Journal List > Cancer Res Treat > v.57(4) > 1516093183

Kim, Kim, Cho, Kim, Byun, and Kim: CYBC1 Drives Glioblastoma Progression via Reactive Oxygen Species and NF-κB Pathways

Abstract

Purpose

This study aims to investigate the role of cytochrome b-245 chaperone 1 (CYBC1) in glioblastoma (GBM) progression, focusing on its involvement in reactive oxygen species (ROS) production and associated signaling pathways. Understanding the molecular mechanisms driven by CYBC1 could provide new therapeutic targets and prognostic markers for GBM.

Materials and Methods

Publicly available datasets were analyzed to assess CYBC1 expression in GBM and its correlation with patient survival. GBM cell lines were genetically manipulated using the CRISPR/Cas9 system to deplete CYBC1. The effects of CYBC1 deficiency on cell proliferation, migration, invasion, and cell cycle dynamics were experimentally evaluated. Additionally, the impact of CYBC1 on the expression of NOXA1, a subunit of NADPH oxidase, and downstream signaling pathways such as nuclear factor кB (NF-κB) was explored.

Results

CYBC1 expression was significantly elevated in GBM tissues and correlated with poor patient survival. CYBC1 deficiency in GBM cells resulted in reduced cell viability, migration, and invasion. Mechanistically, CYBC1 positively regulated NOXA1 expression, which in turn enhanced ROS production and activated the ERK·AKT/NF-κB pathways. The suppression of CYBC1 led to decreased ROS levels, reduced phosphorylation of NF-κB, and downregulation of genes involved in epithelial-mesenchymal transition.

Conclusion

CYBC1 is implicated in GBM progression by regulating NOXA1-mediated ROS production and activating the ERK·AKT/NF-κB pathways. This study suggests that CYBC1 could serve as a potential therapeutic target and prognostic marker in GBM, warranting further investigation into its molecular mechanisms and therapeutic potential.

Introduction

Glioblastoma (GBM) is the most aggressive form of primary brain tumors [1]. Although GBM is considered a rare malignancy with a relatively low incidence rate [2], its high level of infiltration and invasiveness significantly complicates treatment, even with advanced options such as radiation therapy and surgery [3]. Despite advances in therapeutic strategies, the prognosis for GBM remains poor, with most patients facing serious adverse events and frequent relapses. The median survival time post-diagnosis is alarmingly short, typically ranging from 9 to 12 months [4]. The ongoing research on the GBM pathogenesis has yet to yield a fundamental understanding of this formidable disease.
Oxidative stress is linked to various cell signaling pathways, influencing key processes such as cell proliferation and survival [5]. In GBM, reactive oxygen species (ROS) can promote tumor growth and contribute to the development of resistance to chemotherapy [6]. On the other hand, excessive ROS production can lead to DNA damage and induce cell death. Consequently, GBM cells maintain an optimal ROS balance that supports their survival and proliferation while avoiding detrimental effects [7]. Among the primary sources of ROS, the NADPH oxidase (NOX) family plays a pivotal role in modulating apoptosis, cell growth, and angiogenesis [8]. Notably, the overexpression of NOX proteins in gliomas has been associated with enhanced tumor growth and aggressive metastasis, mainly due to their role in sustaining continuous ROS production [9]. NOXA1, a homolog of p67phox, is a cytoplasmic protein that interacts specifically with p22phox, a membrane-bound component of the NOX complex, to facilitate ROS generation [10]. This interaction stabilizes the NOX complex and primarily activates NOX1, NOX2, and NOX3 isoforms, promoting tumor growth and metastasis [11]. While the role of NOXA1 in maintaining appropriate ROS levels and its involvement in tumorigenesis is actively studied, the detailed mechanisms regulating NOXA1 remain to be fully elucidated.
In this intricate molecular landscape, cytochrome b-245 chaperone 1 (CYBC1), also known as EROS, has emerged as a significant protein of interest. CYBC1 is highly expressed in immune cells, where it plays a critical role in regulating the phagocyte respiratory burst, an essential component of innate immune responses [12]. Notably, mutations in CYBC1 have been implicated in chronic granulomatous disease, underscoring its crucial role in maintaining NOX function [13]. Despite the significance of CYBC1 in innate immunity, its role in the context of glioma development remains largely unexplored. This study aims to delve into the molecular mechanisms by which CYBC1 may influence GBM progression, with a particular focus on its potential involvement in ROS production and tumor development pathways.

Materials and Methods

1. Plasmid construction

To construct plasmids for CRISPR-mediated silencing of CYBC1, lentiCRISPRv2 vector was used as a backbone. A pair of oligos (5′-CACCGGCAGAACTTGGAGGACTGGG-3′ and 5′-AAACCCCAGTCCTCCAAGTTCTGCC-3′) was treated with T4 polynucleotide kinase (NEB) and annealed in a thermocycler. The annealed oligos were ligated into the plasmid with T4 DNA ligase (NEB) to generate LC-CYBC1 plasmid. Plasmids for CYBC1 expression were ordered from VectorBuilder (https://en.vectorbuilder.com).

