Detection of Isoniazid and Rifampicin Resistance by Sequencing of katG, inhA, and rpoB Genes in Korea

Eun Hae Cho; Hye Kyung Bae; Seong Ki Kang; Eun Hee Lee

doi:10.3343/kjlm.2009.29.5.455

Journal List > Korean J Lab Med > v.29(5) > 1011581

Go to TopGo to Top Go to BottomGo to Bottom

TOOLS

Cho, Bae, Kang, and Lee: Detection of Isoniazid and Rifampicin Resistance by Sequencing of katG, inhA, and rpoB Genes in Korea

Original Article

Korean J Leg Med 2009;29(5):455-460.

Published online: 14 January 2009

DOI: https://doi.org/10.3343/kjlm.2009.29.5.455

Detection of Isoniazid and Rifampicin Resistance by Sequencing of katG, inhA, and rpoB Genes in Korea

Eun Hae Cho, M.D., Hye Kyung Bae, M.D., Seong Ki Kang, M.S., Eun Hee Lee, M.D.

Greencross Reference Laboratory, Yongin, Korea

Corresponding author: Eun Hae Cho, M.D. Greencross Reference Laboratory, 314 Bojeong-dong, Giheung-gu, Yongin 449-913, Korea Tel: +82-31-260-9216, Fax: +82-31-260-9638 E-mail: ehcho@mail.gcrl.co.kr

Revised 15 April 200919 July 2009 Accepted 2 September 2009

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background:

In Korea, tuberculosis is resistant to isoniazid (INH) and/or rifampicin (RIF) in more than 10% of cases. To prevent the spread of resistant Mycobacterium tuberculosis strains, it is crucial to develop more rapid resistance detection methods.

Methods:

To determine the feasibility of using direct sequencing for detecting INH- and RIF-resistant strains, the katG gene, the regulatory region of the inhA gene, and the 81-bp hot-spot region of the rpoB gene from 95 culture isolates and 46 respiratory specimens were sequenced. Total 141 culture isolates were classified by conventional drug susceptibility testing (DST) as INH^R/RIF^R (N=30), INH^R/RIF^S (N=23), INH^S/RIF^R (N=15), and INH^S/RIF^S (N=73).

Results:

Compared with phenotypic DST, the overall sensitivity and specificity of sequencing were 83.0% (44/53) and 96.6% (85/88), respectively, for INH resistance, and 93.3% (42/45) and 100% (96/96), respectively, for RIF resistance. The rates were similar between culture isolates and respiratory specimens. Interestingly, three specimens with inhA −15C>T mutation were susceptible to INH by conventional DST.

Conclusions:

Detection of mutations in the katG codon 315, the inhA regulatory region, and the hot-spot region of rpoB would be useful for rapid detection of INH and RIF resistance in Korea.

Keywords: Mycobacterium tuberculosis, inhA, katG, rpoB

REFERENCES

1.Espinal MA., Kim SJ., Suarez PG., Kam KM., Khomenko AG., Migliori GB, et al. Standard short-course chemotherapy for drug-resistant tuberculosis: treatment outcomes in 6 countries. JAMA. 2000. 283:2537–45.

2.Bai GH., Park YK., Choi YW., Bai HJ., Kim HJ., Chang CL, et al. Trend of anti-tuberculosis drug resistance in Korea, 1994-2004. Int J Tuberc Lung Dis. 2007. 11:571–6.

3.Bartfai Z., Somoskovi A., Kodmon C., Szabo N., Puskas E., Kosztolanyi L, et al. Molecular characterization of rifampin-resistant isolates of Mycobacterium tuberculosis from Hungary by DNA sequencing and the line probe assay. J Clin Microbiol. 2001. 39:3736–9.

4.Musser JM., Kapur V., Williams DL., Kreiswirth BN., van Soolingen D., van Embden JD. Characterization of the catalase-peroxidase gene (katG) and inhA locus in isoniazid-resistant and -susceptible strains of Mycobacterium tuberculosis by automated DNA sequencing: restricted array of mutations associated with drug resistance. J Infect Dis. 1996. 173:196–202.

5.Telenti A., Imboden P., Marchesi F., Lowrie D., Cole S., Colston MJ, et al. Detection of rifampicin-resistance mutations in Mycobacterium tuberculosis. Lancet. 1993. 341:647–50.

6.Cooksey RC., Morlock GP., Glickman S., Crawford JT. Evaluation of a line probe assay kit for characterization of rpoB mutations in rifampin-resistant Mycobacterium tuberculosis isolates from New York City. J Clin Microbiol. 1997. 35:1281–3.

7.Hillemann D., Rusch-Gerdes S., Richter E. Evaluation of the GenoType MTBDRplus assay for rifampin and isoniazid susceptibility testing of Mycobacterium tuberculosis strains and clinical specimens. J Clin Microbiol. 2007. 45:2635–40.

8.Lee H., Cho SN., Bang HE., Lee JH., Bae GH., Kim SJ, et al. Molecular analysis of rifampin-resistant Mycobacterium tuberculosis isolated from Korea by polymerase chain reaction-single strand conformation polymorphism sequence analysis. Int J Tuberc Lung Dis. 1998. 2:585–9.

9.Park H., Song EJ., Song ES., Lee EY., Kim CM., Jeong SH, et al. Comparison of a conventional antimicrobial susceptibility assay to an oligonucleotide chip system for detection of drug resistance in Mycobacterium tuberculosis isolates. J Clin Microbiol. 2006. 44:1619–24.

10.Coll P., Aragón LM., Alcaide F., Espasa M., Garrigó M., González J, et al. Molecular analysis of isoniazid and rifampin resistance in Mycobacterium tuberculosis isolates recovered from Barcelona. Microb Drug Resist. 2005. 11:107–14.

