Journal List > Int J Stem Cells > v.18(3) > 1516092531

Park, Yoon, Kim, Han, Nam, Lee, Lee, Choi, and Kim: Establishment of a Human Induced Pluripotent Stem Cell-Derived Cerebral Cortex Organoid Model for Neurotoxicity Assessment

Abstract

Human pluripotent stem cell (hPSC)-derived brain organoids have emerged as innovative models for drug screening and cytotoxicity evaluation. However, their inherent cellular heterogeneity presents challenges in isolating targeted neuronal populations, such as upper motor neurons, which are crucial for motor cortex function. In this study, we developed motor cortex-like organoids enriched with excitatory glutamatergic and inhibitory GABAergic neurons to assess neurotoxicity in the upper motor neurons–a key component of voluntary motor control. By optimizing the differentiation protocols, we achieved robust expression of vGlut1 in excitatory neurons and GABA in inhibitory neurons by day 30 of the differentiation. The organoids were generated by co-culturing progenitor cells during the early differentiation phase, followed by lineage-specific maturation. Comparative analyses demonstrated that these organoids more accurately recapitulate the human cortical architecture than traditional neural cell line (SK-N-SH neuroblastoma cells). We observed that measures of cell viability and integrity—assessed via cleaved caspase-3 levels, growth-associated protein 43 (GAP43), and autophagy-related protein 5 (ATG5)—were significantly higher in 3D organoid cultures compared to conventional 2D systems. In toxicological assays, the motor cortex-like organoids exhibited a dose-dependent response to both toxic and non-toxic compounds, highlighting their potential as high-fidelity neurotoxicity screening models. Our findings suggest that hPSC-derived motor cortex-like organoids serve as a robust, physiologically relevant model that can replace animal models in toxicity assessments, offering enhanced accuracy in evaluating compounds that impact the motor cortex while reflecting better human brain physiology.

Introduction

The motor cortex is a critical brain region responsible for voluntary motor control, with the precise coordination of upper motor neurons (UMNs) playing a pivotal role in coordinating voluntary movement (1, 2). These neurons-primarily classified as glutamatergic and GABAergic-are essential for transmitting motor commands from the brain to the spinal cord, thereby orchestrating complex motor functions (3, 4). Disrupted balance between excitatory and inhibitory signaling within this neuronal network is a hallmark of neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS), Parkinson’s disease, and stroke, all of which lead to progressive motor dysfunction and neuronal loss (5, 6). Therefore, there is a pressing need for advanced, physiologically relevant models that replicate the human motor cortex to investigate neurotoxicity and other pathophysiological mechanisms.
Traditional in vitro neurotoxicity models-including tumor-derived cell lines such as neuroblastoma and glioblastoma-are widely used for compound screening and studying cellular responses to toxins (7, 8). However, these models fail to fully capture the complexity of human neural circuits, particularly those within the motor cortex (9, 10). While tumor-derived cell lines provide insights into cell survival and responses to stimuli, they are largely composed of undifferentiated progenitor cells or glial cells, lacking the structural and functional properties of mature, fully differentiated neurons, particularly those involved in motor control (7, 11). Furthermore, traditional animal models (such as rodent models) exhibit substantial interspecies differences in brain anatomy and physiology, limiting their predictive value in human-specific neurotoxicity research (12, 13). These disparities impede the translation of findings from animal studies to human applications, underscoring the need for models that more accurately represent the complexities of human brain physiology.
Recently, human pluripotent stem cell-derived organoids have emerged as promising alternatives for studying brain development and disease (14, 15). These three-dimensional (3D) self-organizing structures better mimic the architecture and cellular composition of the human brain compared to traditional (2D) cultures and represent cellular diversity more accurately. However, organoids impose the challenge of isolating targeted neuronal populations due to their inherent cellular heterogeneity. Organoids often contain a mix of multiple neuronal and glial cell types, which complicates the study of targeted populations like UMNs, without interference from other cell types (16, 17).
In this study, we developed motor cortex-like organoids derived from human induced pluripotent stem cells (hiPSCs) that incorporate both excitatory glutamatergic and inhibitory GABAergic neurons, to investigate neurotoxicity in the UMNs. Our differentiated organoid model replicates key structural and functional aspects of the human motor cortex, thereby enables a more accurate in vitro evaluation of drug effects and neurotoxic responses. By optimizing differentiation protocols and employing a toxicological assay platform, we established a high-fidelity model for neurotoxicity screening, positioning hiPSC-derived motor cortex-like organoids as powerful tools for drug testing and neuropharmacological research.