2. Cell culture and generation of stable cell lines

U373 and U87 cells were purchased from the Korean Cell line bank, and normal human astrocytes (NHA) were purchased from iXCells Biotechnologies. GBM U373 and U87 cells were maintained in minimum essential medium (MEM) (Cytiva), while NHA cells were maintained in Dulbecco’s modified Eagle medium (Cytiva). Both media were supplemented with 10% fetal bovine serum (FBS) (Gibco, Thermo Fisher Scientific) and 1% penicillin-streptomycin (Thermo Fisher Scientific), and cells were kept at 37°C in a humidified incubator with 5% CO2. CYBC1-deficient cells were generated by transfecting LC-CYBC1 plasmid into the GBM cells using Lipofectamine 3000 (Invitrogen, Thermo Fisher Scientific), following the manufacturer’s instructions. Two days post-transfection, cells were selected with 1 μg/mL puromycin. The puromycin-resistant control and CYBC1-deficient U373 and U87 cells were maintained in MEM with 10% FBS, 1% penicillin-streptomycin, and 1 μg/mL puromycin.

3. Wound-healing assay

For the wound-healing assay, cells were seeded in 6-well plates with culture media. Once the cells reached 90% confluency, a wound was created by scratching a line across the monolayer with a 10-μL pipette tip in each well. The wells were then rinsed three times with phosphate-buffered saline (PBS) to remove cell debris, and culture media were subsequently added to the plates. Images were captured at 0 and 24 hours after the scratch was made.

4. Migration assay

For the migration assay, a 24-well Transwell insert system with an 8.0-μm pore size polycarbonate membrane (Corning) was purchased. A total of 5×104 cells in 300 μL of serum-free MEM were seeded into the upper chamber, and 750 μL of MEM containing 10% FBS was seeded into the lower chamber. Cells were incubated at 37°C for 24 hours. After washing with PBS, cells were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet. Non-migrated cells were removed from the top of each insert using a cotton swab. Microscopic images were acquired using the EVOS FL Auto Imaging System (Thermo Fisher Scientific).

5. 3D spheroid invasion assay

For the 3D spheroid invasion assay, cells were seeded in a round-bottom 96-well plate and cultured for 3 days to allow spheroid formation. Once spheroids had formed, 50 μL of Matrigel was added to each well to create a semisolid matrix. After the Matrigel solidified, 100 μL of medium was added to each well to prevent dehydration. Invasion was monitored using phase-contrast microscopy over a period of 3 days. The extent of invasion was quantified by measuring the length of extensions from the spheroid surface.

6. Nuclear and cytoplasmic protein extraction

For nuclear and cytoplasmic isolation, NE-PER nuclear cytoplasmic extraction reagent kit (Thermo Fisher Scientific) was used according to the manufacturer’s instructions. Briefly, cells were collected and suspended in cytoplasmic extraction reagent I. Subsequently, cytoplasmic extraction reagent II was added, and the supernatant (cytoplasmic extract) was transferred to a pre-chilled tube. The insoluble pellet fraction containing nuclei was suspended in a nuclear extraction reagent, and the supernatant constituting the nuclear extract was used for immunoblot assay.

7. Cell cycle synchronization

A total of 1×106 U373 and U87 cells were plated in a 6-well plate. The next day, the culture medium was replaced with MEM supplemented with 10% FBS and 75 ng/mL nocodazole to synchronize the cell cycle. After 16 hours of exposure, the cells were washed with PBS, and fresh MEM containing 10% FBS was added. At 0, 2, 6, and 10 hours after the reintroduction of the culture medium, the cells were collected for immunoblot analysis.

8. Protein preparation and immunoblot analysis

For immunoblotting, cells were disrupted directly with Laemmli buffer (60 mM Tris-HCl [pH 6.8], 2% (w/v) sodium dodecyl sulfate, 10% (v/v) glycerol, and 0.02% (w/v) bromophenol blue), followed by sonication and heat denaturation. Cell lysates were subjected to sodium dodecyl sulfate–polyacrylamide gel electrophoresis and transferred to a polyvinylidene fluoride membrane. Immunoblot assays were performed with antibodies against β-actin (Sigma-Aldrich), CYBC1 (Cusabio), phospho– nuclear factor κB (p–NF-κB; Thermo Fisher Scientific), total NF-κB (Thermo Fisher Scientific), cyclin D1 (Cell Signaling), lamin B1 (Thermo Fisher Scientific), phospho-AKT (Thermo Fisher Scientific), total AKT (Cell Signaling), phospho-Erk1/2 (Thermo Fisher Scientific), total Erk1/2 (Cell Signaling), NOXA1 (Cusabio), α-tubulin (Cell Signaling), Flag M2 (Sigma-Aldrich) overnight at 4℃. The next day, membranes were washed three times with TBST and incubated with horseradish peroxidase-conjugated anti-mouse or anti-rabbit secondary antibodies for 1 hour. Immunoreactive signals were detected with the D-plus ECL Femto system (Dongin LS) or Clarity Western ECL Substrate (Bio-Rad).

9. Immunofluorescence

For immunostaining, cells were fixed in 4% paraformaldehyde and permeabilized with 0.2% Triton X-100/PBS for 15 minutes each at room temperature. After blocking with 2% BSA/PBS for 30 minutes, cells were subjected to immunofluorescence staining with antibodies against CYBC1 (Cusabio) primary antibody overnight at 4℃. The next day, cells were washed with cold PBS and incubated with Flamma 488–conjugated goat anti-rabbit IgG or goat anti-mouse IgG for 30 minutes at room temperature. Fluorescence signals were visualized with EVOS FL Auto Imaging System.

