Journal List > J Korean Med Sci > v.39(2) > 1516085825

TOOLS
Park, Kang, Lee, Lee, Park, Oh, Jang, Hwang, Kwon, An, Son, and Jeong: Combination Analysis of PCDHGA12 and CDO1 DNA Methylation in Bronchial Washing Fluid for Lung Cancer Diagnosis
Original Article
Respiratory Diseases & Critical Care Medicine

Journal of Korean Medical Science 2024; 39(2): e28.

Published online: 4 January 2024

DOI: https://doi.org/10.3346/jkms.2024.39.e28

Combination Analysis of PCDHGA12 and CDO1 DNA Methylation in Bronchial Washing Fluid for Lung Cancer Diagnosis

Se Jin Park1, *, Daeun Kang1, *, Minhyeok Lee1, Su Yel Lee2, Young Gyu Park3, TaeJeong Oh4, Seunghyun Jang4, Wan Jin Hwang5, Sun Jung Kwon1, Sungwhan An4, Ji Woong Son1, In Beom Jeong1

1Division of Pulmonology, Department of Internal Medicine, Konyang University Hospital, Daejeon, Korea.

2Myunggok Medical Research Institute, College of Medicine, Konyang University, Daejeon, Korea.

3Department of Oncology, Asan Medical Center, University of Ulsan College of Medicine, Seoul, Korea.

4Genomictree, Inc., Daejeon, Korea.

5Department of Thoracic and Cardiovascular Surgery, Konyang University Hospital, Daejeon, Korea.

Address for Correspondence: Ji Woong Son, MD, PhD. Division of Pulmonology, Department of Internal Medicine, Konyang University Hospital, 158 Gwanjeodong-ro, Seo-gu, Daejeon 35365, Republic of Korea. sk1609@kyuh.ac.kr

Address for Correspondence: In Beom Jeong, MD. Division of Pulmonology, Department of Internal Medicine, Konyang University Hospital, 158 Gwanjeodong-ro, Seo-gu, Daejeon 35365, Republic of Korea. sharpion@kyuh.ac.kr

Equal contributor:

*Se Jin Park and Daeun Kang contributed equally to this work.

Received 20 July 2023       Accepted 25 October 2023

© 2024 The Korean Academy of Medical Sciences.

The Korean Academy of Medical Sciences

https://creativecommons.org/licenses/by-nc/4.0/
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (https://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background

When suspicious lesions are observed on computer-tomography (CT), invasive tests are needed to confirm lung cancer. Compared with other procedures, bronchoscopy has fewer complications. However, the sensitivity of peripheral lesion through bronchoscopy including washing cytology is low. A new test with higher sensitivity through bronchoscopy is needed. In our previous study, DNA methylation of PCDHGA12 in bronchial washing cytology has a diagnostic value for lung cancer. In this study, combination of PCDHGA12 and CDO1 methylation obtained through bronchial washing cytology was evaluated as a diagnostic tool for lung cancer.

Methods

A total of 187 patients who had suspicious lesions in CT were enrolled. PCDHGA12 methylation test, CDO1 methylation test, and cytological examination were performed using 3-plex LTE-qMSP test.

Results

Sixty-two patients were diagnosed with benign diseases and 125 patients were diagnosed with lung cancer. The sensitivity of PCDHGA12 was 74.4% and the specificity of PCDHGA12 was 91.9% respectively. CDO1 methylation test had a sensitivity of 57.6% and a specificity of 96.8%. The combination of both PCDHGA12 methylation test and CDO1 methylation test showed a sensitivity of 77.6% and a specificity of 90.3%. The sensitivity of lung cancer diagnosis was increased by combining both PCDHGA12 and CDO1 methylation tests.

Conclusion

Checking DNA methylation of both PCDHGA12 and CDO1 genes using bronchial washing fluid can reduce the invasive procedure to diagnose lung cancer.

