Journal List > Korean J Lab Med > v.26(3) > 1011309

TOOLS
Yang, Lee, Park, Lee, and Suh: Comparison of In-house Polymerase Chain Reaction Assay with Conventional Techniques for the Detection of Mycobacterium tuberculosis
Original Article

Korean J Leg Med 2006;26(3):174-178.

Published online: 10 February 2006

DOI: https://doi.org/10.3343/kjlm.2006.26.3.174

Comparison of In-house Polymerase Chain Reaction Assay with Conventional Techniques for the Detection of Mycobacterium tuberculosis

Hee Young Yang, M.D., Hee Joo Lee, M.D., Su Yon Park, M.D., Kwang Kil Lee, M.D., Jin Tae Suh, M.D.

Department of Laboratory Medicine, Collage of Medicine, Kyung Hee University, Seoul, Korea

Received 16 February 2006       Revised 4 April 2006       Accepted 6 April 2006

Copyright © 2006 The Korean Society for Legal Medicine

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background

The polymerase chain reaction (PCR) assay, introduced as a fast and sensitive diagnostic method, has been known to be useful in detecting Mycobacterium tuberculosis. Therefore the purpose of this study was to evaluate the usefulness of an in-house PCR assay in the detection of Mycobacterium tuberculosis by comparing PCR results with those of conventional diagnostic techniques.

Methods

We assessed the diagnostic yield of the in-house PCR assay retrospectively based on the patient's medical records using data from previously evaluated specimens submitted for PCR amplification IS6110 sequences by GeneAmp PCR system 9600 (Perkin Elmer, CT, USA). All samples had been examined for detection of M. tuberculosis by acid-fast stain and culture assay and the results from the 3 methods were analyzed.

Results

The majority of cases (1,727 cases, 96.6%) showed concordant results between in-house PCR, AFB stain, and culture methods; only 60 cases (3.4%) displayed discordant results. The sensitivities, specificities and positive and negative predictive values of each method were as follows: 81.0%, 99.6%, 95.0% and 98.4%, respectively for the in-house PCR; 63.4%, 100%, 100% and 96.9%, respectively for AFB staining method; and 83.8%, 100%, 100% and 98.6%, respectively for culture assays.

Conclusions

The PCR assay shows a high sensitivity and specificity and is a reliable test for an early diagnosis of tuberculosis.

Keywords: Mycobacterium tuberculosis, In-house polymerase chain reaction (PCR) assay, Acid-fast stain

References

1. Yeam YS, Jeong OY, Jang SJ, Moon DS, Park YJ. Comparison of culture, Acid-Fast stain and polymerase chain reaction assay for detection of Mycobacterium tuberculosis. Korean J Clin Pathol. 1995; 15:594–603.
2. Kivihya-Ndugga L, van Cleeff M, Juma E, Kimwomi J, Githui W, Oskam L, et al. Comparison of PCR with the routine procedure for diagnosis of Tuberculosis in a population with High prevalences of Tuberculosis and Human Immunodeficiency virus. J Clin Microbiol. 2004; 42:1012–5.
crossref
3. Almeda J, Garcia A, Gonzalez J, Quinto L, Ventura PJ, Vidal R, et al. Clinical evaluation of an in-house IS6110 polymerase chain reaction for diagnosis of tuberculosis. Eur J Clin Microbiol Infect Dis. 2000; 19:859–67.
4. American Thoracic Society. Diagnostic standards and classification of tuberculosis in adults and children. Am J Respir Crit Care Med. 2000; 161:1376–95.
5. Kim JH, Jang SJ, Moon DS, Park YJ. Evaluation of two PCR-hybridization methods for the detection of Mycobacterium tuberculosis. Korean J Lab Med. 2003; 23:32–8.
6. Lee KE, Cho JH, Moon YH. Comparison of stain methods with PCR and culture for the detection of Mycobacterium tuberculosis in the sputum. Korean J Clin Pathol. 1998; 18:201–7.
7. Shin WS. Diagnosis of tuberculosis; Serodiagnosis and Molecular biologic Approach. Tbc and Resp Dis. 1992; 39:1–6.
8. Eing BR, Becker A, Sohns A, Ringelmann R. Comparison of Roche Cobas Amplicor Mycobacterium tuberculosis Assay with In-house PCR and Culture for detection of M. tuberculosis. J Clin Microbiol. 1998; 36:2023–9.
9. Betty AF, Daniel FS, editors. Bailey and Scott's Diagnostic Microbiology. 7th ed.St. Louis: Mosby;2002. p. 552.
10. Bogard M, Vincelette J, Antinozzi R, Alonso R, Fenner T, Schirm J, et al. Multicenter study of a commercial, automated polymerase chain reaction system for the rapid detection of Mycobacterium tuberculosis in Respiratory Specimens in Routine Clinical Practice. Eur J Clin Microbiol Infect Dis. 2001; 20:724–31.
11. Schirm J, Oostendorp LA, Mulder JG. Comparison of Amplicor, In-house PCR, and Conventional Culture for Detection of Mycobacterium tuberculosis in Clinical Samples. J Clin Microbiol. 1995; 33:3221–4.
12. Cohen RA, Muzaffar S, Schwartz D, Bashir S, Luke S, Mcgartland LP, et al. Diagnosis of Pulmonary Tuberculosis Using PCR assays on sputum collected within 24 hours of hospital admission. Am J Respir Crit Care Med. 1998; 157:156–61.
crossref
13. Beige J, Lokies J, Schaberg T, Finckh U, Fischer M, Mauch H, et al. Clinical Evaluation of a Mycobacterium tuberculosis PCR assay. J Clin Microbiol. 1995; 33:90–5.
14. Beavis KG, Lichty MB, Jungkind DL, Giger O. Evaluation of Amplicor PCR for detection of Mycobacterium tuberculosis from sputum specimens. J Clin Microbiol. 1995; 33:2582–6.