10. Quantitative reverse-transcription polymerase chain reaction

Total RNA was isolated using an RNA Purification Kit (Favorgen), and 250 ng of the total RNA was treated with RNase for 15 minutes. After the inactivation of DNase with EDTA treatment and heating, RNA was reverse-transcribed using a first-strand cDNA synthesis kit according to the manufacturer’s instructions. Quantitative reverse-transcription polymerase chain reaction was performed with cDNA samples using Luna Universal qPCR Master Mix (New England Biolabs). The relative mRNA level was quantitated as values of 2^(Ct[RPL-32]−Ct[gene of interest]). The sequences of the forward and reverse primers are described in Table 1.

11. ROS detection

Intracellular ROS levels were determined using the fluorogenic CellROX Orange reagent, according to the manufacturer’s instructions. CellROX reagent was added to cultured cells at a final concentration of 5 μM for 30 minutes at 37°C. Nuclear DAPI staining was conducted with NucBlue Live ReadyProbes Reagent for 5 minutes. Fluorescent microscopic images were acquired using the EVOS FL Auto Imaging System.

12. Agilent Seahorse Metabolic Flux Analyzer

A metabolic analysis was performed using Seahorse XFp extracellular flux analyzer (Seahorse Bioscience). Control and CYBC1-deficient U373 and U87 cells were seeded at a density of 30,000 cells/well on XFp cell culture miniplates. After washing, the cells were incubated for 30 minutes at 37°C. Measurement of the oxygen consumption rate was conducted with subsequent sequential injections of (1) oligomycin (1.5 μM), (2) carbonyl cyanide-p-trifluoromethoxyphenylhydrazone (0.5 μM), and (3) rotenone-antimycin A (0.5 μM). After assay, data were normalized by cell numbers that were measured by the Countess 3 Automated Cell Counter (Thermo Fisher Scientific). An assay was analyzed with Wave Desktop 2.6 software (Seahorse Bioscience).

13. Bioinformatics data analysis

The expression level of CYBC1 in gliomas was analyzed using the GlioVis dataset (http://gliovis.bioinfo.cnio.es/) and the GEO dataset (GSE15824). Prognostic and genetic correlation values in GBM patients were determined with GEPIA (http://gepia.cancer-pku.cn/index.html). CYBC1 protein abundance was assessed through the pathology platform of the Human Protein Atlas (https://www.proteinatlas.org/pathology). Enrichment analysis of a list of genes exhibiting a positive or negative correlation in expression levels with CYBC1 was conducted using LinkedOmics (http://www.linkedomics.org).

14. Tissue microarray and immunofluorescence staining

For immunostaining, brain tumor tissue microarrays were purchased from US Biomax (GL807a). Tissue array slides were incubated at 60°C for 2 hours, then tissue sections were deparaffinized by immersion in xylene for 10 minutes twice. The slides were then washed for 5 minutes in graded alcohol solutions (100%, 90%, 70%, and 50%), followed by rehydration in distilled water for 5 minutes. For antigen retrieval, sections were incubated in pepsin (Abcam) for 10 minutes and further incubated in 3% hydrogen peroxide solution for 10 minutes. A blocking step was performed for 1 hour to minimize non-specific staining. Subsequently, primary antibodies against CYBC1 (Cusabio) or NOXA1 (Cusabio) incubated overnight. The next day, Alexa Fluor 488-conjugated antibody (Abcam) was incubated for 1 hour. Nuclei were stained with Hoechst 33342 (Thermo Fisher Scientific), followed by the addition of 2 drops of mounting solution (Dako) and sealed with coverslips. Fluorescence signals were visualized with EVOS FL Auto Imaging System (Thermo Fisher Scientific).

15. Statistical analysis

Statistical analysis was conducted using two-tailed Student’s t test, one-way ANOVA, two-way ANOVA, and the post hoc Tukey’s multiple comparison test. All results are expressed as means±standard error of the mean. GraphPad Prism ver. 9 (GraphPad Software) was used for all statistical analysis. Differences were considered significant when *p < 0.05, **p < 0.01, and ***p < 0.001.

Results

1. CYBC1 upregulation in GBM and its association with poor outcomes

To investigate the role of CYBC1 in GBM, we analyzed publicly available datasets. By utilizing Gravendeel and The Cancer Genome Atlas (TCGA)–GBM datasets obtained from GlioVis data portal (http://gliovis.bioinfo.cnio.es/) [14], we found that CYBC1 mRNA expression was notably elevated in several glioma types, including oligodendroglioma, oligoastrocytoma, astrocytoma, and GBM, compared to normal tissue samples (Fig. 1A and B). Using data from the Gene Expression Omnibus (https://www.ncbi.nlm.nih.gov/geo/) dataset GSE15824, we confirmed that CYBC1 expression was particularly high in GBM (Fig. 1C). Survival analysis with GEPIA (http://gepia.cancer-pku.cn/index.html) [15] demonstrated that the increased CYBC1 expression was associated with reduced overall survival in glioma patients, suggesting that high levels of CYBC1 are indicative of a poor prognosis (Fig. 1D).
Further analysis using the Human Protein Atlas (https://www.proteinatlas.org/) [16] revealed that CYBC1 protein is more abundant in low-grade glioma and GBM compared to normal brain tissue (Fig. 1E). To experimentally validate these findings, tissue microarrays of 22 low-grade astrocytoma samples and 23 GBM specimens as well as 10 non-tumor samples were analyzed by immunofluorescence. Consistently, immunostaining results displayed a higher distribution of CYBC1 in GBM (Fig. 1F). Additionally, CYBC1 protein levels were significantly elevated in GBM cell lines U373 and U87 compared to NHA (Fig. 1G). We confirmed that CYBC1 is predominantly localized in the cytoplasm, which was validated by immunostaining (Fig. 1H) and nucleocytoplasmic fractionation (Fig. 1I).

