Lipopolysaccharide (LPS) and XTT (sodium 3-[1-(phenylaminocarbonyl)-3, 4-tetrazolium]-bis (4-methoxy-6-nitro) benzene sulfonic acid hydrate) were purchased from Sigma (St. Louis, MO, USA). Dulbecco's Modified Eagle's Medium (DMEM), antibiotic-penicillin/streptomycin solution, and fetal bovine serum (FBS, Hyclone, Logan, UT, USA) were used for the cell culture.

Dioscoreae Rhizoma was identified by Seungjeong Lee (College of Pharmacy, Chungbuk National University). Fifty grams of Dioscoreae Rhizoma were extracted with distilled deionized water (DDW) at 100℃. The water extracts were concentrated with a vacuum evaporator and then lyophilized.

RAW264.7 mouse macrophage cells (American Type Culture Collection, Manassas, VA, USA) were maintained in DMEM supplemented with 10% heat-inactivated FBS, 100 U/ml of penicillin, and 100 g/ml of streptomycin at 37℃ in a 5% CO₂ incubator.

A commercially-available cell viability assay was employed to evaluate the cytotoxic effect of EDR using XTT (sodium 3-[1-(phenylaminocarbonyl)-3,4-tetrazolium]-bis (4-methoxy-6-nitro) benzene sulfonic acid hydrate). RAW264. 7cells (2×10⁵ cells/well) were plated with various concentrations (25, 50, 100, 200 µg/ml) of EDR in 96-well micro-titer plates (Nunc, Roskilde, Denmark) and then cultured overnight at 37℃ in a 5% CO₂ incubator. Afterwards, 50µl of XTT solution was added to each well for 10 hrs at 37℃ in a 5% CO₂ incubator and the optical density (OD) was measured at 490 nm by a microplate reader (Molecular Devices Corporation, Sunnyvale, CA, USA).

The amount of nitrite produced by mouse macrophages was measured in cell culture supernatant. The cells were plated at a density of 1×10⁶ cells in 200µl of culture medium per well in a flat-bottomed, 96-well plate. They were then treated with various concentrations of EDR in the absence of LPS (100 ng/ml) and incubated overnight. NO production was determined according to the method reported by Stuehr and Nathan (17). The amount of nitrite was measured using Griess reagent [stock-I: 0.2% N-(1-naphthyl) ethylenediamine-HCl, stock-II: 2% sulfanilamide in 5% H₂PO₄].

The amounts of IL-1β, IL-6, TNF-α, and PGE₂ in the cell culture supernatant were measured using an ELISA kit (eBioscience, San Diego, CA, USA, R&D Systems, Minneapolis, MN, USA), according to the manufacturer's instructions. RAW 264.7 cells were cultured in DMEM with 10% FBS in 12-well, flat-bottomed plates at a density of 5×10⁵ cells/well. The cells were treated with various concentrations of EDR in the absence or presence of LPS (100 ng/ml) at 37℃ for 48 hrs in humidified air with 5% CO₂. Subsequently, the culture supernatant was collected and assayed according to the manufacturer's instructions.

Total RNA was extracted from RAW264.7 cells using the RNeasy Mini kit (QIAGEN, Valencia, CA, USA) in an RNase-free environment. RNA was quantified by reading the absorbance at 260 nm as previously described (14). The reverse transcription of 1µg RNA was carried out using M-MLV reverse transcriptase (Promega, Madison, WI, USA), oligo (dT) 16 primer, dNTP (0.5µM), and 1 U RNase inhibitor. After incubation at 65℃ for 5 min and 37℃ for 60 min, M-MLV reverse transcriptase was inactivated by heating at 70℃ for 15 min. The polymerase chain reaction (PCR) was performed in 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl₂, and 2.5 mM dNTPs with 5 units of Taq DNA polymerase and 10 pM of each primer set for iNOS, COX-2, IL-1β, IL-6, and TNF-α. The cDNA was amplified by 35 cycles of denaturing at 94℃ for 45 s, annealing at 62℃ for 45 s, and extension at 72℃ for 1 min. The final extension was performed at 72℃ for 5 min. The PCR products were electrophoresed on 1.5% agarose gels and stained with ethidium bromide. The primer sequences were as follows: 5' AGCTCCTCCCAGGACCACAC 3' (forward) and 5' ACGCTGAGTACCTCATTGGC 3' (reverse) for iNOS, 5' AAGAAGAAAGTTCATTCCTGATCCC 3' (forward) and 5' TGACTGTGGGAGGATACATCTCTC 3' (reverse) for COX-2, and 5' CAGGATGAGACATGACACC 3' (forward) and 5' CTCTGCAGACTCAAACTCCAC 3' (reverse) for IL-1β, 5' GTACTCCAGAAGACCAGAGG 3' (forward) and 5' TGCTGGTGACAACCACGGCC 3' (reverse) for IL-6, 5' TTGACCTCAGCGCTGAGTTG 3' (forward) and 5' CCTGTAGCCCACGTCGTAGC 3' (reverse) for TNF-α, 5' GTGGGCCGCCCTAGGACCAG 3' (forward) and 5' GGAGGAAGAGGATGCGGCAGT 3' (reverse) for β-actin. β-Actin was used as an internal control.

