Association of NQO1 Polymorphism with Multiple Myeloma Risk in Koreans

Seong-Ho Kang; Tae Young Kim; Ho Young Kim; Yun Kyung Lee; Hee Won Moon; Dong Soon Lee; Han Ik Cho

doi:10.3343/kjlm.2006.26.2.71

Journal List > Korean J Lab Med > v.26(2) > 1011366

Go to TopGo to Top Go to BottomGo to Bottom

TOOLS

Kang, Kim, Kim, Lee, Moon, Lee, and Cho: Association of NQO1 Polymorphism with Multiple Myeloma Risk in Koreans

Original Article

Korean J Leg Med 2006;26(2):71-76.

Published online: 10 February 2006

DOI: https://doi.org/10.3343/kjlm.2006.26.2.71

Association of NQO1 Polymorphism with Multiple Myeloma Risk in Koreans

Seong-Ho Kang, M.D.¹, Tae Young Kim², Ho Young Kim², Yun Kyung Lee², Hee Won Moon, M.D.¹, Dong Soon Lee, M.D.^1,², Han Ik Cho, M.D.¹

¹Department of Laboratory Medicine, Seoul National University College of Medicine, Seoul, Korea

²Department of Cancer Research Institue, Seoul National University College of Medicine, Seoul, Korea

Received 14 October 2005 Revised 14 February 2006 Accepted 20 February 2006

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background

NAD(P)H:quinone oxidoreductase 1 (NQO1) is an important enzyme in the metabolism of xenobiotics. NQO1 ⁶⁰⁹C→T (NQO1^*2) has been reported to be associated with reduced enzyme activity, benzene-induced hematotoxicity, and acute leukemia. Incidences of multiple myeloma show interethnic variation and exposure to asbestos, petroleum products, and diesel exhaust is a risk factor for multiple myeloma. We studied the associations of NQO1 polymorphism with multiple myeloma risk, stage, and prognostic factors (hemoglobin, calcium, β₂-microglobulin, M-protein and creatinine).

Methods

The frequency of NQO1 polymorphism was investigated in 117 myeloma patients and 166 controls. NQO1 genetic polymorphism was determined by TaqMan allelic discrimination assay. Prognostic factors were obtained from the patients' medical records.

Results

The frequencies of the NQO1^*1/^*1, ^*1/^*2, and ^*2/^*2 genotypes were 31.6%, 63.2%, and 5.1% in the patients, whereas the respective figures in the controls were 31.9%, 48.3%, and 19,9%. The frequency of NQO1^*2/^*2 was significantly lower in patients than in controls and the odds ratio (OR) was 0.24 (95% confidence interval: 0.01–0.68) to NQO1^*1/^*1 genotype, indicating a decreased risk for multiple myeloma. There were no significant differences in tumor stages and other prognostic factors among NQO1 genotypes.

Conclusions

A risk for multiple myeloma decreased in NQO1^*2/^*2 genotype in Koreans. We report, for the first time, that NQO1 polymorphism is associated with multiple myeloma risk.

Keywords: NAD(P)H:quinone oxidoreductase 1, Multiple myeloma, Single nucleotide polymorphism

References

1. Daniel B. The incidence and epidemiology of plasma cell neoplasms. Stem Cells. 1995; 13(Suppl 2):1–9.

2. Yang SH, Kim TY, Kim BK, Koh YW, Kwak DS, Kim NK, et al. A statistical Study of Multiple Myeloma in Korea. Korean J Hematol. 1995; 30:345–61.

3. Lee WJ, Baris D, Jarvholm B, Silverman DT, Bergdahl IA, Blair A. Multiple myeloma and diesel and other occupational exposures in Swedish construction workers. Int J Cancer. 2003; 107:134–8.

4. Ross D, Kepa JK, Winski SL, Beall HD, Anwar A, Siegel D. NAD(P)H: quinone oxidoreductase 1 (NQO1): chemoprotection, bioactivation, gene regulation and genetic polymorphisms. Chem Biol Interact. 2000; 129:77–97.

5. Hajos AK, Winston GW. Purified NAD(P)H-quinone oxidoreductase enhances the mutagenicity of dinitropyrenes in vitro. J Biochem Toxicol. 1991; 6:277–82.

6. Siegel D, McGuinness SM, Winski SL, Ross D. Genotype-phenotype relationships in studies of a polymorphism in NAD(P)H:quinone oxidoreductase 1. Pharmacogenetics. 1999; 9:113–21.

7. Rothman N, Smith MT, Hayes RB, Traver RD, Hoener B, Campleman S, et al. Benzene poisoning, a risk factor for hematological malignancy, is associated with the NQO1 609C→T mutation and rapid fractional excretion of chlorzoxazone. Cancer Res. 1997; 57:2839–42.

8. Krajinovic M, Sinnett H, Richer C, Labuda D, Sinnett D. Role of NQO1, MPO and CYP2E1 genetic polymorphisms in the susceptibility to childhood acute lymphoblastic leukemia. Int J Cancer. 2002; 97:230–6.

9. Smith MT, Wang Y, Kane E, Rollinson S, Wiemels JL, Roman E, et al. Low NAD(P)H:quinone oxidoreductase 1 activity is associated with increased risk of acute leukemia in adults. Blood. 2001; 97:1422–6.

10. Larson RA, Wang Y, Banerjee M, Wiemels J, Hartford C, Le Beau MM, et al. Prevalence of the inactivating 609C→T polymorphism in the NAD(P)H:quinone oxidoreductase (NQO1) gene in patients with primary and therapy-related myeloid leukemia. Blood. 1999; 94:803–7.