2. CYBC1 depletion alters cell cycle dynamics in GBM cells

To investigate the role of CYBC1 in GBM cell growth, CYBC1-deficient cells were generated using the CRISPR/Cas9 system in U373 and U87 GBM cell lines. CYBC1 deficiency was confirmed through Western blot analysis (Fig. 2A). The MTT assay revealed a decrease in GBM cell viability upon CYBC1 deficiency (Fig. 2B). Similarly, a colony formation assay confirmed the reduction in clonogenic capacity following CYBC1 depletion (Fig. 2C and D).
Considering that cyclin D1 has been reported to play a critical role in the GBM tumorigenesis and survival [17], the protein abundance of cyclin D1 was examined. Our findings revealed a significant suppression in the expression of cyclin D1 under CYBC1 deficiency (Fig. 2E). As anticipated, CYBC1-deficient cells exhibited an increase in the mRNA levels of CDKN1A, a cyclin-dependent kinase inhibitor that blocks cell cycle progression (Fig. 2F). To further investigate the role of CYBC1 in the cell cycle, the cells were synchronized to the G2/M phase using nocodazole. When cells were analyzed after nocodazole release, the accumulation of the G1/S marker cyclin D1 progressed more rapidly in control (LC-GFP) cells compared to CYBC1-deficient (LC-CYBC1) cells (Fig. 2G and H). These findings suggest that CYBC1 promotes the growth of GBM cells by potentially influencing the G1/S transition in the cell cycle.

3. CYBC1 deficiency reduces GBM cell migration and invasion

To investigate the effect of CYBC1 on GBM cell migration and invasion, we conducted a series of experiments including wound-healing assay and Transwell migration analysis. When migration capacity was assessed at 24 hours after cell scratch wound induction, CYBC1-deficient cells demonstrated a significantly reduced migration potential compared to control cells (Fig. 3A and B). This finding was corroborated by Transwell migration analysis, which also showed decreased migration ability in CYBC1-deficient cells (Fig. 3C and D). In line with these results, a 3D spheroid invasion assay revealed that CYBC1-deficient cells had a diminished invasion capability relative to control cells (Fig. 3E and F).
We also observed a marked reduction in the mRNA expression levels of matrix metalloproteinase (MMP) 9, its upstream regulator SNAI1 and mesenchymal markers VIM, TWIST1, and ZEB1, along with an increase in the epithelial marker CDH1 in CYBC1-silenced cells (Fig. 3G and H), mirroring that CYBC1 plays a crucial role in promoting the migration and invasion of GBM cells by regulating the expression of genes associated with the epithelial-mesenchymal transition (EMT).

4. CYBC1 may affect NF-κB activation in GBM

To elucidate the signaling pathway influenced by CYBC1, sequencing data from 153 GBM patients were analyzed using the LinkedOmics database (http://www.linkedomics.org) [18]. A list of genes exhibiting a positive or negative correlation in expression levels with CYBC1 was visualized using a volcano plot (Fig. 4A) and heatmaps (Fig. 4B). Kyoto Encyclopedia of Genes and Genomes pathway analysis of these gene lists indicated that CYBC1 upregulation may be associated with the NF-κB signaling pathway (Fig. 4C). Additional database analysis revealed a strong positive correlation between the protein abundance of CYBC1 and both NFKB1 and NFKB2 in GBM (Fig. 4D). To validate these findings, we assessed NF-κB phosphorylation in CYBC1-deficient cells. The results demonstrated decreased significantly reduced NF-κB phosphorylation levels in CYBC1-deficient cells compared to the control cells (Fig. 4E and F). These results suggest that CYBC1 may contribute to carcinogenesis by modulating NF-κB signaling.