Graphical Abstract

jkms-39-e28-abf001.jpg

Keywords: Lung Cancer, DNA Methylation, PCDHGA12, CDO1, Bronchial Washing Fluid

INTRODUCTION

In order to diagnose lung cancer, we relied on computer-tomography (CT) images. When suspicious lesions are observed on CT, lung cancer is diagnosed through biopsy. According to a previous study, the false positive rate of low dose CT for lung nodule was 94%.1 Although low dose CT is used for lung cancer screening, CT has limitations because the rate of false positive is high. Therefore, biopsy is necessary for diagnosis of lung cancer. Compared with other procedures, bronchoscopy has lower risk for complications.2 However, the sensitivity of peripheral lesion through bronchoscopy including washing cytology is low.3 A new test with higher sensitivity through bronchoscopy is needed.
DNA methylation is an epigenetic mechanism that inactivates cancer suppressor genes and cancer related genes. DNA methylation has been studied as a cancer diagnostic biomarker because it was frequently found in cancer development.4 Recently, DNA methylation is used as a diagnostic tool in various cancers.56 In lung cancer, DNA methylation is used as a marker for diagnosis, treatment, and prediction of prognosis.789 DNA methylation in tissue or body fluid is used recently for diagnosis of lung cancer.9 Many studies have performed diagnosis of lung cancer through DNA methylation in bronchoalveolar lavage fluid (BALF).10
It is known that protocadherin affects tissue development and growth.11 Genes that code for protocadherin can affect the development of various cancers.111213 Hypermethylation of protocadherin gamma subfamily A12 (PCDHGA12) affects various cancers including lung cancer.14 We have found that DNA methylation of PCDHGA12 in bronchial washing cytology has a diagnostic value for lung cancer in a previous study.15 However, its specificity was low although its sensitivity was high.15 Therefore, further study is needed to improve its low specificity.
We used a DNA methylation gene set to make up for the limitation of our previous study and decided to use cysteine dioxygenase type 1 (CDO1). CDO1 is known to affect protein function and antioxidant defense mechanism.16 CDO1 promotor methylation is related to progression and malignancy of various tumors.161718 CDO1 methylation can be used for diagnosis of cancers including lung cancer.192021
We previously reported a highly sensitive and accurate two-step Linear Target Enrichment (LTE)-quantitative methylation specific real-time polymerase chain reaction (PCR) (qMSP) assay (LTE-qMSP) to detect PCDHGA12 methylation using bronchial washing cytology.15 However, this method had limitations, such as the risk of cross-contamination due to the two-step PCR procedure requiring multiple pipetting steps and open-up tubes. In this study, we applied the 3-plex one-step LTE-qMSP assay that uses a single closed-tube reaction to simultaneously detect PCDHGA12 and CDO1 methylation targets DNA. Both PCDHGA12 methylation and CDO1 methylation obtained through bronchial washing cytology were evaluated as a diagnostic tool for lung cancer. Additionally, we analyzed relationships of the combination of PCDHGA12 and CDO1 methylation with clinicopathological parameters including gender, age, cancer location, histology, and staging of lung cancer.

METHODS

Study design

A prospective study was designed to evaluate clinical performance of PCDHGA12 and CDO1 genes for detecting lung cancer using bronchial washing samples. Patients (n = 187) suspected with lung cancer scheduled for bronchoscopy at Konyang University Hospital (Daejeon, Korea) between May 2020 and November 2022 were enrolled. The indications for bronchoscopy of CT images suspected of lung cancer are shown in Table 1. Results of bronchoscopy or histopathology examination were not informed to the personnel involved in the laboratory work. Data analysis of LTE-qMSP results were independently performed to compare bronchoscopy findings and pathology outcomes as reference standards. The outline of this study is illustrated in Fig. 1. Among 217 patients, 12 patients were excluded due to metastatic cancer and 18 patients were excluded due to insufficient samples.
Table 1

Indications for bronchoscopy of CT images suspected of lung cancer

jkms-39-e28-i001
CT findings
Mass (size > 30 mm)
GGO (size > 30 mm)
Cavitary lesion
Consolidation with central necrosis
Non-resolving pneumonia (consolidation, GGO, and mixed consolidation and GGO)
Single solid nodule
a. Size > 8 mm
b. 'Increase size of previously > 6 mm nodule at follow-up CT (until 2 yr)
Multiple solid nodule
a. Size > 8 mm
b. Increase in size of previously > 6 mm nodule at follow-up CT (until 2 yr)
Single subsolid nodule (GGO, partly solid)
a. Size > 6 mm
b. Increase in size of previous 6–30 mm GGO at follow-up CT (until 5 yr)
Multiple subsolid nodule (GGO, partly solid)
a. Size > 6 mm
b. Increase in size of previous 6–30 mm GGO at follow-up CT (until 5 yr)
CT = computer-tomography, GGO = ground-glass opacity.
Fig. 1

Flowchart of the combined analysis of protocadherin gamma subfamily A12 and cysteine dioxygenase type 1 DNA methylation for lung cancer.

LTE-qMSP = Linear Target Enrichment-quantitative methylation specific real-time polymerase chain reaction, LC = lung cancer.
aExcluded due to insufficient specimen quantity; bexcluded due to unclear diagnosis or metastatic cancer.
jkms-39-e28-g001
Clinicopathological and demographical characteristics of patients enrolled in this study are shown in Table 2.
Table 2

Clinical and demographic characteristics of the patients test in this study

jkms-39-e28-i002
Characteristics No. (%)
Non-lung cancer (benign) 62
Gender
Male 30 (48.4)
Female 32 (51.6)
Mean age (range) 66.3 (29.0–88.0)
Lung cancer 125
Gender
Male 100 (80.0)
Female 25 (20.0)
Mean age (range) 70.0 (31.0–93.0)
Pathological stage
Stage I 29
Stage II 12
Stage III 22
Stage IV 62
Histologic type
Squamous 42
Adenocarcinoma 53
NSCLC, other typesa 4
Small-cell lung cancer 26
Location
Central 58
Peripheral 67
NSCLC = non-small-cell lung cancer.
aCarcinoma, mucoepidermoid, neuroendocrine, pleomorphic carcinoma.

