Abstract
Background
Real-time polymerase chain reaction (PCR) is generally regarded as a very accurate and time-saving method, but it is expensive to run. We evaluated the reliability of an inexpensive and a researcher-friendly gel electrophoresis-based PCR method for the quantification of mRNA, and the results were compared with those obtained by real-time PCR.
Methods
We compared the results of relative quantification for MMP-1 measured by real-time PCR and by ethidium bromide stained-agarose gel electrophoresis after end-point PCR.
Results
There was significant but very weak correlation between real-time PCR and end-point PCR for relative quantification of MMP-1 (r=0.16, P<0.01).
Conclusions
Our results suggest that the use of the gel electrophoresis-based end-point PCR is inappropriate for quantifying mRNA. Therefore, in order to confirm the result of relative quantification by end-point PCR, the newly established real-time PCR method or northern hybridization should be applied.
References
1. Mullis KB, Faloona FA. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol. 1987; 155:335–50.
2. Parker RM, Barnes NM. mRNA: detection by in situ and northern hybridization. Methods Mol Biol. 1999; 106:247–83.
3. Hod Y. A simplified ribonuclease protection assay. Biotechniques. 1992; 13:852–4.
4. Clarke PA, te Poele R, Wooster R, Workman P. Gene expression microarray analysis in cancer biology, pharmacology, and drug development: progress and potential. Biochem Pharmacol. 2001; 62:1311–36.
5. Bustin SA. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J Mol Endocrinol. 2000; 25:169–93.
6. Wang T, Brown MJ. mRNA quantification by real time TaqMan polymerase chain reaction: validation and comparison with RNase protection. Anal Biochem. 1999; 269:198–201.
7. Holland PM, Abramson RD, Watson R, Gelfand DH. Detection of specific polymerase chain reaction product by utilizing the 5′→ 3′ exonuclease activity of Thermus aquaticus DNA polymerase. Proc Natl Acad Sci USA. 1991; 88:7276–80.
8. Higuchi R, Fockler C, Dollinger G, Watson R. Kinetic PCR analysis: real-time monitoring of DNA amplification reactions. Biotechnology. 1993; 11:1026–30.
9. Ovstebo R, Haug KB, Lande K, Kierulf P. PCR-based calibration curves for studies of quantitative gene expression in human monocytes: development and evaluation. Clin Chem. 2003; 49:425–32.
10. Heid CA, Stevens J, Livak KJ, Williams PM. Real time quantitative PCR. Genome Res. 1996; 6:986–94.
11. Wittwer CT, Herrmann MG, Moss AA, Rasmussen RP. Continuous fluorescence monitoring of rapid cycle DNA amplification. Biotechniques. 1997; 22(130–1):134–8.
12. Schmittgen TD, Zakrajsek BA, Mills AG, Gorn V, Singer MJ, Reed MW. Quantitative reverse transcription-polymerase chain reaction to study mRNA decay: comparison of endpoint and real-time methods. Anal Biochem. 2000; 285:194–204.
13. Heath PJ, Clendenning JB, Fujimoto BS, Schurr JM. Effect of bending strain on the torsion elastic constant of DNA. J Mol Biol. 1996; 260:718–30.
14. Schneeberger C, Speiser P, Kury F, Zeillinger R. Quantitative detection of reverse transcriptase-PCR products by means of a novel and sensitive DNA stain. PCR Method Appl. 1995; 4:234–8.
15. Hall LL, Bicknell GR, Primrose L, Pringle JH, Shaw JA, Furness PN. Reproducibility in the quantification of mRNA levels by RT-PCR-ELISA and RT competitive-PCR-ELISA. BioTechniques. 1998; 24:652–8.
16. Siddiqi AM, Jennings VM, Kidd MR, Actor JK, Hunter RL. Evaluation of electrochemiluminescence- and bioluminescence-based assays for quantitating specific DNA. J Clin Lab Anal. 1996; 10:423–31.
17. Hayward-Lester A, Oefner PJ, Sabatini S, Doris PA. Accurate and absolute quantitative measurement of gene expression by single-tube RT-PCR and HPLC. Genome Res. 1995; 5:494–9.
18. Borson ND, Strausbauch MA, Wettstein PJ, Oda RP, Johnston SL, Landers JP. Direct quantitation of RNA transcripts by competitive single-tube RT-PCR and capillary electrophoresis. Biotechniques. 1998; 25:130–7.
19. Huber R, Kunisch E, Gluck B, Egerer R, Sickinger S, Kinne RW. Comparison of conventional and real-time RT-PCR for the quantitation of jun protooncogene mRNA and analysis of junB mRNA expression in synovial membranes and isolated synovial fibroblasts from rheumatoid arthritis patients. Z Rheumatol. 2003; 62:378–89.
20. Bradford WD, Cahoon L, Freel SR, Hoopes LL, Eckdahl TT. An inexpensive gel electrophoresis-based polymerase chain reaction method for quantifying mRNA levels. Cell Biol Educ. 2005; 4:157–68.
21. Frade JP, Warnock DW, Arthington-Skaggs BA. Rapid quantification of drug resistance gene expression in Candida albicans by reverse transcriptase LightCycler PCR and fluorescent probe hybridization. J Clin Microbiol. 2004; 42:2085–93.
Table 1.
Primers |
Oligonucleotide sequence (5′-3′) | Product size (bp) | |
---|---|---|---|
MMP-1 | Forward | TGGGATTTCCAAAAGAGGTG | 121 |
Reverse | ACGTGGTTCCCTGAGAAGA | ||
GAPDH | Forward | AATGTATCCGTTGTGGATCTGA | 122 |
Reverse | AGCCCAGGATGCCCTTTA |