5. CYBC1 mediates ROS production via NOXA1 in GBM

Crosstalk of ROS and NF-κB signaling plays a crucial role in the process by which NF-κB signaling promotes tumor progression. ROS can activate NF-κB and induce EMT by activating key EMT-inducing transcription factors such as SNAI1 [19]. ROS can also enhance the activity of MMPs that facilitate cancer cell movement [20].
To investigate the potential involvement of CYBC1 in ROS production, intracellular ROS levels were monitored. Clearly, ROS production was lower in CYBC1-deficient cells compared to control cells (Fig. 5A and B). To check whether changes in intracellular ROS levels were due to mitochondrial dysfunction, mitochondrial activity was examined. However, no significant differences were observed between the control and CYBC1-deficient tumor cells in this regard (S1 Fig.).
Given that CYBC1 mutations impair the function of the NOX complex [21], we focused on NOXA1, a critical subunit of this complex. Database analysis revealed a positive correlation between CYBC1 and NOXA1 mRNA expression, as evidenced by data from TCGA sourced from the cBioPortal database (https://www.cbioportal.org) (Fig. 5C) [22-24]. Immunostaining of GBM tissue microarrays also showed a positive correlation between CYBC1 and NOXA1 expression (Fig. 5D, S2 Fig.).
To further substantiate this correlation, the levels of NOXA1 protein (Fig. 5E) and mRNA (Fig. 5F) were examined in both control and CYBC1-deficient cells, revealing that NOXA1 expression was diminished in the absence of CYBC1. Given that NF-κB can regulate the expression of NOX genes [25], the transcript levels of NOX isoforms were compared in control and CYBC1-deficient cells. The results showed decreased mRNA levels of NOX1, CYBB, and NOX4 in CYBC1-deficient cells compared to controls (Fig. 5G).
To minimize the possibility of off-target gRNA or Cas9 effects, we additionally conducted rescue experiments. To confirm whether exogenous expression of CYBC1 can restore NOXA1 expression, CYBC1 was reintroduced into CYBC1-deficient cells. Our results displayed the restoration of NOXA1 protein (Fig. 5H and I) and mRNA (Fig. 5J and K) levels, suggesting that CYBC1 is presumably an authentic regulator of NOXA1.
We further monitored ERK and AKT, which are upstream signaling components of NF-κB and influenced by ROS [26]. The results showed reduced phosphorylation levels of AKT and ERK in CYBC1-deficient cells (Fig. 5L and M). Taking these findings together, CYBC1 plays a pivotal role in facilitating tumor growth and progression by upregulating NOXA1 to generate ROS and modulate NF-kB signaling. These findings collectively suggest that CYBC1 plays a crucial role in GBM progression by upregulating NOXA1 expression and the NOX complex activity, leading to enhanced crosstalk between ROS and NF-κB signaling.

Discussion

GBM is one of the most formidable challenges in oncology because of its aggressive nature and limited treatment options. Despite ongoing research, the prognosis for patients with GBM remains dismal, emphasizing the critical need for a deeper understanding of the molecular mechanisms driving this malignancy. GBM tumors exhibit significant molecular heterogeneity, meaning that development of personalized treatment strategies is essential. In this study, we identified for the first time that the CYBC1 gene can function as an oncogene in GBM. Our results can be widely used in developing targeted and personalized therapy, discovering prognostic markers, and monitoring treatment response.
Several studies have shown that NOX-generated ROS can contribute to tumor development and progression [27,28]. The role of ROS in cancer is akin to a double-edged sword: while excessive ROS can damage DNA and induce cell death, lower levels can serve as signal transducers that promote cell proliferation, migration, and angiogenesis [29,30]. The NOX/ROS/NF-κB signaling pathway plays a role in tumor progression; however, its involvement in GBM has not been thoroughly investigated. Given the significance of the NOX/ROS/NF-κB signaling in tumor progression, this study focuses on NOXA1, a subunit of the NOX complex, under CYBC1 silencing. The protein and mRNA levels of NOXA1 were reduced in CYBC1-deficient U373 and U87 cells. Although the protein levels of NOX isoforms in the absence of CYBC1 were not evaluated, we observed decreased mRNA levels of NOX1, CYBB, and NOX4 under CYBC1 silencing. Furthermore, CYBC1 deficiency led to ROS downregulation, which may contribute to the decreased phosphorylation of NF-κB. These findings suggest that CYBC1 is a critical oncogene in GBM, potentially driving tumorigenesis through the NOXA1/ROS/ERK·AKT/NF-κB axis.
Although this study confirmed the molecular function of CYBC1 in GBM cells, this study still has some unresolved tasks. First, NOXA1 regulation involves interactions between NOX isoforms and various proteins. In this study, the mRNA levels of NOXA1 were downregulated following CYBC1 deficiency; however, the specific transcription factor through which CYBC1 regulates NOXA1 expression could not be identified. Understanding the transcriptional regulation of NOXA1 is a crucial area for further research. Uncovering the master transcription factor will provide insights into the upstream control of NOXA1 and its interaction with CYBC1. Second, the complicated mechanisms by which CYBC1 affects the NOX complex are still largely unexplored. Discovering how CYBC1 affects the expression, assembly, and activity of various NOX isoforms will contribute to a more comprehensive understanding of its role in ROS production. Third, our data suggested that the NF-κB signaling could be downregulated under CYBC1 silencing. However, further research is needed to determine how CYBC1 regulates NF-κB. Thus, deeper investigation into this aspect is necessary in future studies. Finally, tumors are highly heterogeneous, even within the same cancer type. As this study focused on GBM, it’s important to recognize that CYBC1’s role may vary in different tumor types. Thus, broadening our investigation is imperative to explore the molecular mechanisms of CYBC1 across diverse tumor types. This approach will allow us to gain a more holistic view of CYBC1’s involvement in tumorigenesis and its potential as a therapeutic target.
In conclusion, this study sheds light on the significant role of CYBC1 in GBM, where it is upregulated and associated with poor prognosis. Our findings provide valuable insights into the molecular mechanisms underlying the pathogenesis of GBM and suggest CYBC1 as a potential therapeutic target for this aggressive cancer. Further research is warranted to comprehensively elucidate the intricate mechanisms involved and explore potential therapeutic interventions targeting CYBC1 in GBM.

