Investigation of the Prevalence of Human Parvovirus B19 DNA in Korean Plasmapheresis Donors

Deok Ja Oh; Yoo La Lee; Jae Won Kang; So Yong Kwon; Nam Sun Cho

doi:10.3343/kjlm.2010.30.1.58

Journal List > Korean J Lab Med > v.30(1) > 1011695

Go to TopGo to Top Go to BottomGo to Bottom

TOOLS

Oh, Lee, Kang, Kwon, and Cho: Investigation of the Prevalence of Human Parvovirus B19 DNA in Korean Plasmapheresis Donors

Original Article

Korean J Leg Med 2010;30(1):58-64.

Published online: 14 January 2010

DOI: https://doi.org/10.3343/kjlm.2010.30.1.58

Investigation of the Prevalence of Human Parvovirus B19 DNA in Korean Plasmapheresis Donors

Deok Ja Oh, M.D.¹, Yoo La Lee¹, Jae Won Kang¹, So Yong Kwon, M.D.¹, Nam Sun Cho, M.D.²

¹Blood Transfusion Research Institute, Seoul, Korea

²Central Blood Test Center, Korean Red Cross, Seoul, Korea

Corresponding author: Deok Ja Oh, M.D. Blood Transfusion Research Institute, Korean Red Cross, 764 Sanggye 6-dong, Nowon-gu, Seoul 139-831, Korea Tel: +82-2-3210-0331 Fax: +82-2-3210-0360 E-mail: dj57_2000@redcross.or.kr

^∗ This study was supported by grants from the Blood Service Headquarters, Korean Red Cross.

Revised 1 October 20094 January 2010 Accepted 8 January 2010

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background:

To ensure the safety of plasma derivatives, some countries have been screening for the human parvovirus B19 (B19V) antigen or DNA in blood donors. We investigated the prevalence of B19V DNA and anti-B19V antibodies in Korean plasmapheresis donors to evaluate the necessity of B19V DNA screening test.

Methods:

Plasma samples were collected between March and July 2008 from 10,032 plasmapheresis donors. The B19V DNA test was performed using the LightCycler 2.0 (Roche, Germany) with quantification kits. Anti-B19V IgM and IgG were tested in 928 randomly selected samples from the 10,032 donors using recomWell Parvovirus B19 ELISA IgM, IgG assay (Mikrogen, Germany). RecomLine Parvovirus B19 LIA IgG, IgM assay (Mikrogen, Germany) was used to analyze the epitopes of antibodies in donors showing positive results for B19V DNA and anti-B19V antibodies. DNA sequencing was performed to identify the genotypes.

Results:

The prevalence of B19V DNA was 0.1% (10/10,032). Virus titers in B19V DNA positive donors were less than 10⁵ IU/mL (range: 2.7×10¹-3.2×10⁴ IU/mL) except for 1 donor (1.33×10⁸ IU/mL). All the isolated B19V DNAs from 6 donors were identified as genotype I. Nine out of 10 B19V DNA positive donors also possessed anti-B19V IgG only or IgG and IgM. The prevalence of anti-B19V IgG was 60.1% (558/928).

Conclusions:

The prevalence of B19V DNA in Korean blood donors was not high and most donors also possessed neutralizing anti-B19V antibodies. Thus, the implementation of a B19V screening test for Korean blood donors does not appear to be imperative.

Keywords: Human parvovirus B19, Plasmapheresis donors, Prevalence

REFERENCES

1.Santagostino E., Mannucci PM., Gringeri A., Azzi A., Morfini M. Eliminating parvovirus B19 from blood products. Lancet. 1994. 343:798–9.

2.Yee TT., Cohen BJ., Pasi KJ., Lee CA. Transmission of symptomatic parvovirus B19 infection by clotting factor concentrate. Br J Haematol. 1996. 93:457–9.

3.Mosquet B., Lacotte J., Le Querrec A., Petitjean J., Grollier G., Moulin M. Severe hematologic involvement in parvovirus B19 infection. Are antithrombin III injections the origin of the contamination? Therapie. 1994. 49:471–2.

4.Parsyan A., Candotti D. Human erythrovirus B19 and blood transfusion-an update. Transfus Med. 2007. 17:263–78.

5.Food And Drug Administration. Guidance for Industry: Nucleic acid testing (NAT) to reduce the possible risk of human parvovirus B19 transmission by plasma-derived products. http://www.fda.gov/BiologicsBloodVaccines/GuidanceComplianceRegulatoryInformation/Guidances/Blood/ucm071592.htm. (Updated on Jul. 2009.

6.Wakamatsu C., Takakura F., Kojima E., Kiriyama Y., Goto N., Matsumoto K, et al. Screening of blood donors for human parvovirus B19 and characterization of the results. Vox Sang. 1999. 76:14–21.

7.Schmidt M., Themann A., Drexler C., Bayer M., Lanzer G., Menichetti E, et al. Blood donor screening for parvovirus B19 in Germany and Austria. Transfusion. 2007. 47:1775–82.