11.Kim SJ., Bai GH., Hong YP. Drug-resistant tuberculosis in Korea, 1994. Int J Tuberc Lung Dis. 1997. 1:302–8.

12.Choi JC., Lim SY., Suh GY., Chung MP., Kim H., Kwon OJ, et al. Drug resistance rates of Mycobacterium tuberculosis at a private referral center in Korea. J Korean Med Sci. 2007. 22:677–81.

13.Joh JS., Lee CH., Lee JE., Park YK., Bai GH., Kim EC, et al. The interval between initiation of anti-tuberculosis treatment in patients with culture-positive pulmonary tuberculosis and receipt of drug-susceptibility test results. J Korean Med Sci. 2007. 22:26–9.

14.Miotto P., Piana F., Penati V., Canducci F., Migliori GB., Cirillo DM. Use of genotype MTBDR assay for molecular detection of rifampin and isoniazid resistance in Mycobacterium tuberculosis clinical strains isolated in Italy. J Clin Microbiol. 2006. 44:2485–91.

15.Kim SY., Park YJ., Song E., Jang H., Kim C., Yoo J, et al. Evaluation of the CombiChip Mycobacteria Drug-Resistance detection DNA chip for identifying mutations associated with resistance to isoniazid and rifampin in Mycobacterium tuberculosis. Diagn Microbiol Infect Dis. 2006. 54:203–10.

16.Park YK., Shin S., Ryu S., Cho SN., Koh WJ., Kwon OJ, et al. Comparison of drug resistance genotypes between Beijing and non-Beijing family strains of Mycobacterium tuberculosis in Korea. J Microbiol Methods. 2005. 63:165–72.

17.Abe C., Kobayashi I., Mitarai S., Wada M., Kawabe Y., Takashima T, et al. Biological and molecular characteristics of Mycobacterium tuberculosis clinical isolates with low-level resistance to isoniazid in Japan. J Clin Microbiol. 2008. 46:2263–8.

18.Banerjee A., Dubnau E., Quemard A., Balasubramanian V., Um KS., Wilson T, et al. inhA, a gene encoding a target for isoniazid and ethionamide in Mycobacterium tuberculosis. Science. 1994. 263:227–30.

Fig. 1.

A mixed pattern of the inhA-15C and T mutation.

Table 1.

Oligonucleotide primers used in this study

Target gene∗	Primer set (direction)	Nucleotide sequence (5′-3′)	Nucleotide positions^†	Product size (bp)
rpoB	1st forward	AGGACGTGGAGGCGATCA	1,445-1,462	245
	1st reverse	GGTTTCGATCGGGCACAT	1672-1,689
	2nd forward	ACCGCAGACGTTGATCAACAT	1,464-1,484	166^‡
	2nd reverse	GGCACGCTCACGTGACAG	1,612-1,629
katG	1st forward	TGGCCGCGGCGGTCGACATT	725-744	420^‡
	1st reverse	GGTCAGTGGCCAGCATCGTC	1,125-1,144
	2nd forward	GGTGTTCGTCCATACGACCT	768-787	205
	2nd reverse	CATGAACGACGTCGAAACAG	953-972
inhA regulatory region	1st forward	CCTCGCTGCCCAGAAAGGGA	-168 to −149	249^‡'
	1st reverse	ATCCCCCGGTTTCCTCCGGT	61-81
	2nd forward	GTCACACCGACAAACGTCAC	-124 to −105	190
	2nd reverse	TCCGGTAACCAGGACTGAAC	47-66

^∗ The complete sequences of target genes in M. tuberculosis H37Rv are reported in the GenBank database under accession number NC_000962;

^† Numbering based on nucleotide position relative to the initiation codon of each gene;

^‡ Primers that were reported in other studies.

Table 2.

inhA and katG genotypic analysis of 95 culture isolates and 46 respiratory specimens by conventional drug susceptibility testing (DST) of isoniazid (INH)

INH result by conventional DST	Genotype	Number (%)
Resistant	Total	53 (100)
	katG Ser315Thr	26 (49.1)
	katG Ser315Gly	1 (1.9)
	inhA −15C>T	13 (24.5)
	inhA −8T>A	1 (1.9)
	katG Ser315Thr and inhA −15C>T	3 (5.7)
	Wild type	9 (17.0)
Susceptible	Total	88 (100)
	inhA −15C>T	3 (3.4)
	Wild type	85 (96.6)

Table 3.

rpoB genotypic analysis of 95 culture isolates and 46 respiratory specimens by conventional drug susceptibility testing (DST) of rifampicin (RIF)

RIF result by conventional DST	Genotype	Number (%)
Resistant	Total	45 (100)
	S531L	29 (64.4)
	H526Y	4 (8.9)
	H526N	1 (2.2)
	Q513L	2 (4.4)
	Q513P	2 (4.4)
	D516Y	2 (4.4)
	D516N	1 (2.2)
	L533P	1 (2.2)
	Wild type	3 (6.6)
Susceptible	Wild type	96 (100)

Table 4.

Sensitivity and specificity of sequencing for the detection of resistance in culture isolates and respiratory specimens

	N of positive strains/N of strains tested (%)
	Sensitivity		Specificity
	Culture isolates	Respiratory specimens	Culture isolates	Respiratory specimens
Isoniazid	32/39	12/14	55/56	30/32
	(82.0%)	(85.7%)	(98.2%)	(93.8%)
Rifampicin	31/33	11/12	60/60	34/34
	(93.9%)	(91.7%)	(100%)	(100%)

TOOLS

Similar articles