Journal List > Int J Stem Cells > v.18(3) > 1516092534

Kang, Shin, Lim, Kim, Song, Song, Kim, Kim, Shin, Shin, and Cho: Thermostable bFGF Improves Cell Lifespan by Enhancing Cell Activity in the Long-Term Culture of Human Orbicularis Oculi Stem Cells

Abstract

Stem cells derived from human orbicularis oculi muscle (hOOM) are a valuable resource for cell therapy. However, when stem cells are continuously cultured, their abilities tend to deteriorate over time. One method to address this issue is to use basic fibroblast growth factor (bFGF) to maintain the stem cell functionality. The limitation is that bFGF is unstable under mammalian cell culture conditions with a half-life of only 8 hours, which poses a significant challenge to the production and maintenance of high-quality stem cells. In this study, we used thermostable bFGF (TS-bFGF) and demonstrated that hOOM-derived stem cells cultured with TS-bFGF exhibited superior proliferation, stem cell function, reduced reactive oxygen species, and cellular senescence delay effect compared to cells cultured with wild-type bFGF. Considering the pivotal role of stem cells in broad ranges of applications such as regenerative medicine and cultured meat, we anticipate that TS-bFGF, owing to its thermostability and long-lasting properties, will contribute significantly to the acquisition of high-quality stem cells.

Introduction

Mesenchymal stem cells (MSCs) can differentiate into multiple lineages and play key roles in tissue homeostasis and regeneration (1). Although MSCs can be isolated from various organs, they are primarily obtained from bone marrow and adipose tissue, with practical limitations due to procurement challenges, invasiveness, and donor variability (2, 3). A less invasive method for cell harvesting is needed. Eyelid blepharoplasty, which typically discards human orbicularis oculi muscle (hOOM) as waste, has been shown to be a valuable source of hOOM-derived stem cells (hOOM-SCs) (4). However, the continuous subculture of these adult tissue-derived stem cells presents challenges due to cellular senescence.
Basic fibroblast growth factor (bFGF) involves cell growth and differentiation, angiogenesis, tissue and organ formation, and metabolism in multiple cell types (5). bFGF is essential for stem cell proliferation, self-renewal, differentiation, and stemness, but its instability in culture limits its use. Thermostable bFGF (TS-bFGF), with superior stability and prolonged activity, outperforms wild-type bFGF (WT-bFGF) in enhancing cell growth and stemness in human pluripotent and Wharton’s Jelly (WJ)-MSCs, offering improved methods for stem cell culture (6, 7).
The function and nature of stem cells naturally diminish due to continuous culture (8). Several studies have reported a significant decline in stemness during continuous passaging due to cell senescence. Various stress factors, including telomere shortening, oxidative stress, oncogene activation, and DNA damage, contribute to cellular senescence and are closely linked to senescence (9). Cellular senescence is marked by increased cell size, flattened morphology, elevated reactive oxygen species (ROS) levels, associated-β-galactosidase (SA-β-Gal) activity, increased SASP, upregulation of cell cycle arrest genes (p53, p21, p16), and an enhanced DNA damage response (10).
This study demonstrated that TS-bFGF treatment improves cell culture outcomes and exhibits anti-senescence effects in hOOM-SCs compared to WT-bFGF, suggesting its potential to enhance stem cell acquisition from adult tissues for regenerative medicine and cultured meat applications by alleviating passage restrictions.

Materials and Methods

Culture of hOOM-SCs and adipose-derived MSCs using WT-bFGF and TS-bFGF

The experimental protocols for the isolation of hOOM were approved by the Ethics Committee of Konkuk University Medical Center (IRB number: KUMC 2019-05-043) and conformed to the principles outlined in the Declaration of Helsinki. For the preparation of hOOM-SCs donors who underwent eyelid blepharoplasty were enrolled in this study (Supplementary Table S1). Stem cells were isolated from unused tissue as described in a previous study (4), and adipose-derived (AD)-MSCs were cultured using α-MEM (Gibco) supplemented with 10% fetal bovine serum (FBS; Peak Serum Inc.) and 1% penicillin/streptomycin (Gibco). TS-bFGF, which was manufactured as described previously (6), was subsequently used after being dissolved in 1X phosphate-buffered saline (Gibco) at the required concentration for all experiments and stored at −20℃. In addition, WT-bFGF (Peprotech) dissolved in 1X PBS was used for all experiments.