Table 1.
Sequences of primers used for the detection of M. tuberculosis by in-house PCR
Name Function Position of IS6110 Sequences (5′ → 3′)
TB1 Primer of first PCR 555–572 CTCAAGGAGCACATCAGC
TB2 Primer of first PCR 1111–1084 TCATAGGAGCTTCCGACC
TB3 Primer of second PCR 590–609 CTACGGTGTTTACGGTGCCC
TB4 Primer of second PCR 874–855 TAGGCGTCGGTGACAAAGGC

Abbreviation: PCR, polymerase chain reaction.

Table 2.
Results of AFB stain, culture and in-house PCR, according to sample origin
Type of sample Total N of samples (%) N of positive samples
In-house PCR AFB stain Culture
Pulmonary specimens 519 (29.0)      
Sputum 420 (23.5) 49 44 56
Brochial aspirate 99 (5.5) 13 10 11
Extrapulmonary specimens 1,268 (71.0)      
Pleural fluid 552 (30.9) 20 13 22
Cerebrospinal fluid 220 (12.3) 1 0 0
Urine 156 (8.7) 10 6 10
Tissue 136 (7.6) 7 6 7
Pus 95 (5.3) 21 11 13
Ascites fluid 31 (1.7) 0 0 0
Blood 29 (1.6) 0 0 0
Gastric aspirate 8 (0.5) 0 0 0
Bone marrow 5 (0.3) 0 0 0
Pericardial fluid 4 (0.2) 0 0 0
Synovial fluid 2 (0.1) 0 0 0
Other 30 (1.7) 0 0 0
Total 1,787 (100.0) 121 90 119

Abbreviations: AFB, acid fast bacilli; PCR, polymerase chain reaction.

Table 3.
Comparison of results of in-house PCR with those of AFB stain and culture
Diagnosis N (%) In-house PCR AFB stain Culture N (%)
Tuberculosis 142 (8.0) + + + 88 (4.9)
  + − + 4 (0.3)
  + − − 23 (1.3)
  − − + 25 (1.4)
  − + + 2 (0.1)
Non tuberculosis 1,645 (92.0) + − − 6 (0.3)
  − − − 1,639 (91.7)

Abbreviations: See Table 2.

Table 4.
Sensitivities, specificities, positive predictabilities, negative predictabilities, true positive, true negative, false positive and false negative of in-house PCR, AFB stain and culture
  Sensitivity (%) Specificity (%) Predictive value (%)
 True positive (%) True negative (%) False positive (%) False negative (%)
positive negative
In-house PCR 81.0 99.6 95.0 98.4 80.9 99.6 0.4 19.1
AFB stain 63.4 100.0 100.0 96.9 63.1 100.0 0.0 36.9
Culture 83.8 100.0 100.0 98.6 83.7 100.0 0.0 16.3

Abbreviations: See Table 2.

Table 5.
Outcome of discordant cases
Group In-house PCR AFB stain Culture N (%) Final Diagnosis (N of cases)
1 + − − 29 (48.3) Tuberculosis (23)
          Pneumonia (2)
          Esophageal cancer (1)
          Bronchitis (1)
          COPD (2)
2 + − + 4 (6.7) Tuberculosis (4)
3 − − + 25 (41.7) Tuberculosis (25)
4 − + + 2 (3.3) Tuberculosis (2)

Abbreviations: See Table 2.

TOOLS
Similar articles