Bronchial washing samples, DNA isolation, and bisulfite treatment

Fresh bronchial washing samples (10 mL each) were collected into preservative buffer (Genomictree, Inc., Daejeon, Korea) during bronchoscopy. Samples were kept at −20°C until DNA extraction.
Genomic DNA was isolated using a solid phase magnetic bead-based GT NUCLEIC ACID PREP Kit (Genomictree, Inc.) according to the manufacturer’s instructions. The 20 ng of the genomic DNA was then chemically modified with sodium bisulfite using an EZ DNA Methylation Gold kit (Zymo Research, Irvine, CA, USA) according to the manufacturer’s instructions. Bisulfite-converted DNA was purified and eluted with 18 µL of distilled water using a Zymo-Spin IC column (Zymo Research). Eluted DNA was immediately subjected to methylation analysis.15

Measurement of methylation for target genes in bronchial washing samples by 3-plex LTE-qMSP test

We developed a 3-plex LTE-qMSP test for measuring PCDHGA12 and CDO1 methylation targets and control gene in a single-tube. This test was performed by trained personnel who were unaware of bronchoscopy or histopathology results. A total of 20 ng of genomic DNA was used as an input. A 25 µL reaction mixture contained 5 µL of bisulfite-converted DNA, PCDHGA12 and CDO1 methylation-specific forward primer, PCDHGA12 and CDO1 methylation-specific reverse primer linked to a 5’ universal tag sequence, PCDHGA12 probe (5’-FAM), CDO1 probe (5’-HEX), COL2A1-specific forward and reverse primers, COL2A1 probe (5’-Cy5), universal tag sequence, and 5 µL of 5 x Fast qPCR PreMIX TaqMan Probe (Enzynomics, Inc., Daejeon, Korea). Real-time PCR was performed on an AB7500 FAST Real-Time PCR system (Thermo Fisher Scientific, Waltham, MA, USA). Thermal cycling conditions were as follows: 95°C for 5 minutes; 15 cycles of 95°C for 15 seconds and 70°C for 45 seconds; followed by 35 cycles of 95°C for 15 seconds and 60°C for 45 seconds. Heating and cooling rates were ≥ 4°C per second and ≥ 3.5°C per second, respectively. Primers and probes used for the 3-plex LTE-qMSP test are listed in Table 3.
Table 3

Primer and probe sequences used in the 3-plex Linear Target Enrichment-quantitative methylation specific real-time polymerase chain reaction assay

jkms-39-e28-i003
Gene Primers and probes Sequences, 5′-3′a Concentration, nmol/L
PCDHGA12 Sense CGGTGCGTATAGGTATCGC 200
Anti-sense CTCGCGCGATACTCGAACTAAACAAACG 80
Probe FAM-CGCGTGATGGTTTTGGATGCGAACGAT-BQ1 200
CDO1 Sense GAGAGATTGCGCGGAGTTTAC 200
Anti-sense CGAAAACGAAAAAACCCTACGAACACGACTC 40
Probe HEX-TTTTTGGGAAGGCGCGGAGTTCGGGGAAGT-BQ1 200
COL2A1 Sense TAGGAGTATTAGTAATGTTAGGAGTA 100
Anti-sense CTACCCCAAAAAAACCCAATCC 100
Probe Cy5-AGAAGAAGGGAGGGGTGTTAGGAGAGG 100
Universal sequence tag AAAGATTCGGCGACCACCGA 400
PCDHGA12 = protocadherin gamma subfamily A12, CDO1 = cysteine dioxygenase type 1, COL2A1 = collagen type II alpha 1 chain.
aUnderlines indicated CpG dinucleotide sites.
We performed the 3-plex LTE-qMSP test once for each sample. The relative level of methylated gene in each sample was calculated as 35-△CT [CT of amplified target gene − CT of COL2A1 (human reference gene)].22 Higher values of 35-△CT indicated higher levels of methylation. If the CT of target gene was undetectable, the value was set to 20, the value closest to the lowest 35-△CT for all test results.

Statistical analysis

We calculated receiver operating characteristic (ROC), area under ROC (AUC), and 95% confidence interval (CI) to determine the accuracy, sensitivity, and specificity of diagnosis using the MedCalc software, version 9.3.2.0 (MedCalc Software Ltd., Basel, Belgium). Statistical significance was considered when P value was less than 0.05. To calculate sensitivity and specificity, we categorized test results in a dichotomous manner: methylation-positive as ‘1’ and methylation-negative as ‘0.’ To describe demographic and other clinical characteristics, we used frequency and percentile (%). We also computed negative and positive predictive values.

Ethics statement

All participants in this study provided written informed consent. This study adhered to local ethics guidelines. The study plan was approved by the Institutional Review Board (IRB) of Konyang University Hospital in South Korea (IRB number 2022-03-025).

RESULTS

Clinical and demographic characteristics

A total of 187 patients were enrolled in this study, including 62 patients who were diagnosed with a benign disease and 125 patients who were diagnosed with lung cancer. Benign diseases were confirmed by histological examination through biopsy or improvement of CT lesion after 6 months follow-up. The mean age of patients with a benign disease was 66.3 years and the mean age of patients with lung cancer was 70.0 years. Among 125 lung cancer patients, there were 29 with stage I, 12 with stage II, 22 with stage III, and 62 with stage IV. In lung cancer patients, adenocarcinoma was the most common with 53 cases. Four patients were confirmed to have other types of NSCLC, including carcinoma, mucoepidermoid, neuroendocrine, and pleomorphic carcinoma. There were more peripheral cases than central cases (Table 2).