Cell growth kinetics and viability

Cell growth kinetics were assessed based on the population doubling time and cumulative cell numbers. Cells were seeded at a density of 1×105 cells in a 60 mm culture dish (SPL Life Sciences) and incubated at 37℃ in a 5% CO2 atmosphere until they reached 80%∼90% confluence. After each passage (P), the cells were harvested, and the cell number was determined using a NucleoCounter NC-250TM (ChemoMetec), as recommended. Cell population doubling was calculated using the following equation:
(1)
PD=(log Nt.log N0)/0.301,
where population doublings (PD) represents population doubling, Nt corresponds to the cell number after trypsinization or collection, and N0 indicates the number of initially seeded cells.

Cell cycle analysis

The cellular DNA content was quantified using the recommended protocol of the NC-250TM to analyze the G0/G1, S, and G2/M cell cycle phases.

Flow cytometry

The cells were incubated with primary antibodies anti-CD73 (41-0200; Invitrogen), anti-CD90 (AF2067; R&D Systems, Inc.), anti-CD34 (553731; BD Biosciences), and anti-CD45 (14-0451-82; Invitrogen) followed by secondary antibodies (Alexa488, anti-mouse; Invitrogen or sheep IgG PE-conjugated F0126; R&D Systems) at the recommended concentrations. After washing, antibody fluorescence was measured using a CytoFLEX flow cytometer and analyzed with the CytExpert program.

In vitro cell scratch assay

hOOM-SCs were seeded in 6-well plates (SPL) and cultured in α-MEM until confluence, and 10 μg/mL mitomycin C (Sigma-Aldrich) was added for 2 hours at 37℃ to stop cell proliferation, and subsequently, the cells were washed with serum-free α-MEM and scratched with a 1 mL pipette tip. After washing twice with 1X PBS and adding culture medium, the time-dependent size of the wound closure (in triplicate) was determined using TScratch software (Tobias Gebäck, 2009).

Colony-forming assay

hOOM-SCs were seeded at 100 cells in a 60 mm dish (SPL) in α-MEM with 10% FBS and 1% P/S. After culturing for 14 days with regular replacement of the culture medium every 2∼3 days, the colonies were stained with crystal violet (Sigma-Aldrich), and the number of colonies was manually counted.

RNA isolation and reverse transcription-quantitative polymerase chain reaction

Total RNA was isolated from each group of hOOM-SCs using Labozol Reagent (Cosmo Genetech), according to the manufacturer’s instructions, and purified RNA was quantified using a NanoDrop spectrophotometer (NanoPhotometer N50, IMPLEN). Synthesis of cDNA was performed using 2 μg of total RNA with the M-MuLV reverse transcription kit (Labopass) and oligo-dT primers. The polymerase chain reaction (PCR) mixture was prepared using EzAmpTM qPCR 2X Master Mix (ELPIS-BIOTECH) and run on a Quant StudioTM 3 Real-Time PCR System (Thermo Fisher Scientific). The results were normalized using GAPDH expression as an internal control, and the fold change in gene expression was calculated using the comparative cycle time (Δct) method. Primers used are listed in Table 1.

ROS generation assessment

To determine the level of intracellular accumulation of ROS, the CellROX Green reagent (Thermo Fisher Scientific) was used according to the manufacturer’s instructions. The hOOM-SCs were cultured in α-MEM until they reached confluence. Subsequently, the cells were thoroughly washed and then incubated in culture medium containing 5 μM CellROX reagent for 30 minutes at 37℃. Following the incubation period, the solution was discarded, and the cells were washed three times with 1X PBS. Their fluorescence intensity was captured using a fluorescence microscope (Nikon), which was analyzed using ImageJ software (version 1.53c; National Institutes of Health).