Electronic Supplementary Material

Supplementary materials are available at Cancer Research and Treatment website (https://www.e-crt.org).

Notes

Author Contributions

Conceived and designed the analysis: Kim HJ, Kim TJ, Byun JS, Kim DY.

Collected the data: Kim HJ, Kim TJ, Cho JH, Kim MS.

Contributed data or analysis tools: Kim HJ, Kim TJ.

Performed the analysis: Kim HJ, Kim TJ, Byun JS, Kim DY.

Wrote the paper: Kim HJ, Kim TJ, Byun JS, Kim DY.

Conflicts of Interest

Conflict of interest relevant to this article was not reported.

Funding

This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (MSIT) (No. 2022R1C1C1006181 and RS-2023-00208416).

References

1. Yu JS, Liu G, Ying H, Yong WH, Black KL, Wheeler CJ. Vaccination with tumor lysate-pulsed dendritic cells elicits antigen-specific, cytotoxic T-cells in patients with malignant glioma. Cancer Res. 2004; 64:4973–9.
crossref
2. Kim HJ, Kim DY. Present and future of anti-glioblastoma therapies: a deep look into molecular dependencies/features. Molecules. 2020; 25:4641.
crossref
3. Stupp R, Mason WP, van den Bent MJ, Weller M, Fisher B, Taphoorn MJ, et al. Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. N Engl J Med. 2005; 352:987–96.
crossref
4. Liu Y, Li C, Lin J. STAT3 as a therapeutic target for glioblastoma. Anticancer Agents Med Chem. 2010; 10:512–9.
crossref
5. Shono T, Yokoyama N, Uesaka T, Kuroda J, Takeya R, Yamasaki T, et al. Enhanced expression of NADPH oxidase Nox4 in human gliomas and its roles in cell proliferation and survival. Int J Cancer. 2008; 123:787–92.
crossref
6. Huang H, Zhang S, Li Y, Liu Z, Mi L, Cai Y, et al. Suppression of mitochondrial ROS by prohibitin drives glioblastoma progression and therapeutic resistance. Nat Commun. 2021; 12:3720.
crossref
7. Lei FJ, Chiang JY, Chang HJ, Chen DC, Wang HL, Yang HA, et al. Cellular and exosomal GPx1 are essential for controlling hydrogen peroxide balance and alleviating oxidative stress in hypoxic glioblastoma. Redox Biol. 2023; 65:102831.
crossref
8. Lambeth JD. NOX enzymes and the biology of reactive oxygen. Nat Rev Immunol. 2004; 4:181–9.
crossref
9. Kesanakurti D, Maddirela D, Banasavadi-Siddegowda YK, Lai TH, Qamri Z, Jacob NK, et al. A novel interaction of PAK4 with PPARgamma to regulate Nox1 and radiation-induced epithelial-to-mesenchymal transition in glioma. Oncogene. 2017; 36:5309–20.
crossref
10. Moloney JN, Cotter TG. ROS signalling in the biology of cancer. Semin Cell Dev Biol. 2018; 80:50–64.
crossref
11. Kawano M, Miyamoto K, Kaito Y, Sumimoto H, Tamura M. Noxa1 as a moderate activator of Nox2-based NADPH oxidase. Arch Biochem Biophys. 2012; 519:1–7.
crossref
12. Thomas DC, Clare S, Sowerby JM, Pardo M, Juss JK, Goulding DA, et al. Eros is a novel transmembrane protein that controls the phagocyte respiratory burst and is essential for innate immunity. J Exp Med. 2017; 214:1111–28.
crossref
13. Thomas DC, Charbonnier LM, Schejtman A, Aldhekri H, Coomber EL, Dufficy ER, et al. EROS/CYBC1 mutations: Decreased NADPH oxidase function and chronic granulomatous disease. J Allergy Clin Immunol. 2019; 143:782–5.
crossref
14. Bowman RL, Wang Q, Carro A, Verhaak RG, Squatrito M. GlioVis data portal for visualization and analysis of brain tumor expression datasets. Neuro Oncol. 2017; 19:139–41.
crossref
15. Tang Z, Li C, Kang B, Gao G, Li C, Zhang Z. GEPIA: a web server for cancer and normal gene expression profiling and interactive analyses. Nucleic Acids Res. 2017; 45:W98–102.
crossref
16. Uhlen M, Bjorling E, Agaton C, Szigyarto CA, Amini B, Andersen E, et al. A human protein atlas for normal and cancer tissues based on antibody proteomics. Mol Cell Proteomics. 2005; 4:1920–32.
crossref
17. Zhang D, Dai D, Zhou M, Li Z, Wang C, Lu Y, et al. Inhibition of cyclin D1 expression in human glioblastoma cells is associated with increased temozolomide chemosensitivity. Cell Physiol Biochem. 2018; 51:2496–508.
crossref
18. Vasaikar SV, Straub P, Wang J, Zhang B. LinkedOmics: analyzing multi-omics data within and across 32 cancer types. Nucleic Acids Res. 2018; 46:D956–63.
crossref
19. Cichon MA, Radisky DC. ROS-induced epithelial-mesenchymal transition in mammary epithelial cells is mediated by NF-kB-dependent activation of Snail. Oncotarget. 2014; 5:2827–38.
crossref
20. Kessenbrock K, Plaks V, Werb Z. Matrix metalloproteinases: regulators of the tumor microenvironment. Cell. 2010; 141:52–67.
crossref
21. Wang Y, Qi H, Liu Y, Duan C, Liu X, Xia T, et al. The double-edged roles of ROS in cancer prevention and therapy. Theranostics. 2021; 11:4839–57.
crossref
22. Cerami E, Gao J, Dogrusoz U, Gross BE, Sumer SO, Aksoy BA, et al. The cBio cancer genomics portal: an open platform for exploring multidimensional cancer genomics data. Cancer Discov. 2012; 2:401–4.
crossref
23. Gao J, Aksoy BA, Dogrusoz U, Dresdner G, Gross B, Sumer SO, et al. Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal. Sci Signal. 2013; 6:pl1.
crossref
24. de Bruijn I, Kundra R, Mastrogiacomo B, Tran TN, Sikina L, Mazor T, et al. Analysis and visualization of longitudinal genomic and clinical data from the AACR Project GENIE Biopharma Collaborative in cBioPortal. Cancer Res. 2023; 83:3861–7.
crossref
25. Anrather J, Racchumi G, Iadecola C. NF-kappaB regulates phagocytic NADPH oxidase by inducing the expression of gp91phox. J Biol Chem. 2006; 281:5657–67.
26. Chen B, Liu J, Ho TT, Ding X, Mo YY. ERK-mediated NF-kappaB activation through ASIC1 in response to acidosis. Oncogenesis. 2016; 5:e279.
27. Mittal M, Siddiqui MR, Tran K, Reddy SP, Malik AB. Reactive oxygen species in inflammation and tissue injury. Antioxid Redox Signal. 2014; 20:1126–67.
crossref
28. Bedard K, Krause KH. The NOX family of ROS-generating NADPH oxidases: physiology and pathophysiology. Physiol Rev. 2007; 87:245–313.
crossref
29. Perillo B, Di Donato M, Pezone A, Di Zazzo E, Giovannelli P, Galasso G, et al. ROS in cancer therapy: the bright side of the moon. Exp Mol Med. 2020; 52:192–203.
crossref
30. Nakamura H, Takada K. Reactive oxygen species in cancer: current findings and future directions. Cancer Sci. 2021; 112:3945–52.
crossref