Diagnostic performance of 3-plex LTE-qMSP test in detecting lung cancer using bronchial washing samples

The 3-plex LTE-qMSP test was performed using DNAs from 187 patients composed of 125 lung cancer patients at various stages (I to IV) and 62 non-lung cancer patients. Results revealed that significantly higher levels of PCDHGA12 and CDO1 methylation were present in DNAs from lung cancer patients than in DNAs from non-lung cancer patients (P < 0.001, Kruskal-Wallis test) (Fig. 2). Optimal cutoff values for PCDHGA12 and CDO1 were determined to be 30.5 and 28.5 of 35-△CT for detecting lung cancer, respectively (Fig. 3). For PCDHGA12, its sensitivity and specificity were 74.4% (93/125, 95% CI, 65.8–81.8%) and 91.9% (57/62, 95% CI, 82.2–97.3%), respectively, with an AUC of 0.832 (95% CI, 0.770–0.882, P < 0.001). For CDO1, its sensitivity and specificity were 57.6% (72/125, 95% CI, 48.4–66.4%) and 96.8% (60/62, 95% CI, 88.8–99.6%), respectively, with an AUC of 0.772 (95% CI, 0.705–0.830, P < 0.001). The combination of both genes revealed a sensitivity of 77.6% (97/125 95% CI, 69.3–84.6%) and a specificity of 90.3% (56/62, 95% CI, 80.1–96.4%), with an AUC of 0.840 (95% CI, 0.779–0.889) (Table 4). Cytology achieved a sensitivity of 39.2% (49/125 95% CI, 30.6–48.3%) and a specificity of 100% (62/62, 95% CI, 94.2–100%), with an AUC of 0.696 (95% CI, 0.625–0.761) (Table 4). Combining the two methylation genes and cytology for detecting lung cancer showed an overall sensitivity of 80.8% (101/125, 95% CI, 72.8–87.3%) and a specificity of 90.3% (56/62, 95% CI, 80.1–96.4%), with an AUC of 0.856 (95% CI, 0.797–0.903) (Table 4).
Fig. 2

The DNA methylation level of PCDHGA12 gene (A) and CDO1 (B) in lung cancer patients and non-LC patients.

PCDHGA12 = protocadherin gamma subfamily A12, CDO1 = cysteine dioxygenase type 1, LC = lung cancer.
jkms-39-e28-g002
Fig. 3

Receiver operating characteristic curve for PCDHGA12 gene (A) and CDO1 (B) for diagnosing lung cancer in bronchial washing fluids.

PCDHGA12 = protocadherin gamma subfamily A12, CDO1 = cysteine dioxygenase type 1, AUC = area under receiver operating characteristic.
jkms-39-e28-g003
Table 4

Clinical performance of the methylation test and cytology for detecting lung cancer

jkms-39-e28-i004
Test Cut-off (35-ΔCT) Sensitivity Specificity PPV NPV
Methylation
PCDHGA12 30.5 74.4 (65.8–81.8) 91.9 (82.2–97.3) 94.9 (88.9–97.7) 64.0 (56.7–70.8)
CDO1 28.5 57.6 (48.4–66.4) 96.8 (88.8–99.6) 97.3 (90.1–99.3) 53.1 (47.9–58.3)
Cytology 39.2 (30.6–48.3) 100.0 (94.2–100) 100.0 44.9 (41.5–48.4)
Combined
PCDHGA12 or CDO1 77.6 (69.3–84.6) 90.3 (80.1–96.4) 94.2 (88.3–97.2) 66.7 (58.8–73.7)
PCDHGA12 or cytology 77.6 (69.3–84.6) 91.9 (82.2–97.3) 95.1 (89.3–97.8) 67.1 (59.3–74.0)
CDO1 or cytology 64.0 (54.9–72.4) 96.8 (88.8–99.6) 97.6 (91.0–99.4) 57.1 (51.2–62.9)
PCDHGA12 or CDO1 or cytology 80.0 (71.9–86.6) 90.3 (80.1–96.4) 94.3 (88.6–97.3) 69.1 (61.0–76.3)
Values are presented as % (95% confidence interval).
PCDHGA12 = protocadherin gamma subfamily A12, CDO1 = cysteine dioxygenase type 1, PPV = positive predictive value, NPV = negative predictive value.