Analysis of the level of cellular thiols

Changes in the level of reduced thiols in cells were analyzed using the NC-250TM following the recommended procedure. A micropipette was used as a representative cell sample from the cell suspension in a 1 mL microcentrifuge tube (SPL). One volume of 10 μL propidium iodide solution (Solution 6, VB-48TM PI Staining Reagent; ChemoMetec) was added into 190 μL of the cell suspension.

Senescence SA-β-Gal assay

The hOOM-SCs treated with various bFGF were prepared, and the senescence SA-β-Gal assay was performed according to the protocol of Debacq-Chainiaux and colleagues (11). When cells cultured in 6-well cell culture plates (SPL) reached 80% confluence, they were gently washed with 1X PBS at 2∼3 times and fixed for 15 minutes at room temperature with 2% paraformaldehyde (Biosesang) and 0.2% glutaraldehyde. Subsequently, the cells were incubated overnight at 37℃ with freshly prepared SA-β-Gal stain solution. SA-β-Gal-positive cells appeared blue and were observed and counted under a light microscope (Nikon).

Cell size measurement

Cell size was quantified using the NC-250TM following the recommended protocol. The cell suspension was mixed to obtain a homogeneous suspension. A micropipette was used as a representative cell sample from the cell suspension in a 1 mL microcentrifuge tube. One volume of 5 μL DAPI Solution (Solution 18; ChemoMetec) was added into 20 volumes of the 100 μL cell suspension sample.

Western blotting assay

Using the BCA protein assay kit, we measured the isolated protein levels according to the manufacturer’s protocol. We extracted the cellular proteins using a buffer composed of 100 mM Tris-HCl (pH 7.5), 1% Triton X-100 (Sigma-Aldrich), 10 mM NaCl, 10% glycerol (Amresco), 50 mM sodium fluoride (Sigma-Aldrich), 1 mM phenylmethylsulfonyl fluoride (Sigma-Aldrich), 1 mM p-nitrophenyl phosphate (Sigma-Aldrich), and 1 mM sodium orthovanadate (Sigma-Aldrich). The cell lysates were centrifuged at 16,000 g for 15 minutes at 4℃. The supernatant was carefully transferred into a new E-tube, and protein quantification was performed using a BCA protein assay kit. The proteins were separated by 8%∼12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and then transferred onto nitrocellulose membranes (Bio-Rad). Membranes were incubated overnight at 4℃ with the appropriate primary antibodies: NRF2 (sc-365949), P53 (sc-126), P21 (sc-6246) (Santa Cruz Biotechnology), and anti-β-actin (4970S; CST). Subsequently, the membranes were incubated with secondary antibodies (anti-mouse or -rabbit IgGs) conjugated with horseradish peroxidase (Santa Cruz Biotechnology) for 1 hour at room temperature. Protein signals were visualized using an enhanced chemiluminescence kit (Amersham Biosciences) and ChemiDocTM Imaging System (17001401; Bio-Rad).

Statistical analysis

All statistical analyses were performed using GraphPad Prism (version 9.5.1). In all experiments designed in triplicate, adjusted p-values were calculated using the Student’s t-test. In all figures, the p-values are marked with asterisks (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001).