11. Durie BG, Salmon SE. Multiple myeloma, macroglobulinemia, and monoclonal gammopathies. Hoffbrand AV, Brain MC, editors. Recent advances in hematology. Edinberg: Churchill-Livingston;1977. p. 243–56.

12. Shi MM, Myrand SP, Bleavins MR, de la Iglesia FA. High throughput genotyping for the detection of a single nucleotide polymorphism in NAD(P)H quinone oxidoreductase (DT diaphorase) using TaqMan probes. Mol Pathol. 1999; 52:295–9.

13. Durie BG, Salmon SE. A clinical staging system for multiple myeloma. Correlation of measured myeloma cell mass with presenting clinical features, response to treatment, and survival. Cancer. 1975; 36:842–54.

14. Kelsey KT, Ross D, Traver RD, Christiani DC, Zuo ZF, Spitz MR, et al. Ethnic variation in the prevalence of a common NAD(P)H quinone oxidoreductase polymorphism and its implications for anti-cancer chemotherapy. Br J Cancer. 1997; 76:852–4.

15. Chen H, Lum A, Seifried A, Wilkens LR, Le Marchand L. Association of the NAD(P)H:quinone oxidoreductase 609C→T polymorphism with a decreased lung cancer risk. Cancer Res. 1999; 59:3045–8.

16. Menzel HJ, Sarmanova J, Soucek P, Berberich R, Grunewald K, Haun M, et al. Association of NQO1 polymorphism with spontaneous breast cancer in two independent populations. Br J Cancer. 2004; 90:1989–94.

17. Schulz WA, Krummeck A, Rosinger I, Eickelmann P, Neuhaus C, Ebert T, et al. Increased frequency of a null-allele for NAD(P)H: quinone oxidoreductase in patients with urological malignancies. Pharmacogenetics. 1997; 7:235–9.

18. Ross D. Metabolic basis of benzene toxicity. Eur J Haematol Suppl. 1996; 60:111–8.

19. Sonoda T, Nagata Y, Mori M, Ishida T, Imai K. Meta-analysis of multiple myeloma and benzene exposure. J Epidemiol. 2001; 11:249–54.

20. Wong O, Harris F, Rosamilia K, Raabe GK. An updated mortality study of Workers at a petroleum refinery in Beaumont, Texas, 1945 to 1996. J Occup Environ Med. 2001; 43:384–401.

21. Flodin U, Fredriksson M, Persson B. Multiple myeloma and engine exhausts, fresh wood, and creosote: a case-referent study. Am J Ind Med. 1987; 12:519–29.

22. Arlt VM, Stiborova M, Henderson CJ, Osborne MR, Bieler CA, Frei E, et al. Environmental pollutant and potent mutagen 3-nitrobenzanthrone forms DNA adducts after reduction by NAD(P)H:quinone oxidoreductase and conjugation by acetyltransferases and sulfotransferases in human hepatic cytosols. Cancer Res. 2005; 65:2644–52.

Fig. 1.

Detection of NAD(P)H:quinone oxidoreductase 1 (NQO1) polymorphism using TaqMan allelic discrimination. NQO1 genotypes were selected based on the ratio of the FAM and VIC intensity. A, NQO1^*1/^*1; B, NQO1^*1/^*2; C, NQO1^*2/^*2; D, no template control.

Table 1.

Sequence of the oligonucleotides for primers and probes

Oligonucleotide	Sequence (5′ to 3′)
Forward primer	TGCATTTCTGTGGCTTCCAA
Reverse primer	CTGGAGTGTGCCCAATGCTA
NQO1_C probe	VIC-TCTTAGAACCTCAACTGACA^*-TARMA
NQO1_T probe	FAM-TCTTAGAATCTCAACTGACA^*-TARMA

^* Nucloetides in bold and underlined characters are NAD(P)H:quinone oxidoreductase 1 polymorphic sites.

Table 2.

Distribution of subjects by NQO1 genotype and odds ratios for multiple myeloma

	NQO1 genotype			Total	P^*
	^1/^1	^1/^2	^2/^2	Total	P^*
Case (%)	37 (31.6)	74 (63.2)	6 (5.1)	117
Control (%)	53 (31.9)	80 (48.2)	33 (19.9)	166	0.001
OR (95% CI)	1.0	1.33 (0.78–2.24)	0.26 (0.01–0.68)

^* Statistical significance were tested by χ² method.

Abbreviations: NQO1, NAD(P)H:quinone oxidoreductase 1; OR, odds ratio; CI, confidence interval.

Table 3.

Comparison of prognostic factors by NQO1 genotype

	NQO1 genotype			P^*
	^1/^1	^1/^2	^2/^2	P^*
Hemoglobin (g/dL)	10.0±1.9	10.0±2.4	8.8±1.4	NS
Calcium (μmol/L)	2.3±0.3	2.2±0.3	2.5±0.4	NS
β₂-microglobulin (mg/L)	7.1±9.7	6.6±10.0	5.5±3.1	NS
M-protein (g/dL)	3.1±1.9	3.9±2.0	3.3±3.2	NS
Creatinine (μmol/L)	147.7+277.6	166.2±199.8	147.6±149.4	NS

^* Statistical significances were tested by one way analysis of variances among groups.

Abbreviations: NS, not significant; See Table 2.

TOOLS

Similar articles