Subgroup analysis of methylation test and cytology for lung cancer

Results of subgroup analysis for lung cancer patients are shown in Table 5. Compared with PCDHGA12 methylation test, combined test for methylation of both genes showed a higher sensitivity in males (81.0%), those with age ≥ 65 years (81.3%), those with a central location (94.7%), those with SCLC (90.9%), and those with stages III–IV (88.0%). Combining methylation of both genes and cytology had a significant diagnostic value for central lung cancer (sensitivity 94.7%, P < 0.001) and stage III–IV lung cancer (sensitivity 91.6%, P < 0.001). In all subgroup analyses, the sensitivity was higher when combining methylation tests for both genes than PCDHGA12 or CDO1 methylation test alone and cytology alone. Table 6 shows results according to the location of lung suspicious lesion. There was no significant difference in DNA methylation according to the location of suspicious lesion. In this study, there were 10 patients who underwent surgery without biopsy for histological confirmation, of which 8 were diagnosed with cancer and the other 2 had a non-cancerous disease.
Table 5

The relationship between clinicopathological parameters, methylation and cytology in bronchial aspirate samples from 125 lung cancer patients

jkms-39-e28-i005
Parameters No. of samples tested Sensitivity % (95% CI)
Methylationa P valueb Cytology P valueb Methylation or cytology P valueb
Gender 0.105 0.821 0.047
Male 100 81.0 (71.9–88.2) 40.0 (30.3–50.3) 84.0 (75.3–90.6)
Female 25 64.0 (42.5–82.0) 36.0 (18.0–57.5) 64.0 (42.5–82.0)
Age, yr 0.147 0.412 0.133
< 65 34 67.6 (49.4–82.6) 32.4 (17.4–50.6) 70.6 (52.5–84.9)
≥ 65 91 81.3 (71.8–88.7) 41.8 (31.5–52.6) 83.5 (74.3–90.5)
Cancer location < 0.001 0.006 < 0.001
Central 57 94.7 (85.3–98.9) 52.6 (38.9–66.0) 94.7 (85.3–98.9)
Peripheral 68 63.2 (50.6–74.6) 27.9 (17.7–40.1) 67.6 (55.2–78.5)
Histology 0.157 1.000 0.241
SCLC 22 90.9 (70.8–98.9) 36.4 (17.2–59.4) 90.9 (70.8–98.9)
NSCLC 103 74.8 (65.3–82.8) 35.9 (26.7–46.0) 77.7 (68.4–85.3)
Stage < 0.001 < 0.001 < 0.001
I–II 42 57.1 (40.9–72.2) 16.7 (7.0–31.4) 57.1 (40.9–72.2)
III–IV 83 88.0 (79.0–94.1) 50.6 (39.4–61.8) 91.6 (83.4–96.6)
CI = confidence interval, SCLC = small-cell lung cancer, NSCLC = non-small cell lung cancer.
aProtocadherin gamma subfamily A12 or cysteine dioxygenase type 1.
bP value was calculated by Fisher’s exact test.
Table 6

The relationship between mass location, methylation and cytology in bronchial aspirate samples from 125 lung cancer patients

jkms-39-e28-i006
Parameters No. of samples tested Sensitivity % (95% CI)
Methylationa P valueb Cytology P valueb Methylation or cytology P valueb
Mass location 0.218 0.816 0.326
RUL 37 78.4 (61.8–90.2) 43.2 (27.1–60.5) 78.4 (61.8–90.2)
RML 6 66.7 (22.3–95.7) 33.3 (4.3–77.7) 66.7 (22.3–95.7)
RLL 37 64.9 (47.5–79.8) 40.5 (24.7–57.9) 70.3 (53.1–84.2)
LUL 23 82.6 (61.2–95.0) 43.5 (23.2–65.5) 87.0 (66.5–97.2)
LLL 19 94.7 (73.9–99.9) 31.6 (12.6–56.6) 94.7 (73.9–99.9)
RML-RLL & LUL 1 100.0 (2.5–100.0) 0 (0–97.5) 100.0 (2.5–100.0)
Unknown 2 100 (15.8–100.0) 0 (0–84.2) 100.0 (15.8–100.0)
CI = confidence interval, RUL = right upper lobe, RML = right middle lobe, RLL = right lower lobe, LUL = left upper lobe, LLL = left lower lobe.
aProtocadherin gamma subfamily A12 or cysteine dioxygenase type 1.
bP value was calculated by Chi-squared test.