Results

Effects of TS-bFGF in cell growth kinetics of hOOM-SCs

Based on previous findings showing superior outcomes with TS-bFGF in pluripotent stem cells (6), this study evaluated its effects on hOOM-SCs. Stem cells from orbicularis oculi muscle surgeries were preserved and cultured with WT-bFGF or TS-bFGF. In 5G1 cells from a 5-year-old donor, TS-bFGF treatment significantly increased cumulative cell numbers compared to the control and WT-bFGF groups. After continuous culture in the control group, differences in cell morphology between passage 9 were compared at 40× and 100× magnifications, but there were no significant changes in cell morphology (Fig. 1A). Additionally, the doubling times of the cells were lower than those of the controls, whereas no significant difference was observed in cell viability (Fig. 1B). Moreover, a relatively higher population of TS-5G1 cells was observed in S phase compared with WT-5G1 and the control group (Fig. 1C), whereas no difference in cell surface phenotypes was observed between different cell treatment groups (Fig. 1D). Similar culture outcomes were observed for hOOM-SCs (lines 18T1, 74U1, and 5S1 derived from donors aged 18, 74, and 5 years, respectively) and AD-MSCs cultured with TS-bFGF (Supplementary Fig. S1), indicating that the effects observed were not specific to the 5G1 cell line. In summary, TS-bFGF showed superior cell culture outcomes compared to WT-bFGF, likely by promoting cell cycle progression, leading to faster cell duplication and higher cumulative cell numbers without altering cellular morphology or surface phenotypes.

Effects of TS-bFGF on the proliferation and stemness of hOOM-SC-derived 5G1

To compare the effect of WT-bFGF and TS-bFGF on stemness and cellular wound-healing ability, the expression levels of stemness markers, such as Sox2, Oct4, klf4, L-myc, and Nanog (12), were evaluated in WT-5G1 and TS-5G1 cells. In contrast to the situation in pluripotent stem cells, where TS-bFGF stimulates the expression of stemness markers, these markers in 5G1 cells were not upregulated in response to TS-bFGF, except for a slight increase in the level of Sox2 (Fig. 2A). Sox2 supports the pluripotency and self-renewal of MSCs and enhances the expansion and differentiation of somatic stem cells (13). This suggests that long-term culture of hOOM-SCs with TS-bFGF can enhance cell performance. To further understand the effect of TS-bFGF on stemness, the WT-5G1 and TS-5G1 cells were evaluated for colony formation ability. A significant increase in colony formation ability was observed in TS-5G1 cells compared to the control group (Fig. 2B). Furthermore, we observed that TS-5G1 cells showed better wound healing ability than either the WT-5G1 or control cells (Fig. 2C). Taken together, TS-5G1 cells exhibited greater colony formation and wound healing abilities, suggesting that TS-bFGF enhances stemness and promotes cell proliferation during long-term culture.

Anti-senescence effects of TS-bFGF in hOOM-SC-derived 5G1 cells

Given the increased cell proliferation observed in TS-bFGF-treated 5G1 cells, we investigated its potential anti-senescence effects. WT-5G1 and TS-5G1 cells were analyzed for senescence-related changes during extended culture. First, it was observed that the number of SA-β-Gal stained positive cells decreased in TS-5G1 cells compared with the WT-5G1 or control cells (Fig. 3A), which was supported by similar results using WJ-MSCs (Supplementary Fig. S2A). Next, we observed that the expression levels of p16, p21, and p53, three well-known senescence markers, were significantly lower in TS-5G1 cells than in WT-5G1 or control cells (Fig. 3B). In addition, the TS-5G1 cell line showed a further decrease in p16 (11.1%), p21 (23.7%), and p53 (17.1%) compared to the WT-5G1 cell line. Moreover, oxidative stress levels, quantified by measuring cellular ROS, were significantly decreased in TS-5G1 cells compared to WT-5G1 or control cells (Fig. 3C). Further, based on the protective role of reduced glutathione (GSH), we measured the intracellular GSH levels and found that it was higher in TS-5G1 cells than in WT-5G1 or control cells (Fig. 3D). Interestingly, we did not detect any significant change in cell size, which is known to increase during cellular senescence (Supplementary Fig. S2B). After continuous treatment with TS-bFGF and WT-bFGF in 5G1 cells, the expression of activity-related markers, including NRF2 (related to ROS and GSH production) and the senescence markers P53 and P21, was evaluated. NRF2 levels were higher in the TS-bFGF-treated group compared to the control. Furthermore, the expression of P53 and P21, related to senescence, was observed to be decreased compared to the control group (Fig. 3E). Taken together, these results suggested that TS-bFGF has a positive effect on delaying cellular senescence in stem cells in continuous culture by reducing the levels of various senescence factors.