Fig. 1.
Analysis of cytochrome b-245 chaperone 1 (CYBC1) expression. (A) CYBC1 mRNA expression in different glioma types. Non-tumor, n=4; oligodendroglioma, n=191; oligoastrocytoma, n=130; astrocytoma, n=194; glioblastoma (GBM), n=152. One-way ANOVA with Tukey’s multiple comparison test was conducted for statistical analysis. (B) CYBC1 expression in non-tumors and gliomas. Non-tumor, n=4; GBM, n=156. This data was derived from the GlioVis database (http://gliovis.bioinfo.cnio.es/). TCGA, The Cancer Genome Atlas.(C) Differential mRNA expression of the CYBC1 gene in Gene Expression Omnibus (GEO) datasets (accession number: GSE15824). Non-tumor, n=5; GBM, n=12. (D) Kaplan-Meier survival curves derived from GEPIA (http://gepia.cancer-pku.cn/index.html). (E) CYBC1 immunostaining in normal cortex, low-grade glioma (LGG), and high-grade glioma (HGG). Data are derived from the Human Protein Atlas. (F) CYBC1 immunostaining in normal (n=10), astrocytoma (n=22), and GBM (n=23) tissue microarrays (GL807a). Scale bars=500 μm. (G) Western blot analysis of CYBC1 expression in normal human astrocytes (NHA) and GBM cell lines. Immunofluorescence (H) and immunoblot (I) assay demonstrating CYBC1 localization in GBM cells. Scale bars=200 μm. n.s, not significant.
crt-2024-827f1.tif
Fig. 2.
Cytochrome b-245 chaperone 1 (CYBC1) deficiency suppresses glioblastoma cell proliferation. (A) Verification of CYBC1 depletion through immunoblotting. (B) MTT assay for assessing viability in control (LC-GFP) and CYBC1-deficient (LC-CYBC1) U373 (n=3) and U87 (n=4) cells. Two-way ANOVA with Šidák’s multiple comparisons was conducted for statistical analysis. *p < 0.05. Representative images (left) and quantification (right) of clonogenic analysis of U373 (C) and U87 (D) cells (n=4). Unpaired two-tailed t test was conducted for statistical analysis. (E) Immunoblot analysis of cyclin D1 protein in control and CYBC1-deficient U373 and U87 cells. (F) CDKN1A mRNA expression in control and CYBC1-deficient U373 and U87 cells (n=3). Unpaired two-tailed t test was conducted for statistical analysis. Treatment of control and CYBC1-deficient U373 (G) and U87 (H) cells with 75 ng/mL nocodazole for 16 hours to synchronize cells at the G2/M phase. Immunoblot analysis of cyclin D1 protein after nocodazole release.
crt-2024-827f2.tif
Fig. 3.
Effects of cytochrome b-245 chaperone 1 (CYBC1) deficiency on glioblastoma cell migration and invasion. Representative images (left) and quantification (right) of the wound-healing assay with control and CYBC1-deficient U373 (A) and U87 (B) cells (n=3). Unpaired two-tailed t test was conducted for statistical analysis. Scale bars=100 μm. Representative images (top) and quantification (bottom) of the Transwell migration assay with control and CYBC1-deficient U373 (C, n=3) and U87 (D, n=4) cells. Unpaired two-tailed t test was conducted for statistical analysis. ***p < 0.001. Scale bars=100 μm. Representative images (left) and quantification (right) of the 3D culture invasion assays with control and CYBC1-deficient U373 (E, n=7) and U87 (F, n=9) cells. Unpaired two-tailed t test was conducted for statistical analysis. Scale bars=500 μm. mRNA expression levels of epithelial-mesenchymal transition–related genes in control and CYBC1-deficient U373 (G) and U87 (H) cells (n=3). Unpaired two-tailed t test was conducted for statistical analysis.
crt-2024-827f3.tif
Fig. 4.