DISCUSSION

In our previous study, PCDHGA12 methylation for diagnosing lung cancer had a sensitivity of 75.0%, a specificity of 78.9%, a positive predictive value of 84.9%, and a negative predictive value of 66.7%.15 Compared with our previous study, the sensitivity and specificity were increased by combining methylation of both genes in the present study. The positive predictive value of combining methylation of both PCDHGA12 and CDO1 was also superior to that of the previous PCDHGA12 methylation test, although the negative predictive value of combining methylation of both PCDHGA12 and CDO1 was not inferior to that of the PCDHGA12 methylation test in the previous study. Additionally, when methylation of both genes was combined with cytology, sensitivity, specificity, positive predictive value, and negative predictive value all showed better results. According to previous studies on DNA methylation and lung cancer diagnosis, sensitivity was increased by adding different types of methylation markers compared to lung cancer diagnosis through a single DNA methylation marker.102324 In the present study, the sensitivity was increased by combining methylation of PCDHGA12 and CDO1 compared with our previous study.15
In this study, we improved the specificity of the methylation test as compared to our previous study. In the previous study, we used a two-step LTE-qMSP method to measure methylation in bronchial washing samples. However, this method involves open tubes and multiple pipetting steps, which increases the risk of cross-contamination and prolonged assay time. To overcome these limitations, we employed a one-step LTE-qMSP assay using a single closed-tube reaction to simultaneously detect multiple methylated targets of DNA.25 This method has several advantages such as low false-positive and negative rates and minimal risk of PCR contamination.
Lung cancer is diagnosed through low dose CT and biopsy. As mentioned earlier, low dose CT has high false positive rate and biopsy has many complications.1 Biopsy through bronchoscopy is difficult to find the exact bronchus that has lesion.26 Recently, many studies are being conducted to diagnose lung cancer with non-invasive tests such as liquid biopsy to minimize complication through invasive test including bronchoscopy biopsy and surgical biopsy.2728 A liquid biopsy is a test for confirming substances present in blood or bodily secretion. Through liquid biopsy, lung cancer can be diagnosed by confirming circulating tumor cells, circulating tumor DNA, exosome, and microRNA in blood or bodily fluids including bronchial washing cytology.27 However, bronchial washing cytology has limitation in screening or diagnosis for lung cancer due to its low sensitivity.29 Therefore, finding a new tumor marker that can suggest lung cancer with a high sensitivity is needed to reduce invasive tests and supplement the false positive rate of a low-dose CT.
Previous studies on bronchoscopy have used BALF.103031 BALF analysis is invasive. It can induce several complications to patients including respiratory failure, bronchospasm.32 To diagnose lung cancer, percutaneous transthoracic needle aspiration biopsy can also induce complications including pneumothorax and air embolism.3334 In this study, we used simple bronchial washing fluid. It is less invasive than other procedures with complications. If data on DNA methylation tests through bronchial washing fluid are accumulated, invasive tests such as BALF analysis and percutaneous transthoracic needle aspiration biopsy for lung cancer diagnosis can be reduced. Through reducing the invasive tests, there are some advantages including lesser costs, shorter hospital days and lesser complications.35
Recent studies have tried to diagnose lung cancer through DNA methylation.789 In our previous study, we found that methylation of PCDHGA12 had a diagnostic value of lung cancer.15 Compared with our previous study, the sensitivity was increased by combining methylation of CDO1 and the specificity was increased by changing technological method. According to this study, it was found that diagnosis through bronchial washing cytology and both gene methylation can be helpful in increasing the diagnosis rate of lung cancer.
This study has several limitations. The small sample size was the first limitation. A total of 187 patients were enrolled. Statistical limitations could not be ruled out due to the small sample size. In subgroup analysis, some subgroups including male, central location lung cancer, and stage III–IV lung cancer has a significant diagnostic sensitivity. However, other groups dividing by age or histology did not show any significant difference in sensitivity. Further study is needed to overcome the limitation of subgroup analysis in this study. To increase the diagnostic value of lung cancer through DNA methylation, it is important to find optimal combination of DNA methylation. This study did not combine with methylation of other DNAs known to be associated with lung cancer including SOX17, TAC1, HOXA7, and RASSF1A.10363738 Lastly, in this study, a statistically significant increase in sensitivity was shown as the stage of the patients in the subgroup progressed, with 57.1% in stages I and II compared to 88% in stage III and IV of lung cancer. The sensitivity of this study increases as the stage progresses, however patients with advanced lung cancer require biopsy for chemotherapy rather than surgery. Hence, the DNA methylation method will be more beneficial for screening rather than having a significant impact on diagnosis and treatment.
In conclusion, the sensitivity for lung cancer diagnosis was increased after combining results of both PCDHGA12 and CDO1 methylation tests. Therefore, checking DNA methylation of both genes using bronchial washing fluid can reduce invasive procedure for diagnosing lung cancer.

Notes

Funding: This research was funded by a grant (NRF-2021R1F1A1062553) of the National Research Foundation of Korea funded by the Korean Government.

Disclosure: The authors have no potential conflicts of interest do disclose.

Author Contributions:

  • Conceptualization: Park SJ, Kang D, Lee M, Kwon SJ, Son JW, Jeong IB.

  • Data curation: Park SJ, Kang D, Park YG, Hwang WJ, Son JW, Jeong IB.

  • Formal analysis: Lee M, Lee SY, Oh T, Jang S, An S.

  • Investigation: Kang D, Lee M, Lee SY, Park YG, Hwang WJ, Jeong IB.

  • Funding acquisition: Son JW.

  • Methodology: Park SJ, Lee M, Lee SY, Park YG, Oh T, Jang S, Hwang WJ, An S.

  • Project administration: Son JW, Jeong IB.

  • Resources: Oh T, Jang S, An S.

  • Visualization: Oh T, Jang S, An S.

  • Writing - original draft: Park SJ, Kang D.

  • Writing - review & editing: Park SJ, Kang D, Kwon SJ, Son JW, Jeong IB.