Discussion

In this study, we investigated the role of TS-bFGF, previously shown to be critical in the culture of pluripotent stem cells derived from adult tissues. Our findings demonstrated that TS-bFGF outperformed WT-bFGF in the continuous culture of hOOM-SCs, improving outcomes such as stemness maintenance, differentiation, and cell proliferation, consistent with prior results in pluripotent stem cells (4, 6).
Unlike in pluripotent stem cells, TS-bFGF treatment did not significantly upregulate most stemness markers in 5G1 cells, except for Sox2, which showed a notable increase. Sox2 is key for maintaining pluripotency and self-renewal in mesenchymal and somatic stem cells with enhanced expansion and differentiation potential (13). The effects of TS-bFGF on Sox2 expression remain unclear, though other stemness markers were unchanged. Despite minimal changes in stemness marker expression, TS-bFGF significantly enhanced colony formation in 5G1 cells, suggesting its role in maintaining stemness in adult stem cells. While in pluripotent stem cells, TS-bFGF increases both stemness markers and colony formation, in 5G1 cells, it primarily promotes proliferation, resulting in higher cell numbers and improved wound healing. Importantly, TS-bFGF did not alter cell morphology or surface phenotypes, offering advantages for stem cell manufacturing and clinical applications.
We also found that TS-bFGF plays a protective role against aged during prolonged cell culture. Persistent stem cell cultivation is associated with cellular senescence (8, 14). Therefore, significant efforts have been directed towards ameliorating cell aging during continuous subculture, thereby improving their therapeutic potential (15). This study investigated the effect of TS-bFGF on cell senescence in extended subculturing of 5G1 cells. TS-bFGF treatment reduced senescence, confirmed by senescent cell staining and the downregulation of senescence-associated genes (p16, p21, p53). Additionally, TS-bFGF lowered ROS-related factors, while elevated GSH levels protected cells from oxidative stress by scavenging ROS and regulating redox balance (16). We observed that TS-bFGF increased intracellular GSH levels and effectively delayed cell senescence, outperforming conventional WT-bFGF in preventing the onset of senescence.
However, the utility of primary stem cells is limited due to a passage restriction, in there during the cellular duplications the telomere lengths of cells are shortened and DNA damages are accumulated, resulting in cell cycle arrest and morphological changes through cellular senescence (17, 18). To address the limitations of primary cells, various strategies have been explored for cell immortalization, either genetically (e.g., via ectopic expression of TERT and CDK4) or naturally, allowing cells to proliferate beyond typical limits with minimal cellular changes (19). Given TS-bFGF’s strong proliferative and anti-senescence effects, it likely influences signaling pathways via FGF receptors to regulate genes related to these functions. Comparing transcriptional, telomere length, and epigenomic profiles between TS-bFGF and WT-bFGF treatments would be insightful. While our data suggest TS-bFGF’s anti-senescence activity, this effect may be cell-type specific and requires further study in other cell types. In addition, we evaluated the enhanced function of stem cells treated with TS-bFGF and its effects on differentiation, stemness, and long-term culture efficacy of hOOM-derived stem cells (Supplementary Fig. S3), and further studies are planned.
In summary, TS-bFGF effectively inhibits senescence in hOOM-SCs. TS-bFGF-treated 5G1 cells showed increased cell proliferation, elevated SOX2 expression, and reduced ROS levels, highlighting their potential for stem cell-based therapies. These findings suggest that TS-bFGF enhances cell preservation during extended culture, improving the quality of stem cells for applications such as cell therapy and cultured meat. Also, we filed patents for this study (Korean patent application numbers: 10-2023-0069536 and 10-2023-0071437).

Summary

This study shows that TS-bFGF delays senescence in hOOM-SCs, increasing cell proliferation, SOX2 expression, and reducing ROS. It enhances cell lifespan in long-term culture, offering potential for high-quality stem cells in therapies and applications like cultured meat.

