 70℃ for 15 min for enzymatic inactivation and then stored at -20℃.

Real-time PCR was performed using iQTM SYBR® Green supermix (BIO-RAD, Hercules, CA, USA). The primer sequences for PR-A and PR-B were as follows: PR-A forward, 5' GAGCACTGGATGCTGTTGCT 3', PR-A reverse 5' GGCTTA GGGCTTGGCTTTC 3', PR-B forward, 5' TGGGATCTGAGAT CTTCGGAG 3', and PR-B reverse, 5' GAAGGGTCGGACTTCT GCTG 3'. The iCycler (My iQTM Single Color Real-time PCR Detection System, BIO-RAD) was used for PCR with the following thermocycling conditions: 95℃ for 3 min, 95℃ for 15 sec, 59℃ for 30 sec, 70℃ for 40 sec (40 cycles), and 95℃ for 1 min.

Formalin-fixed paraffin-embedded samples were cut into 4-µm thick sections. After deparaffinization, immunohistochemical staining was performed as described in our previous study14 using a Progesterone Receptor Ab-2 primary antibody (Clone hPRa 2; 1:100; Lab vision Corporation, Fremont, CA, USA) and a biotinylated anti-mouse secondary antibody (1:400; Vector Laboratory, Burlingame, CA, USA). The intensity of PR-B immunoreactivity was semiquantitatively evaluated and analyzed as described previously.14

All of the data were normally distributed as assessed by the Kolmogorov-Smirnov test. Student's t-test was used for comparisons of two variables, and an ANOVA and the post hoc Tukey test for pairwise comparisons were used for the comparison of three variables. Statistical analyses were performed using Statistical Programs for the Social Sciences (SPSS, version 14.0, SPSS Inc., Chicago, IL, USA) software. Statistical significance was defined as p<0.05.

The PR-B/A ratios were assessed using real-time PCR in Ishikawa cells (n=5) and ESCs (n=5) following treatment with vehicle, TNF-α (10 or 25 ng/mL), or IL-1β (10 or 25 ng/mL) for 1 h or 6 h. The PR-B/A ratio was significantly lower in Ishikawa cells treated with 10 ng/mL (p=0.021) and 25 ng/mL (p=0.011) TNF-α at 1 h compared to those treated with vehicle, respectively (Fig. 1A and B). ESCs treated with 25 ng/mL TNF-α had a significantly lower PR-B/A ratio at 1 h than cells treated with vehicle (p=0.027) (Fig. 1C). However, we could not find any differences in the PR-B/A ratio following IL-1β treatment (10 or 25 ng/mL) in Ishikawa cells (Fig. 1B) as well as ESCs (Fig. 1D).

To investigate the effects of peritoneal fluid obtained from patients with advanced-stage endometriosis, the PR-B/A ratio was assayed in Ishikawa cells (n=6) and ESCs (n=6) after treatment with vehicle or peritoneal fluid for 1 or 6 h. The PR-B/A ratio was significantly reduced in Ishikawa cells treated with peritoneal fluid at 1 h (p=0.011) and at 6 h (p<0.001) compared to cells treated with vehicle, respectively (Fig. 1E and F). The ESCs treated with peritoneal fluid had a significantly lower PR-B/A ratio at 1 h than cells treated with vehicle (p=0.027).

We observed strong immunoreactivities of PR-B in the glandular and stromal cells during the proliferative phase, whereas weak or no staining of PR-B was detected during the secretory phase (Fig. 2A). On comparing the HSCOREs between the two phases, we found obvious reductions in PR-B expression during the secretory phase in the glandular cells (p<0.001) as well as in the stromal cells (p=0.001) (Fig. 2B).

Fig. 3 shows the expression of PR-B in the eutopic endometrium of controls and endometriosis patients. The immunoreactivity of PR-B was obviously decreased in the glandular cells as well as in the stromal cells of the eutopic endometrium of women with endometriosis compared to the controls (Fig. 3A and B). In the glandular cells, we observed a significant decrease of PR-B expression in the eutopic endometrium of women with endometriosis compared to the controls throughout the menstrual phases (p=0.031) as well as during the proliferative phase (p<0.001) (Fig. 3C). In the stromal cells, the immunoreactivity of PR-B was significantly lower in the eutopic endometrium of women with endometriosis than in the controls throughout the menstrual phases (p=0.001), during the proliferative phase (p=0.001), and during the early secretory phase (p<0.001), respectively (Fig. 3D).

Based on our findings that PR-B expression was lower in the eutopic endometrium of women with endometriosis than in the controls, we evaluated whether there was also any difference of PR-B expression in ovarian endometrioma. We found that the PR-B expression was significantly decreased in the glandular cells of ovarian endometrioma compared to the controls (p=0.036) (Fig. 4). However, there was no difference in PR-B expression in the stromal cells between the two groups.