References

1. National Lung Screening Trial Research Team. Aberle DR, Adams AM, Berg CD, Black WC, Clapp JD, et al. Reduced lung-cancer mortality with low-dose computed tomographic screening. N Engl J Med. 2011; 365(5):395–409. PMID: 21714641.
2. Tukey MH, Wiener RS. Population-based estimates of transbronchial lung biopsy utilization and complications. Respir Med. 2012; 106(11):1559–1565. PMID: 22938740.
3. Detterbeck FC, Lewis SZ, Diekemper R, Addrizzo-Harris D, Alberts WM. Executive summary: diagnosis and management of lung cancer, 3rd ed: American College of Chest Physicians evidence-based clinical practice guidelines. Chest. 2013; 143(5 ):Suppl. 7S–37S. PMID: 23649434.
4. Kulis M, Esteller M. DNA methylation and cancer. Adv Genet. 2010; 70:27–56. PMID: 20920744.
5. Kandimalla R, van Tilborg AA, Zwarthoff EC. DNA methylation-based biomarkers in bladder cancer. Nat Rev Urol. 2013; 10(6):327–335. PMID: 23628807.
6. Wang Y, Zhang M, Hu X, Qin W, Wu H, Wei M. Colon cancer-specific diagnostic and prognostic biomarkers based on genome-wide abnormal DNA methylation. Aging (Albany NY). 2020; 12(22):22626–22655. PMID: 33202377.
7. Darılmaz Yüce G, Ortaç Ersoy E. Lung cancer and epigenetic modifications. Tuberk Toraks. 2016; 64(2):163–170. PMID: 27481083.
8. Langevin SM, Kratzke RA, Kelsey KT. Epigenetics of lung cancer. Transl Res. 2015; 165(1):74–90. PMID: 24686037.
9. Mehta A, Dobersch S, Romero-Olmedo AJ, Barreto G. Epigenetics in lung cancer diagnosis and therapy. Cancer Metastasis Rev. 2015; 34(2):229–241. PMID: 25939322.
10. Zhang C, Yu W, Wang L, Zhao M, Guo Q, Lv S, et al. DNA methylation analysis of the SHOX2 and RASSF1A panel in bronchoalveolar lavage fluid for lung cancer diagnosis. J Cancer. 2017; 8(17):3585–3591. PMID: 29151944.
11. Dang Z, Shangguan J, Zhang C, Hu P, Ren Y, Lv Z, et al. Loss of protocadherin-17 (PCDH-17) promotes metastasis and invasion through hyperactivation of EGFR/MEK/ERK signaling pathway in hepatocellular carcinoma. Tumour Biol. 2016; 37(2):2527–2535. PMID: 26386721.
12. Chen T, Long B, Ren G, Xiang T, Li L, Wang Z, et al. Protocadherin20 acts as a tumor suppressor gene: epigenetic inactivation in nasopharyngeal carcinoma. J Cell Biochem. 2015; 116(8):1766–1775. PMID: 25736877.
13. Taylor KH, Pena-Hernandez KE, Davis JW, Arthur GL, Duff DJ, Shi H, et al. Large-scale CpG methylation analysis identifies novel candidate genes and reveals methylation hotspots in acute lymphoblastic leukemia. Cancer Res. 2007; 67(6):2617–2625. PMID: 17363581.
14. Lu Y, Lemon W, Liu PY, Yi Y, Morrison C, Yang P, et al. A gene expression signature predicts survival of patients with stage I non-small cell lung cancer. PLoS Med. 2006; 3(12):e467. PMID: 17194181.
15. Jeong IB, Yoon YS, Park SY, Cha EJ, Na MJ, Kwon SJ, et al. PCDHGA12 methylation biomarker in bronchial washing specimens as an adjunctive diagnostic tool to bronchoscopy in lung cancer. Oncol Lett. 2018; 16(1):1039–1045. PMID: 29963180.
16. Brait M, Ling S, Nagpal JK, Chang X, Park HL, Lee J, et al. Cysteine dioxygenase 1 is a tumor suppressor gene silenced by promoter methylation in multiple human cancers. PLoS One. 2012; 7(9):e44951. PMID: 23028699.
17. Harada H, Hosoda K, Moriya H, Mieno H, Ema A, Ushiku H, et al. Cancer-specific promoter DNA methylation of cysteine dioxygenase type 1 (CDO1) gene as an important prognostic biomarker of gastric cancer. PLoS One. 2019; 14(4):e0214872. PMID: 30934021.
18. Meller S, Zipfel L, Gevensleben H, Dietrich J, Ellinger J, Majores M, et al. CDO1 promoter methylation is associated with gene silencing and is a prognostic biomarker for biochemical recurrence-free survival in prostate cancer patients. Epigenetics. 2016; 11(12):871–880. PMID: 27689475.
19. Nishizawa N, Harada H, Kumamoto Y, Kaizu T, Katoh H, Tajima H, et al. Diagnostic potential of hypermethylation of the cysteine dioxygenase 1 gene (CDO1) promoter DNA in pancreatic cancer. Cancer Sci. 2019; 110(9):2846–2855. PMID: 31325200.
20. Ushiku H, Yamashita K, Ema A, Minatani N, Kikuchi M, Kojo K, et al. DNA diagnosis of peritoneal fluid cytology test by CDO1 promoter DNA hypermethylation in gastric cancer. Gastric Cancer. 2017; 20(5):784–792. PMID: 28243814.