Supplementary Materials

Supplementary data including one table and three figures can be found with this article online at https://doi.org/10.15283/ijsc24039

Notes

Potential Conflict of Interest

Author Ssang-Goo Cho is the CEO & CTO of the company StemExOne Co., Ltd. Author Hyun Jin Shin is a COO of the company StemExOne Co., Ltd. and is affiliated with the Department of Ophthalmology at Konkuk University Hospital and provided human orbicularis oculi muscle, contributing to joint this research. Author Geun-Ho Kang, Yeo Kyung Shin, Kyung Min Lim, Se Jong Kim, Myeongjin Song, and Kwonwoo Song are employed by the company StemExOne Co., Ltd. Author Dae Young Kim and Jung Hyun Kim are employed by the company PnP Biopharm Co., Ltd. Author Hang-Cheol Shin is a CEO of the company PnP Biopharm Co., Ltd. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The authors declare that this study received funding from Konkuk University in 2022. The funder was not involved in the study design, collection, analysis, interpretation of data, the writing of this article or the decision to submit it for publication.

Authors’ Contribution

Conceptualization: HCS, HJS, SGC. Methodology: GHK, KML. Validation: GHK, KML, SJK, YKS, MS, KS, JHK, DYK. Investigation: GHK, YKS, KML. Resources: HCS, DYK. Data curation: HCS, DYK, SGC. Visualization: YKS, GHK. Supervision: SGC. Project administration: GHK, YKS, SGC. Funding acquisition: SGC. Writing – original draft: GHK, DYK. Writing – review and editing: GHK, DYK, SGC.

Funding

This study was supported by the KFRM (Korean Fund for Regenerative Medicine) grant funded by the Korean government (the Ministry of Science and ICT and the Ministry of Health & Welfare). Grant numbers: 22B0502L1-01 and 24A0203L1 (SGC). Also, this paper was supported by Konkuk University Researcher Fund in 2024.