Materials and Methods

iPSCs culture

The studies on human and animals should indicate that procedures were in accordance with institutional guidelines (i.e., Institutional Review Board and Institutional Animal Care and Use Committee). Wild-type (WTc11) hiPSCs were cryopreserved in STEMCELL Technologies and stored in liquid nitrogen. For routine culture, hiPSCs were maintained in Essential 8TM medium (Life Technologies) on Matrigel-coated plates (Corning) and supplemented with the Rho-associated protein kinase inhibitor Y27632 (Tocris Bioscience) as needed. The cells were incubated at 37℃ in a humidified environment containing 5% CO2. Passaging was performed weekly once the cells reached 65%∼70% confluence. For cell dissociation, 1X TrypLE SelectTM (Gibco-BRL) was applied at 37℃ for 5 minutes. Subsequently, cells were gently transferred onto fresh Matrigel-coated plates to promote attachment and proliferation. The culture medium was refreshed daily to maintain optimal growth conditions and to preserve pluripotency.

Generation of motor cortex-like organoids

Motor cortex-like organoids were generated from cultured WTc11 iPSCs using a three-step differentiation protocol involving sequential patterning and lineage-specific differentiation. The first step was neuroepithelial differentiation. To initiate neuroepithelial differentiation, WTc11 iPSCs (3×106 cells/well) were seeded into AggreWellTM plates (STEMCELL Technologies) and cultured in NeurobasalTM (GibcoTM) medium supplemented with 10 μM SB431542 (Tocris Bioscience), 100 nM LDN193189 (STEMCELL Technologies), and 1 μM dorsomorphin (Sigma-Aldrich). Within 24 hours, cell aggregates formed into neural rosettes, which were subsequently transferred to Petri dishes (SPL) and cultured in the same medium for an additional 7 days. On day 8, when the rosette structures became visible, neuroepithelial cells were isolated using a Neural Rosette Selection Reagent (STEMCELL Technologies) to obtain a purified population for further differentiation. The second step involved lineage-specific differentiation of progenitors. Isolated neuroepithelial cells were cultured in lineage-specific differentiation medium for 12 days. For glutamatergic progenitor differentiation, the medium was supplemented with 20 ng/mL basic fibroblast growth factor 2 (bFGF2; PeproTech), 5 μM cyclopamine (Sigma-Aldrich), and 5 μM XAV 939 (Tocris Bioscience). For GABAergic progenitor differentiation, the medium was supplemented with 20 ng/mL bFGF2, 50 nM Sonic hedgehog protein (R&D Systems) and 1.5 μM IWR (Sigma-Aldrich). The final step involved the maturation of the motor cortex-like organoids. On day 20, differentiated progenitor cells were dissociated into single cells using Accutase (GibcoTM). A total of 8×106 cells (4×106 each of glutamatergic and GABAergic progenitors) were mixed and seeded into a PrimeSurface 3D Culture Spheroid Plate (S-BIO) in NeurobasalTM medium supplemented with 10 ng/mL brain-derived neurotrophic factor (BDNF; PeproTech), 10 ng/mL glial cell line-derived neurotrophic factor (R&D Systems), and 10 μM Y27632 for initial organoid formation. After 24 hours, the newly formed spheroids were transferred to suspension culture dishes and maintained in the same medium without Y27632 for an additional 9 days before characterization and cytotoxicity assays.

SK-N-SH cell culture and 3D sphere formation

SK-N-SH human neuroblastoma cells (ATCC) were cultured in Roswell Park Memorial Institute 1640 medium (Gibco-BRL) supplemented with 10% heat-inactivated fetal bovine serum (Gibco-BRL). Cells were incubated at 37℃ in a humidified atmosphere with 5% CO2. For 3D sphere formation, 3×105 cells per dish were cultured in suspension in Petri dishes, allowing spheroid aggregation over 5 days. This method promoted stable and reproducible 3D structures suitable for subsequent experimental applications.

