PDF
ePub
Citation
Print
Abstract
Background
Recently, two G->A polymorphisms at positions −308 and −238, in the promoter of the tumor necrosis factor-α (TNF-α) gene, have been identified. These variants have been linked to estimates of insulin resistance and obesity in different ethnic groups. The objective of the present study was to investigate whether these genetic variants of TNF-α were associated with features of the insulin resistance in two study populations comprising type 2 diabetic patients and healthy control subjects.
Methods
We analyzed the polymorphisms of TNF-α gene in 198 type 2 diabetes mellitus (DM) patients and 169 healthy control subjects. We used five primers and two separate polymerase chain reaction (PCR) to detect the TNF-α polymorphism by the multiplex amplification refractory mutation system (ARMS) technique.
References
1. Kahn CR, Vicent D, Doria A. Genetics of non-insulin-dependent (type-II) diabetes mellitus. Annu Rev Med. 1996; 47:509–31.
2. Rewers M, Hamman RF. Risk factors for non-insulin dependent diabetes mellitus. In: Harris MI, Cowie CC, Stern MP, Boyko EJ, Reider GE, Bennett PH, eds. Diabetes in America, 2nd ed. National Diabetes Data Group. Bethesda: U.S. Government Printing Office; NIH Publication. 1995; 1468:179–220.
3. DeFronzo RA, Ferrannini E. Insulin resistance. A multifaceted syndrome responsible for NIDDM, obesity, hypertension, dyslipidemia, and atherosclerotic cardiovascular disease. Diabetes Care. 1991; 14:173–94.
4. Moller DE, Bjorbaek C, Vidal-Puig A. Candidate genes for insulin resistance. Diabetes Care. 1996; 19:394–400.
5. Hotamisligil GS, Spiegelman BM. TNF-α and the insulin resistance of obesity. LeRoith D, Taylor SI, Olefsky JM, editors. Diabetes Mellitus. Philadelphia: Lippincott-Raven;1996. p. 554–60.
6. Stephens JM, Lee J, Pilch PF. Tumor necrosis factor-α-induced insulin resistance in 3T3-L1 adipocytes is accompanied by a loss of insulin receptor substrate-1 and GLUT4 expression without a loss of insulin-receptor-mediated signal transduction. J Biol Chem. 1997; 272:971–6.
7. Kern PA, Saghizadeh M, Ong JM, Bosch RJ, Deem R, Simsolo RB. The expression of tumor necrosis factor in human adipose tissue. Regulation by obesity, weight loss, and relationship to lipoprotein lipase. J Clin Invest. 1995; 95:2111–9.
8. Moriwaki Y, Yamamoto T, Shibutani Y, Aoki E, Tsutsumi Z, Takahashi S, et al. Elevated levels of interleukin-18 and tumor necrosis factor-alpha in serum of patients with type 2 diabetes mellitus:relationship with diabetic nephropathy. Metabolism. 2003; 52:605–8.
9. Navarro JF, Mora C, Maca M, Garca J. Inflammatory parameters are independently associated with urinary albumin in type 2 diabetes mellitus. Am J Kidney Dis. 2003; 42:53–61.
10. Wilson AG, di Giovine FS, Blakemore AI, Duff GW. Single base polymorphism in the human tumor necrosis factor alpha (TNF alpha) gene detectable by NcoI restriction of PCR product. Hum Mol Genet. 1992; 1:353.
11. Wilson AG, Symons JA, McDowell TL, McDevitt HO, Duff GW. Effects of a polymorphism in the human tumor necrosis factor α promoter on transcriptional activation. Proc Natl Acad Sci USA. 1997; 94:3195–9.
12. Mira JP, Cariou A, Grall F, Delclaux C, Losser MR, Heshmati F, et al. Association of TNF2, a TNF-α promoter polymorphism, with septic shock susceptibility and mortality:a multicenter study. JAMA. 1999; 282:561–8.
13. Rood MJ, van Krugten MV, Zanelli E, van der Linden MW, Keijsers V, Schreuder GM, et al. TNF-308A and HLA-DR3 alleles contribute independently to susceptibility to systemic lupus erythematosus. Arthritis Rheum. 2000; 43:129–34.
14. Hohler T, Kruger A, Gerken G, Schneider PM, Meyer zum Buschenefelde KH, Rittner C. A tumor necrosis factor-alpha (TNF-alpha) promoter polymorphism is associated with chronic hepatitis B infection. Clin Exp Immunol. 1998; 111:579–82.
15. Day CP, Grove J, Daly AK, Stewart MW, Avery PJ, Walker M. Tumour necrosis factor-alpha gene promoter polymorphism and decreased insulin resistance. Diabetologia. 1998; 41:430–4.
16. Grove J, Daly AK, Bassendine MF, Day CP. Association of a tumor necrosis factor promoter polymorphism with susceptibility to alcoholic steatohepatitis. Hepatology. 1997; 26:143–6.