References

1. Jovic D, Yu Y, Wang D, et al. 2022; A brief overview of global trends in MSC-based cell therapy. Stem Cell Rev Rep. 18:1525–1545. DOI: 10.1007/s12015-022-10369-1. PMID: 35344199. PMCID: PMC8958818.
2. Berebichez-Fridman R, Montero-Olvera PR. 2018; Sources and clinical applications of mesenchymal stem cells: state-of-the-art review. Sultan Qaboos Univ Med J. 18:e264–e277. DOI: 10.18295/squmj.2018.18.03.002. PMID: 30607265. PMCID: PMC6307657.
3. Klingemann H, Matzilevich D, Marchand J. 2008; Mesenchymal stem cells - sources and clinical applications. Transfus Med Hemother. 35:272–277. DOI: 10.1159/000142333. PMID: 21512642. PMCID: PMC3076359.
4. Lim KM, Dayem AA, Choi Y, et al. 2021; High therapeutic and esthetic properties of extracellular vesicles produced from the stem cells and their spheroids cultured from ocular surgery-derived waste orbicularis oculi muscle tissues. Antioxidants (Basel). 10:1292. DOI: 10.3390/antiox10081292. PMID: 34439540. PMCID: PMC8389225.
5. Dai S, Zhou Z, Chen Z, Xu G, Chen Y. 2019; Fibroblast growth factor receptors (FGFRs): structures and small molecule inhibitors. Cells. 8:614. DOI: 10.3390/cells8060614. PMID: 31216761. PMCID: PMC6627960.
6. Kim S, Kang GH, Lim KM, et al. 2023; Thermostable human basic fibroblast growth factor (TS-bFGF) engineered with a disulfide bond demonstrates superior culture outcomes in human pluripotent stem cell. Biology (Basel). 12:888. DOI: 10.3390/biology12060888. PMID: 37372172. PMCID: PMC10294964.
7. Park S, Kim S, Lim K, et al. 2023; Thermostable basic fibroblast growth factor enhances the production and activity of human Wharton's jelly mesenchymal stem cell-derived extracellular vesicles. Int J Mol Sci. 24:16460. DOI: 10.3390/ijms242216460. PMID: 38003648. PMCID: PMC10671285.
8. Gatta V, D'Aurora M, Lanuti P, et al. 2013; Gene expression modifications in Wharton's Jelly mesenchymal stem cells promoted by prolonged in vitro culturing. BMC Genomics. 14:635. DOI: 10.1186/1471-2164-14-635. PMID: 24053474. PMCID: PMC3849041.
9. Hernandez-Segura A, Nehme J, Demaria M. 2018; Hallmarks of cellular senescence. Trends Cell Biol. 28:436–453. DOI: 10.1016/j.tcb.2018.02.001. PMID: 29477613.
10. Christodoulou I, Kolisis FN, Papaevangeliou D, Zoumpourlis V. 2013; Comparative evaluation of human mesenchymal stem cells of fetal (Wharton's jelly) and adult (adipose tissue) origin during prolonged in vitro expansion: considerations for cytotherapy. Stem Cells Int. 2013:246134. DOI: 10.1155/2013/246134. PMID: 23533440. PMCID: PMC3603673.
11. Debacq-Chainiaux F, Erusalimsky JD, Campisi J, Toussaint O. 2009; Protocols to detect senescence-associated beta-galactosidase (SA-betagal) activity, a biomarker of senescent cells in culture and in vivo. Nat Protoc. 4:1798–1806. DOI: 10.1038/nprot.2009.191. PMID: 20010931.
12. Dias IX, Cordeiro A, Guimarães JAM, Silva KR. 2023; Potential and limitations of induced pluripotent stem cells-derived mesenchymal stem cells in musculoskeletal disorders treatment. Biomolecules. 13:1342. DOI: 10.3390/biom13091342. PMID: 37759742. PMCID: PMC10526864.
13. Han SM, Han SH, Coh YR, et al. 2014; Enhanced proliferation and differentiation of Oct4- and Sox2-overexpressing human adipose tissue mesenchymal stem cells. Exp Mol Med. 46:e101. DOI: 10.1038/emm.2014.28. PMID: 24946789. PMCID: PMC4081551.
14. Neri S, Borzì RM. 2020; Molecular mechanisms contributing to mesenchymal stromal cell aging. Biomolecules. 10:340. DOI: 10.3390/biom10020340. PMID: 32098040. PMCID: PMC7072652.
15. Panwar U, Mishra K, Patel P, et al. 2021; Assessment of long-term in vitro multiplied human Wharton's jelly-derived mesenchymal stem cells prior to their use in clinical administration. Cells Tissues Organs. 210:239–249. DOI: 10.1159/000517423. PMID: 34521091.
16. Coppola S, Ghibelli L. 2000; GSH extrusion and and the mitochondrial pathway of apoptotic signalling. Biochem Soc Trans. 28:56–61. DOI: 10.1042/bst0280056. PMID: 10816099.
17. Melzener L, Verzijden KE, Buijs AJ, Post MJ, Flack JE. 2021; Cultured beef: from small biopsy to substantial quantity. J Sci Food Agric. 101:7–14. DOI: 10.1002/jsfa.10663. PMID: 32662148. PMCID: PMC7689697.
18. Kuilman T, Michaloglou C, Mooi WJ, Peeper DS. 2010; The essence of senescence. Genes Dev. 24:2463–2479. DOI: 10.1101/gad.1971610. PMID: 21078816. PMCID: PMC2975923.
19. Stout AJ, Arnett MJ, Chai K, et al. 2023; Immortalized bovine satellite cells for cultured meat applications. ACS Synth Biol. 12:1567–1573. DOI: 10.1021/acssynbio.3c00216. PMID: 37146268.