Cell viability assay

Cell viability in motor cortex-like organoids was assessed using the WST-8 (WELGENE inc.), LDH (DOJINDO Laboratories), MTT (Sigma-Aldrich) assay to evaluate neuronal toxicity. Single organoids were seeded into 96-well plates and treated for 24 hours with one of the following: 100 μM aspirin (Sigma-Aldrich); amitriptyline (Sigma-Aldrich) at concentrations of 2, 10, 20, 40, 80, or 100 μM; γ-aminobutyric acid (GABA; Sigma-Aldrich) at 5.92, 29.6, 59.2, 296, 1,480, or 2,960 μM; methanol (Sigma-Aldrich) at 5.85%, 10%, 12%, or 15%; or N-methyl-D-aspartic acid (NMDA; Sigma-Aldrich) at 5.85, 10, 12, or 15 mM. Following treatment, the viability of the cells was assessed by adding the reagent following the manufacturer’s protocol. The absorbance was measured at 450 nm using a microplate reader (BioTek). Results are expressed as the percentage of viability relative to untreated control organoids.

mRNA expression analysis

Total RNA of the cultured cells cells and human brain tissue (Seoul National University Hospital Brain Bank) were isolated using TRIzol Reagent (Invitrogen), followed by chloroform extraction. One microgram of RNA was reverse transcribed into cDNA using a cDNA Synthesis Kit (Invitrogen), Real-time polymerase chain reaction (PCR) was performed using an ExicyclerTM (Bioneer) with SYBR Green dye (Thermo Fisher Scientific). The PCR conditions included initial denaturation performed at 95℃ for 10 minutes, followed by 40 cycles of denaturation at 95℃ for 10 seconds, annealing at 60℃ for 30 seconds, and extension at 72℃ for 30 seconds. Primer sequences are listed in Table 1.

Immunocytochemistry

Cells were cultured into confocal dishes and fixed with 4% paraformaldehyde (Sigma-Aldrich) for 15 minutes at room temperature. After fixation, cells were permeabilized with 0.1% Triton X-100 (Sigma-Aldrich) for 10 minutes. To block the non-specific binding, the cells were incubated with 5% bovine serum albumin (BSA; Sigma-Aldrich) in phosphate-buffered saline (PBS; HyClone) for 1 hour at room temperature. Cells were incubated overnight at 4℃ with specific primary antibodies diluted in 3% BSA-PBS. Primary antibodies included Anti-vGlut1 (1:200, 135 303C3; Synaptic Systems), Anti-Map2b (1:500, MA1-34378; Thermo Fisher Scientific), Anti-GABA (1:1,000, A2052; Sigma-Aldrich), and Anti-TuJ1 (Anti-β- Tubulin III, 1:500, T2200; Sigma-Aldrich). Staining was visualized using a confocal laser scanning microscope (Carl Zeiss). The cell nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) (1:1,000, 100-43-6; Sigma-Aldrich). Representative images were captured and analyzed for marker expression investigation.

Western blotting analysis

Motor cortex-like organoids were harvested, rinsed using cold PBS, and lysed in radioimmunoprecipitation assay buffer (Thermo Fisher Scientific) containing protease and phosphatase inhibitors (Thermo Fisher Scientific). Protein concentration was determined using a BCA Protein Assay Kit (Thermo Fisher Scientific). Equal amounts of protein (30 μg per sample) were separated in 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membranes (Millipore) using a Bio-Rad wet blotting at 100 V for 90 minutes at 4℃. Membranes were blocked with 5% nonfat milk in Tris-buffered saline containing 0.1% Tween-20 (TBS-T) for 1 hour at room temperature. Primary antibodies, including cleaved caspase-3 (1:1,000; Cell Signaling Technology), and α-tubulin (1:1,000; Abcam) as a loading control, were applied overnight at 4℃. After three washes with TBS-T, the membranes were incubated with horseradish peroxidase-conjugated secondary antibodies (1:5,000; Cell Signaling Technology) for 1 hour at room temperature, followed by three additional TBS-T washes. Chemiluminescence signals were detected using an enhanced chemiluminescence system.