Cultured cells were collected, washed twice with cold PBS, and then suspended in hypotonic buffer (10 mM HEPES, pH 7.9, 10 mM KCl, 1.5 mM MgCl₂, 0.2 mM PMSF, 0.5 mM DTT, 10µg/ml aportinin). After 15 min incubation on ice, the cells were lysed by the addition of 0.1% NP-40 and vigorous vortexing for 1 min. The nuclei were pelleted by centrifugation at 12,000×g for 1 min at 4℃ and resuspended in high salt buffer (20 mM HEPES, pH 7.9, 25% glycerol, 400 mM KCl, 1.5 mM MgCl₂, 0.2 mM EDTA, 0.5 mM DTT, 1 mM NaF, 1 mM sodium orthovanadate). The supernatant fluid was stored in aliquots at -70℃.

RAW 264.7 cells were washed with phosphate-buffered saline (PBS) and lysed with lysis buffer (1% SDS, 1.0 mM sodium vanadate, 10 mM Tris-Cl buffer, pH 7.4) for 5 min. 20µg of protein from the cell lysates was applied to 8~12% SDS-polyacrylamide gels and then transferred to nitrocellulose membranes. The membranes were blocked with 5% skim milk in PBST solution for 1 hr. They were then incubated with anti-IL-1β, anti-IL-6, anti-TNF-α, anti-IL-4, anti-IL-10, anti-iNOS, anti-COX-2, anti-p-IκBα or anti-NF-κB monoclonal antibodies (Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA) for 2 hrs and washed 3 times with PBST. After incubation with an alkaline phosphatase-labeled secondary antibody (Abcam, Cambridge, MA, USA) for 2 hrs, the bands were visualized using a Western Blot Kit with alkaline phosphatase substrate (Vector, Burlingame, VT, USA).

RAW 264.7 cells (1×10⁶ cells/ml) were cultured in Petri dishes. The cells were treated with various concentrations of EDR in the absence or presence of LPS (100 ng/ml). The dishes were incubated at 37℃ for 24 hrs in humidified 5% CO₂ incubator under standard conditions. The cells were then washed with PBS. The washed cells were blocked with staining buffer containing 10% normal mouse serum (NMS) for 20 min on ice. The blocked cells were incubated with co-stimulatory molecules such as B7-1 and B7-2 antibody (BD Biosciences, San Jose, CA, USA) for 20 min on ice. The incubated cells were washed three times with staining buffer and then fixed by 1% paraformaldehyde in PBS. The fixed cells were measured by flow cytometry (Beckman Coulter, Brea, CA, USA).

Statistics software (version 8.0, Analytical Software, Tallahassee, FL, USA) was used for the statistical analysis. Differences between the vehicle and other groups were tested by two-way analysis of variance (group×experiment). A value p<0.05 was considered significant.

To rule out any toxic effects of EDR, we tested its effect on the viability of RAW 264.7 cells by XTT assay. The exposure of cells to EDR (25~200 µg/ml) revealed no significant toxic adverse effects on viability compared to the untreated control.

To analyze the potential pro-inflammatory properties of EDR, we used murine macrophages, which produce NO. LPS was used as a positive control for macrophage activation. In LPS (100 ng/ml)-stimulated RAW 264.7 cells, iNOS increased NO production. Various concentrations of EDR (25, 50, 100, 200 µg/ml) were added to the culture media at the time of cell stimulation, results indicated that macrophages did not release NO in response to the medium alone; LPS-induced NO production decreased in an EDR concentration-dependent manner (Fig. 1A). Furthermore, EDR also dose-dependently decreased PGE₂ production (Fig. 2A). EDR had a direct effect on pro-inflammatory mediators (NO and PGE₂) related to modulation of the expression of iNOS and COX-2 according to RT-PCR and western blot analyses. As shown in Fig. 1B and Fig. 2B, EDR decreased the gene expression of LPS-induced iNOS and COX-2 in a dose-dependent manner. Furthermore, western blot analysis revealed that the expression of the iNOS and COX-2 levels was correlated with their gene levels (Fig. 1C and 2C).

To determine whether EDR had a direct effect on cytokine production, IL-1β, IL-6, and TNF-α secretion were measured in the macrophage cell line using the cytokine ELISA kit. IL-1β, IL-6, and TNF-α are the major pro-inflammatory cytokines produced by monocytes and macrophages. As shown in Fig. 3A, B, and C, EDR dose-dependently decreased cytokine production in the presence of LPS. Moreover, we examined whether EDR dose-dependently suppressed the mRNA and protein levels of the pro-inflammatory cytokines in LPS-stimulated cells by RT-PCR and western blot analysis (Fig. 3D and E) and again found that EDR decreased the LPS-induced cellular levels of IL-1β, IL-6, and TNF-α in a dose-dependent manner.

In order to determine the effect of EDR on anti-inflammatory cytokine production, IL-4 and IL-10 were measured by western blot in RAW 264.7 cells. Results demonstrated that IL-4 and IL-10 did not change significantly in a dose-dependent manner (Fig. 4). These results suggest that EDR did not affect IL-4 and IL-10 production at the protein level in activated macrophages.

To further evaluate whether EDR influences the phenotypic maturation of macrophages, the cells were cultured with EDR and LPS for 24 hrs and then analyzed surface expression of B7-1 and B7-2 molecules. As shown in Fig. 5, EDR slightly suppressed the expression of B7-1/-2 molecules.

Activation of the transcription factor NF-κB is required for the expression of various cytokines, iNOS, and COX-2 in macrophages in response to LPS. NF-κB is found in an inactive form associated with its inhibitor molecule (IκB) in the cytoplasm. Upon stimulation, rapid phosphorylation and degradation of IκBα allows NF-κB to translocate into the nucleus and regulate transcription of the target genes. We also studied the effect of EDR on NF-κB activation by western blot analysis of phosphorylation of IκBα in RAW 264.7 cells (Fig. 6). These results showed that EDR inhibits the LPS-induced NF-κB activation.