17. Fernandez-Real JM, Gutierrez C, Ricart W, Casamitjana R, Fernandez-Castaner M, Vendrell J, et al. The TNF-alpha gene Nco I polymorphism influences the relationship among insulin resistance, percent body fat, and increased serum leptin levels. Diabetes. 1997; 46:1468–72.
18. Rasmussen SK, Urhammer SA, Jensen JN, Hansen T, Borch-Johnsen K, Pedersen O. The −238 and −308G->A polymorphisms of the tumor necrosis factor-alpha gene promoter are not associated with features of the insulin resistance syndrome or altered birth weight in Danish Caucasians. J Clin Endocrinol Metab. 2000; 85:1731–4.
19. Lee SC, Pu YB, Thomas GN, Lee ZS, Tomlinson B, Cockram CS, et al. Tumor necrosis factor alpha gene G-308A polymorphism in the metabolic syndrome. Metabolism. 2000; 49:1021–4.
20. Hoffstedt J, Eriksson P, Hellstrom L, Rossner S, Ryden M, Arner P. Excessive fat accumulation is associated with the TNF alpha-308 G/A promoter polymorphism in women but not in men. Diabetologia. 2000; 43:117–20.
21. Buffone GJ, Darlington GJ. Isolation of DNA from biological specimens without extraction with phenol. Clin Chem. 1985; 31:164–5.
22. Wenham PR, Newton CR, Price WH. Analysis of apolipoprotein E genotypes by the Amplification Refractory Mutation System. Clin Chem. 1991; 37:241–4.
23. Newton CR, Kalsheker N, Graham A, Powell S, Gammack A, Riley J, et al. Diagnosis of α1-antitrypsin deficiency by enzymatic amplification of human genomic DNA and direct sequencing of polymerase chain reaction products. Nucleic Acids Res. 1988; 16:8233–43.
24. Lee JY, Kim HY, Kim KH, Kim SM, Jang MK, Park JY, et al. Association of polymorphism of IL-10 and TNF-A genes with gastric cancer in Korea. Cancer Lett. 2005; 225:207–14.
25. Yea SS, Yang YI, Jang WH, Lee YJ, Bae HS, Paik KH. Association between TNF-α promoter polymorphism and Helicobacter pylori cagA subtype infection. J Clin Pathol. 2001; 54:703–6.
26. Pae CU, Lee KU, Han H, Serretti A, Jun TY. Tumor necrosis factor alpha gene-G308A polymorphism associated with bipolar I disorder in the Korean population. Psychiatry Res. 2004; 125:65–8.
27. Uysal KT, Wiesbrock SM, Marino MW, Hotamisligil GS. Protection from obesity-induced insulin resistance in mice lacking TNF-α function. Nature. 1997; 389:610–4.
28. Kroeger KM, Carville KS, Abraham LJ. The −308 tumor necrosis factor-alpha promoter polymorphism effects transcription. Mol Im munol. 1997; 34:391–9.
29. D'Alfonso S, Richiardi PM. A polymorphic variation in a putative regulation box of the TNFA promoter region. Immunogenetics. 1994; 39:150–4.
30. Winkler G, Salamon F, Salamon D, Speer G, Simon K, Cseh K. Elevated serum tumour necrosis factor-α levels can contribute to the insulin resistance in type II (non-insulin dependent) diabetes and in obesity. Diabetologia. 1998; 41:860–1.
31. Shiau MY, Wu CY, Huang CN, Hu SW, Lin SJ, Chang YH. TNF-α polymorphisms and type 2 diabetes mellitus in Taiwanese patients. Tissue Antigens. 2003; 61:393–7.
32. Seki N, Kamizono S, Yamada A, Higuchi T, matsumoto H, Niiya F, et al. Polymorphisms in the 5′-flanking region of tumor necrosis factor-alpha gene in patients with rheumatoid arthritis. Tissue Antigens. 1999; 54:194–7.
33. Clausell N, Kalil P, Biolo A, Molossi S, Azevedo M. Increased expression of tumor necrosis factor-alpha in diabetic macrovasculopathy. Cardiovasc Pathol. 1999; 8:145–51.
Table 1.
Primers used for multiplex ARMS
| Primer | Oligonucleotide sequence (5′-3′)* |
|---|---|
| −308G | ACCCTGGAGGCTGAACCCCGTCTC |
| −308A | ACCCTGGAGGCTGAACCCCGTCTT |
| −238G | CACACTCCCCATCCTCCCTGCTTC |
| −238A | CACACTCCCCATCCTCCCTGCTTT |
| CP | GCCCCTCCCAGTTCTAGTTCTATC |
| IPC-1† | CCCACCTTCCCCTCTCTCCAGGCAAATGGG |
| IPC-2† | GGGCCTCAGTCCCAACATGGCTAAGAGGTG |
Table 2.
Genotypes and alleles frequencies of TNF-α −308 and −238 in NIDDM and normal controls
Table 3.
Genotype and allele frequencies of TNF-α-308 with normal controls in Korea
XML Download