Statistical analysis

Data are presented as the mean±standard error of the mean from the specified number of experiments. Statistical analyses were conducted using Student’s t-test for two-group comparisons and one-way ANOVA for multiple group comparisons. A p-value<0.05 was considered statistically significant.

Results

Establishment of a differentiation method for organoid formation

First, we developed a 3D motor cortex-like organoid model derived from human iPSCs, as depicted in Fig. 1A. The schematic outlines the generation of 3D neuronal spheres by combining glutamatergic and GABAergic motor neuron types in a 1:1 ratio to create mixed 3D cultures. The differentiation process commenced with the formation of neural rosettes from iPSC-derived neuroepithelial cells. Next, we directed lineage specification by applying cyclopamine to induce glutamatergic progenitors formation from the dorsal forebrain and Sonic hedgehog protein to induce GABAergic progenitors formation from the ventral forebrain. By day 30, the application of BDNF facilitated terminal differentiation, which yielded a structurally organized organoid model that reflected the cellular diversity and complexity of the human cerebral cortex. Following terminal differentiation, as shown in Fig. 1B and 1C, successful induction of the target neuron types was verified through immunostaining. Specifically, vGlut1, a marker for glutamatergic neurons, and Map2b, a general neuronal marker, were highly expressed in the glutamatergic cluster. Additionally, the robust expression of GABA, a marker specific to GABAergic neurons, and TuJ1, a pan-neuronal marker, was detected in the GABAergic neuron differentiation cluster. These results confirm that our differentiation protocol effectively and reliably generated two distinct neuronal subtypes—glutamatergic and GABAergic—derived from human iPSCs.

Characterization and stability analysis of motor cortex-like organoids

To determine whether the 3D motor cortex-like organoid model exhibited characteristics of the human brain, we first performed quantitative polymerase chain reaction (qPCR). Fig. 2A presents microscopic images comparing the human neuroblastoma 3D model with both 2D and 3D models of iPSC-derived motor cortex-like organoids. Fig. 2B presents gene expression profiles of human neuroblastoma cells, iPSC-derived 2D and 3D model cultures, and human brain tissue using specific primers for vGlut1, vGlut2, ARPP21, and GABA. The results indicate that iPSC-derived 2D and 3D cultures displayed gene expression patterns closely aligned with the molecular signature of the human brain, unlike the neuroblastoma cells. To further assess cellular stability and safety within the cytotoxicity model, we evaluated the markers of autophagy, cell death, and neuronal regeneration. The analysis revealed that the 3D iPSC-derived model, which closely mimics the human brain’s tissue architecture, exhibited significantly lower expression levels of ATG5, a critical autophagy gene indicative of intracellular stability, and caspase-3, a marker of apoptosis, compared to the 2D model. Moreover, lower levels of GAP43, a key marker of neuronal regeneration, were observed in the 3D model, indicating enhanced cellular stability in the 3D cultures compared to its 2D counterpart (Fig. 2C). These findings highlight the potential of 3D motor cortex-like organoids as robust in vitro models for studying neurotoxicity and regenerative processes, providing a closer approximation of the native human brain environment.

Establishment of a toxicity evaluation platform using motor cortex-like organoids