Fig. 1
Comparative analysis of the effects of TS-bFGF and WT-bFGF in 5G1. (A) Phase-contrast images (left) and cumulative cell numbers (right) of WT-5G1 and TS-5G1 at passage 9 during continuous cell culture. Scale bar=200 μm. (B) Analysis of the doubling time (left) and the cell viability (right) of WT-5G1 and TS-5G1. (C) Cell cycle analysis of WT-5G1 and TS-5G1. (D) Cell surface phenotype analysis of WT-5G1 and TS-5G1 using a flow cytometry. Values are expressed as the mean±SEM of three independent experiments. Statistical analyses were performed using one-way and two-way ANOVA. TS-bFGF: thermostable-basic fibroblast growth factor, WT-bFGF: wild-type bFGF, control: cells not treated with bFGF, TS-5G1: cells treated with TS-bFGF, WT-5G1: cells treated with WT-bFGF, ns: not significant. *p<0.05, ***p<0.001, ****p<0.0001.
ijsc-18-3-301-f1.tif
Fig. 2
Analysis of the cell proliferation and stemness of WT-5G1 and TS-5G1 cells. (A) Analysis of the expression level of stemness markers (Sox2, Oct4, Klf4, L-myc, and Nanog) in WT-5G1 and TS-5G1 cells. (B) Evaluation of colony formation ability of WT-5G1 and TS-5G1 cells. (C) Comparison of the wound healing effect in WT-5G1 and TS-5G1 cells. Values are expressed as the mean±SEM of three independent experiments. Control: cells not treated with basic fibroblast growth factor (bFGF), TS-5G1: cells treated with thermostable-bFGF, WT-5G1: cells treated with wild-type (WT)-bFGF, ns: not significant. *p<0.05, **p<0.01, ****p<0.0001.
ijsc-18-3-301-f2.tif
Fig. 3
Anti-senescence effects of TS-bFGF during a prolonged cell culture of 5G1 cells. (A) SA-β-Gal staining assay of WT-5G1 and TS-5G1 cells. Red arrows indicate SA-β-Gal-positive stained cells. Scale bar=200 µm. (B) Expression level of senescence-related genes in WT-5G1 and TS-5G1 cells. (C) Intracellular levels of ROS in WT-5G1 and TS-5G1 cells. (D) Cellular distribution of reduced glutathione (GSH) in WT-5G1 and TS-5G1 cells. (E) Expression levels of cellular senescence and oxidative stress markers, including NRF2, P53, P21, and beta-actin by immunoblotting assay. Values are expressed as the mean±SEM of three independent experiments. Statistical analyses were performed using one-way and two-way ANOVA. Control: cells not treated with basic fibroblast growth factor (bFGF), SA-β-Gal: associated-β-galactosidase, TS-5G1: cells treated with thermostable-bFGF, WT-5G1: cells treated with wild-type (WT)-bFGF, ns: not significant. *p<0.05, ***p<0.001, ****p<0.0001.
ijsc-18-3-301-f3.tif
Table 1
Primer information
Gene Primer sequencea (5’→3’) Product size (bp) Accession No.
GAPDH GTCTCCTCTGACTTCAACAGCG (F)
ACCACCCTGTTGCTGTAGCCAA (R)
131 NM_001357943.2
OCT4 CCTGAAGCAGAAGAGGATCACC (F)
AAAGCGGCAGATGGTCGTTTGG (R)
106 NM_203289.6
SOX2 GCTACAGCATGATGCAGGACCA (F)
TCTGCGAGCTGGTCATGGAGTT (R)
135 NM_003106.4
KLF4 CATCTCAAGGCACACCTGCGAA (F)
TCGGTCGCATTTTTGGCACTGG (R)
156 NM_001314052.2
LMYC GCGAACCCAAGACCCAGGCCTGCTCC (F)
CAGGGGGTCTGCTCGCACCGTGATG (R)
143 NM_001033082.3
NANOG TGAACCTCAGCTACAAACAG (F)
TGGTGGTAGGAAGAGTAAAG (R)
154 NM_024865.4
CDKN2A (p16) AGGGCTTCCTGGACACG (F)
TCTATGCGGGCATGGTTA (R)
175 NM_000077.5
CDKN1A (p21) TGGCAGTAGAGGCTATGGA (F)
AACAGTCCAGGCCAGTATG (R)
178 NM_000389.5
TP53 (p53) ACCCAGGTCCAGATGAAG (F)
GCAAGAAGCCCAGACG (R)
174 NM_000546.6

aF and R, forward and reverse primers, respectively.

TOOLS
Similar articles