8.Brooker M. Registry of clotting factor concentrate. 8th ed.Quebec: World Federation of Hemophilia;2008. p. 1–16.

9.Lee SO., Hwang JM., Lim JH., Kim Y., Lee JW., Park YRJ, et al. Screening of apheresis platelet donors for human parvovirus B19 by gel card test. Korean J Blood Transfusion. 1999. 10:215–20.

10.Chun LH., Kim TY. Human parvovirus B19 and rheumatoid arthritis in Korea. J Korean Rheum Assoc. 2001. 8:14–9.

11.Servant A., Laperche S., Lallemand F., Marinho V., De Saint Maur G., Meritet JF, et al. Genetic diversity within human erythroviruses: identification of three genotypes. J Virol. 2002. 76:9124–34.

12.Toan NL., Duechting A., Kremsner PG., Song le H., Ebinger M., Aberle S, et al. Phylogenetic analysis of human parvovirus B19, indicating two subgroups of genotype 1 in Vietnamese patients. J Gen Virol. 2006. 87:2941–9.

13.Blümel J., Schmidt I., Effenberger W., Seitz H., Willkommen H., Brackmann HH, et al. Parvovirus B19 transmission by heat-treated clotting factor concentrates. Transfusion. 2002. 42:1473–81.

14.Wu CG., Mason B., Jong J., Erdman D., McKernan L., Oakley M, et al. Parvovirus B19 transmission by a high-purity factor VIII concentrate. Transfusion. 2005. 45:1003–10.

15.Kleinman SH., Glynn SA., Lee TH., Tobler LH., Schlumpf KS., Todd DS. A linked donor-recipient study to evaluate parvovirus B19 transmission by blood component transfusion. Blood. 2009. 114:3677–83.

16.Stramer SL., Kane KL., Beyers ML., Dodd RY. Parvovirus B19 and HAV screening of Whole blood donations. http://www.fda.gov/ohrms/dockets/ac/02/briefing/3913b1.htm. (Updated on Dec. 2002.

17.Kleinman SH., Glynn SA., Lee TH., Tobler L., Montalvo L., Todd D, et al. Prevalence and quantitation of parvovirus B19 DNA levels in blood donors with a sensitive polymerase chain reaction screening assay. Transfusion. 2007. 47:1756–64.

18.Japanese Red Cross. Yuketsujouhou. http://www.jrc.or.jp/vcms_lf/iyakuhin_yuketu081015-04.pdf. (Updated on Nov. 2009.

19.Japanese Red Cross. Yuketsujouhou. http://www.jrc.or.jp/pdf/iyakuhin_news081101-04.pdf. (Updated on Nov. 2009.

Table 1.

Primers used in PCRs and sequencing of human parvovirus B19

Gene	Primer name	Nucleotide sequence (5′-3′)	Location∗ (nucleotides)
NS1/VP1u	e1855f	CACTATGAAAACTGGGCAA	1855-1873
	e2960r	ACAATTCTTCATCTGCTAC	2960-2978
	e1863f	AAACTGGGCAATAAACTACAC	1863-1883
	e2953r	CTTCATCTGCTACCGTCCAA	2953-2972
	n-P5f	CGTGAACTGTTAGTTGGGGTTG	2355-2377
	n-P5r	AATTGCTGATACACAGCTTTAG	2690-2669

^∗ The location refers to the Pvbaua sequence (accession no. M13178) except for primers n-P5f and n- P5r, which refer to the HV sequence (accession no. AF162273).

Abbreviations: f, forward primer; r, reverse primer.

Table 2.

Quantitative PCR results of 10 confirmed human parvovirus B19 positive cases

Concentration of DNA (IU/mL)	Donor ID	Gender	Age	B19V DNA (IU/mL)		Anti-B19V (U/mL∗)
Concentration of DNA (IU/mL)	Donor ID	Gender	Age	Mean	95% CI	IgM	IgG
10¹-10²	Donor1	M	29	2.72×10¹	0.96×10¹-5.23×10¹	Negative	147.34
10²-10³	Donor2	F	28	1.39×10²	0.51×10¹-2.78×10²	38.86	392.83
	Donor3	M	25	4.25×10²	1.15×10²-7.36×10²	Negative	151.54
	Donor4	F	25	4.60×10²	4.06×10²-5.15×10²	27.01	163.72
	Donor5	M	24	8.01×10²	6.55×10²-9.47×10²	83.61	162.81
	Donor6	F	27	8.15×10²	2.15×10¹-1.61×10³	96.04	153.13
10³-10⁴	Donor7	M	42	1.85×10³	1.53×10³-2.17×10³	123.44	156.00
	Donor8	M	31	2.33×10³	1.35×10³-3.31×10³	124.98	140.14
10⁴-10⁵	Donor9	F	24	3.20×10³	2.70×10⁴-3.69×10⁴	128.31	77.36
≥10⁵	Donor10	F	24	1.33×10⁸	1.05×10⁸-1.62×10⁴	Negative	Negative

^∗ U/mL sample >24, positive; U/mL sample <20, negative; 20≤ U/mL sample ≤24, borderline.