21. Wang P, Zhao H, Shi R, Liu X, Liu J, Ren F, et al. The role of plasma CDO1 methylation in the early diagnosis of lung cancer. Zhongguo Fei Ai Za Zhi. 2020; 23(5):314–320. PMID: 32317090.
22. Chung W, Bondaruk J, Jelinek J, Lotan Y, Liang S, Czerniak B, et al. Detection of bladder cancer using novel DNA methylation biomarkers in urine sediments. Cancer Epidemiol Biomarkers Prev. 2011; 20(7):1483–1491. PMID: 21586619.
23. Kneip C, Schmidt B, Seegebarth A, Weickmann S, Fleischhacker M, Liebenberg V, et al. SHOX2 DNA methylation is a biomarker for the diagnosis of lung cancer in plasma. J Thorac Oncol. 2011; 6(10):1632–1638. PMID: 21694641.
24. Zhai X, Li SJ. Methylation of RASSF1A and CDH13 genes in individualized chemotherapy for patients with non-small cell lung cancer. Asian Pac J Cancer Prev. 2014; 15(12):4925–4928. PMID: 24998565.
25. An S, Oh T. Method for multiplex detection of methylated DNA. United States patent US11186866B2. Updated 2021. Accessed November 30, 2021. https://patents.google.com/patent/US11186866B2/en .
26. Funahashi A, Browne TK, Houser WC, Hranicka LJ. Diagnostic value of bronchial aspirate and postbronchoscopic sputum in fiberoptic bronchoscopy. Chest. 1979; 76(5):514–517. PMID: 498821.
27. Li W, Liu JB, Hou LK, Yu F, Zhang J, Wu W, et al. Liquid biopsy in lung cancer: significance in diagnostics, prediction, and treatment monitoring. Mol Cancer. 2022; 21(1):25. PMID: 35057806.
28. Rolfo C, Mack P, Scagliotti GV, Aggarwal C, Arcila ME, Barlesi F, et al. Liquid biopsy for advanced NSCLC: a consensus statement from the International Association for the Study of Lung Cancer. J Thorac Oncol. 2021; 16(10):1647–1662. PMID: 34246791.
29. Girard P, Caliandro R, Seguin-Givelet A, Lenoir S, Gossot D, Validire P, et al. Sensitivity of cytology specimens from bronchial aspirate or washing during bronchoscopy in the diagnosis of lung malignancies: an update. Clin Lung Cancer. 2017; 18(5):512–518. PMID: 28007409.
30. Villalba M, Exposito F, Pajares MJ, Sainz C, Redrado M, Remirez A, et al. TMPRSS4: a novel tumor prognostic indicator for the stratification of stage IA tumors and a liquid biopsy biomarker for NSCLC patients. J Clin Med. 2019; 8(12):2134. PMID: 31817025.
31. Topaloglu O, Hoque MO, Tokumaru Y, Lee J, Ratovitski E, Sidransky D, et al. Detection of promoter hypermethylation of multiple genes in the tumor and bronchoalveolar lavage of patients with lung cancer. Clin Cancer Res. 2004; 10(7):2284–2288. PMID: 15073103.
32. Schnabel RM, van der Velden K, Osinski A, Rohde G, Roekaerts PM, Bergmans DC. Clinical course and complications following diagnostic bronchoalveolar lavage in critically ill mechanically ventilated patients. BMC Pulm Med. 2015; 15(1):107. PMID: 26420333.
33. Zhang H, Wang S, Zhong F, Liao M. Risk factors for air embolism following computed tomography-guided percutaneous transthoracic needle biopsy: a systematic review and meta-analysis. Diagn Interv Radiol. 2023; 29(3):478–491. PMID: 36994842.
34. Polat G, Özdemir Ö, Serçe Unat D, Karadeniz G, Ayrancı A, Unat OS, et al. Pneumothoraxes after CT-guided percutaneous transthoracic needle aspiration biopsy of the lung: a single-center experience with 3426 patients. Tuberk Toraks. 2023; 71(1):67–74. PMID: 36912411.
35. Na KJ, Park IK, Park S, Kang CH, Kim YT. Efficacy and cost-effectiveness of surgical biopsy for histologic diagnosis of indeterminate nodules suspected for early stage lung cancer: comparison with percutaneous needle biopsy. J Korean Med Sci. 2020; 35(28):e261. PMID: 32686374.
36. Ji XY, Li H, Chen HH, Lin J. Diagnostic performance of RASSF1A and SHOX2 methylation combined with EGFR mutations for differentiation between small pulmonary nodules. J Cancer Res Clin Oncol. 2023; 149(11):8557–8571. PMID: 37097393.
37. Hulbert A, Jusue-Torres I, Stark A, Chen C, Rodgers K, Lee B, et al. Early detection of lung cancer using DNA promoter hypermethylation in plasma and sputum. Clin Cancer Res. 2017; 23(8):1998–2005. PMID: 27729459.
38. Marmor HN, Zorn JT, Deppen SA, Massion PP, Grogan EL. Biomarkers in lung cancer screening: a narrative review. Curr Chall Thorac Surg. 2023; 5:5. PMID: 37016707.
TOOLS
Similar articles