Cytochrome b-245 chaperone 1 (CYBC1)–mediated regulation of nuclear factor κB (NF-κB). (A) Volcano plot of genes exhibiting a positive or negative correlation in expression levels with CYBC1, based on The Cancer Genome Atlas data. (B) Heatmap illustrating the expression levels (z-score) of the top 50 genes exhibiting a positive or negative correlation in expression levels with CYBC1. (C) Functional enrichment analysis of genes exhibiting a positive or negative correlation in expression levels with CYBC1. (D) Associations of the protein abundance of CYBC1 with NFKB1 and NFKB2. Immunoblot analysis of total and phospho-NF-κB protein levels in control and CYBC1-deficient U373 (E) and U87 (F) cells. CCRCC, clear cell renal cell carcinoma; COAD, colon adenocarcinoma; FDR, false discovery rate; GBM, glioblastoma; HNSCC, head and neck squamous cell carcinoma; LSCC, lung squamous cell carcinoma; LUAD, lung adenocarcinoma; OV, ovarian serous cystadenocarcinoma; PDAC, pancreatic ductal adenocarcinoma; UCEC, uterine corpus endometrial carcinoma.
crt-2024-827f4.tif
Fig. 5.
Impact of cytochrome b-245 chaperone 1 (CYBC1) on NOXA1 expression and reactive oxygen species (ROS) production. CellROX (red) and nuclear DAPI signal (blue) fluorescence images displaying ROS production in control and CYBC1-deficient U373 (A, n=400) and U87 (B, n=600) cells. Unpaired two-tailed t test was conducted for statistical analysis. ***p < 0.001. Scale bars=200 μm. (C) CYBC1 and NOXA1 mRNA expression correlation data derived from the cBioPortal database (n=141). R, Spearman correlation coefficient. (D) CYBC1 and NOXA1 immunostaining intensity correlation from glioblastoma tissue microarray (n=72). R, Spearman correlation coefficient. NOXA1 protein level (E) and mRNA expression (F) in control and CYBC1-deficient cells (n=3). Unpaired two-tailed t test was conducted for statistical analysis. (G) NOX1, CYBB, NOX3, and NOX4 mRNA expression levels in control and CYBC1-deficient cells (n=3). Two-way ANOVA with Šidák’s multiple comparisons was conducted for statistical analysis. n.s, not significant. Immunoblot analysis of NOXA1 protein after CYBC1 restoration in CYBC1-deficient U373 (H) and U87 (I) cells. NOXA1 mRNA expression after CYBC1 restoration in CYBC1-deficient U373 (J) and U87 (K) cells (n=3). One-way ANOVA with Tukey’s multiple comparison test was conducted for statistical analysis. Western blot analysis of total and phospho-ERK and -AKT in control and CYBC1-deficient cells (L) and quantification results (M) (n=3). Two-way ANOVA with Šidák’s multiple comparisons was conducted for statistical analysis. ***p < 0.001.
crt-2024-827f5.tif
Table 1.
Primers sequences used for quantitative RT-PCR
Gene name Sequence (5’ to 3’)
hRPL32 GAAGTTCCTGGTCCACAACG
GCGATCTCGGCACAGTAAG
hMMP9 GCTGGCAGAGGAATACCTGTAC
CAGGGACAGTTGCTTCTGGA
hSNAI1 AGTGGTTCTTCTGCGCTACT
GTAGGGCTGCTGGAAGGTAA
hTWIST1 GCCAGGTACATCGACTTCCT
CCAGCTCCAGAGTCTCTAGA
hVIM CAAAGCAGGAGTCCACTGAG
TAAGGGCATCCACTTCACAG
hZEB1 AGGATGACCTGCCAACAGAC
TCTGCATCTGACTCGCATTC
hCDH1 CATCTTTGTGCCTCCTGAAA
TGGGCAGTGTAGGATGTGAT
hNOXA1 CCAAGCCGTGACCAAGGAC
GGTTGTTTGGTTAGGGCTGA
hNOX1 GGTTGTTTGGTTAGGGCTGA
TGTGGAAGGTGAGGTTGTGA
hCYBB CTCTGAACTTGGAGACAGGCAAA
CACAGCGTGATGACAACTCCAG
hNOX3 CCTGGAAACACGGATGAGTGAG
CCTCCCATAGAAGGTCTTCTGC
hNOX4 GCCAGAGTATCACTACCTCCAC
CTCGGAGGTAAGCCAAGAGTGT

RT-PCR, reverse-transcription polymerase chain reaction.

TOOLS
Similar articles