Abbreviations: B19V, human parvovirus B19; CI, confidence interval.

Table 3.

Prevalence of human parvovirus B19 antibodies in plasmapheresis donors

Age	N of donors	Only IgG positive		IgG and IgM positive
Age	N of donors	Number	∗	Number	∗
16-19	30	15	50.00	0	0.00
20-29	630	356	56.90	5	0.78
30-39	164	106	64.85	1	0.61
40-49	58	37	64.41	1	1.69
50-59	35	27	77.14	0	0.00
≥60	11	10	90.91	0	0.00
Total	928	551	59.38	7	0.75

^∗ proportion (%) of antibody positively identified within the same age group.

Table 4.

The results of the confirmatory test for the positive donors in both anti-B19V and B19V NAT

Donor ID	Ab	Antigen band reading						Status
Donor ID	Ab	VP-2p	VP-N	VP-1S	VP-2r	VP-C	NS-1	Status
Donor1	IgG	2+	3+	3+	2+		1+	Past infection month to year
Donor2	IgM	2+	3+	3+	2+			Status after infection (weeks to months)
	IgG	2+	3+	3+	3+	1+
Donor3	IgG	2+	3+	3+	1±		1+	Long past infection
Donor4	IgM	±	3+	2+				Status after infection(weeks to months)
	IgG	2+	3+	3+	3+	1+	1+
Donor5	IgM	2+	3+	3+	2+			Status after infection (weeks to months)
	IgG	3+	3+	3+	3+	2+
Donor6	IgM	2+	3+	1+	2+			Status after infection (weeks to months)
	IgG	1+	3+	3+	2+	1±
Donor8	IgM	2+	3+	3+	3+	2+		Acute infection (infection within the last 12 weeks)
	IgG	3+	3+	2+	3+	2+
Donor9	IgM	2+	3+	2+	3+	1+		Status after infection (weeks to months)
	IgG	2+	3+	3+	3+	1+

Abbreviations: B19V, human parvovirus B19; NAT, Nucleic Acid Testing.

Table 5.

B19V DNA and anti-B19V antibodies in retrospective and follow-up specimens

Donor ID	Donation date	B19V DNA con (IU/mL)	Anti-B19V^†
Donor ID	Donation date	B19V DNA con (IU/mL)	IgM (U/mL)	IgG (U/mL)
Donor1	2008-05-04∗	2.72×10¹	Negative	147.34
	2008-08-02		Negative	358.36
	2008-10-23	7.19×10¹	Negative	145.26
Donor2	2007-04-17	Negative	ND	ND
	2007-05-26	Negative	ND	ND
	2007-10-23	Negative	ND	ND
	2007-11-09	Negative	ND	ND
	2007-12-06	Negative	ND	ND
	2007-12-20	Negative	ND	ND
	2008-01-11	7.29×10⁴	160.20	152.45
	2008-03-08	6.36×10¹	88.72	434.46
	2008-04-02	5.34×10¹	52.88	396.47
	2008-04-16∗	1.39×10²	38.86	392.83
	2008-05-05	2.96×10¹	Negative	350.31
	2008-07-14	1.39×10²	Negative	329.31
	2008-09-29	Negative	Negative	162.28
Donor3	2007-12-23	1.13×10²	Negative	159.42
	2008-01-06	1.28×10²	Negative	160.24
	2008-01-27	8.87×10¹	Negative	156.70
	2008-02-17	1.24×10²	Negative	155.36
	2008-03-16∗	4.25×10²	Negative	151.54
	2008-03-30	9.44×10¹	Negative	149.97
	2008-08-17	2.24×10²	Negative	135.26
Donor5	2007-05-18	Negative	ND	ND
	2007-06-01	Negative	ND	ND
	2007-06-15	Negative	ND	ND
	2008-03-06	5.78×10⁴	104.40	161.61
	2008-03-22∗	8.01×10²	83.61	162.81
Donor8	2008-01-15	Negative	ND	ND
	2008-03-15	Negative	ND	ND
	2008-05-19∗	2.33×10³	124.98	140.14
	2008-08-06	7.14×10²	71.84	153.08
	2008-10-29	3.03×10²	Negative	144.47
Donor9	2007-08-12	Negative	ND	ND
	2007-10-06	Negative	ND	ND
	2007-11-10	Negative	ND	ND
	2008-02-02	Negative	ND	ND
	2008-02-24	Negative	ND	ND
	2008-04-10	Negative	ND	ND
	2008-04-27	Negative	ND	ND
	2008-07-15∗	3.20×10⁴	128.31	77.36
Donor10	2007-11-23	Negative	ND	ND
	2008-02-19	Negative	ND	ND
	2008-03-27∗	1.33×10⁸	Negative	Negative
	2008-07-08	2.68×10²	Negative	266.54
	2008-09-24	2.85×10²	Negative	158.66

^∗ index donation;

^† U/mL sample >24, positive; U/mL sample <20, negative; ≥20 U/mL sample <24, borderline.

Abbreviations: B19V, human parvovirus B19; ND, not done.

TOOLS

Similar articles