To develop organoids as a platform for toxicity assessment, we first evaluated their structural integrity by measuring organoid size and characterizing cellular differentiation. Immunofluorescence staining performed before organoid aggregation confirmed a high expression of neural progenitor markers, with PAX6 (93.0%±4.9%/Field) and Nestin (90.5%±3.8%/Field), indicating robust neural commitment of progenitor cells (Fig. 3A). By day 15 of differentiation, approximately 550±10 μm organoids were successfully generated from neuronal progenitor-stage cells (Fig. 3B). On day 15 post-organoid formation, immunofluorescence analysis confirmed the differentiation of progenitor cells into glutamatergic and GABAergic neuronal subtypes, as indicated by the expression of vGLUT1 (38.7%±5.9% of DAPI-positive cells) and GABA (44.1%±11.0% of DAPI-positive cells). Furthermore, the high expression levels of the pan-neuronal markers Map2b (62.5%±6.8% of DAPI-positive cells) and TUJ1 (72.4%±11.2% of DAPI-positive cells) provided additional evidence of robust neuronal differentiation within the organoids (Fig. 3C). To assess cellular heterogeneity, we performed qPCR to compare gene expression levels among undifferentiated cells, 3D-differentiated glutamatergic and GABAergic neurons, and fully formed organoids. We demonstrated that significantly higher expression levels of vGlut1 and GAD1 in organoids compared to individually differentiated neuronal populations, suggesting enhanced neuronal maturation and a more heterogeneous cellular composition within the organoid structure (Fig. 3D). These findings highlight the potential of motor cortex-like organoids as a physiologically relevant platform for evaluating neurotoxicity and studying region-specific neuronal interactions.

Motor cortex-like organoid-based platform for drug toxicity evaluation

To enhance the reliability of organoid-based neurotoxicity assessments, we implemented a multi-parametric approach by integrating WST-8, LDH, and MTT assays, each probing distinct aspects of cellular metabolism, rather than relying on a single cytotoxicity measure. Additionally, intracellular protein analysis was performed using Western blotting to elucidate molecular responses to toxic exposure. To evaluate neurotoxicity, the mature organoids were exposed to various concentrations of aspirin, GABA, NMDA (a non-neurotoxic drug) and amitriptyline and methanol (a known neurotoxic compound) (Fig. 4A-4C). Cytotoxicity assay results demonstrated that aspirin, GABA and NMDA exhibited no detectable toxic effects, whereas amitriptyline and methanol induced a dose-dependent cytotoxic response, confirming its neurotoxic potential. Furthermore, western blot analysis confirmed the activation of the apoptotic pathway, as evidenced by an increase in cleaved caspase-3, a key marker for apoptosis, in amitriptyline-treated organoids compared to controls. This increase was concentration-dependent, with significantly higher expression levels at elevated concentrations (Fig. 4D). These findings suggest that the 3D motor cortex-like organoid model is a reliable platform for assessing neurotoxicity and effectively distinguishing between non-toxic and toxic compounds.

Discussion

In this study, we developed a robust and reproducible method for generating motor cortex-like organoids from human iPSCs, thereby providing an advanced in vitro model that closely mirrors the structural and cellular complexities of the human motor cortex. By directing neuroepithelial cells toward distinct neural lineages, we established a 3D co-culture system composed of glutamatergic and GABAergic neurons in a 1:1 ratio. This balanced combination of excitatory and inhibitory neurons replicates the natural architecture of the motor cortex, making our organoid model particularly well suited for investigating cortical circuitry, neural network formation, and cellular interactions in a physiologically relevant context.
Our approach leveraged cortical embryological cues, utilizing cyclopamine and Sonic hedgehog protein signaling pathways to guide the differentiation of neural progenitors into distinct dorsal forebrain (Glutamatergic) and ventral forebrain (GABAergic) lineages (18, 19). This strategy facilitated the generation of organoids enriched with targeted neuronal populations, as confirmed by immunostaining on day 30, which showed robust expression of vGlut1 and Map2b in glutamatergic neurons, and GABA and TuJ1 in GABAergic neurons. By selectively inducing and subsequently mixing these progenitors, we aimed to reduce the inherent cellular complexity of traditional brain organoid models. Conventional organoid protocols often involve the differentiation of iPSCs-derived neuroepithelial cells without specific isolation, leading to the development of a heterogenous mix of various neural and glial cell types, including astrocytes and oligodendrocytes (20, 21). Although these models have provided valuable insights into brain-like tissue architecture, their heterogeneity can complicate studies that focus on specific tissue toxicity or neurological disease mechanisms. In contrast, our refined platform offers enhanced reproducibility and specificity, allowing for more precise evaluation of neurotoxicity and the pathophysiological mechanisms underlying neurological disorders.
In our comparative analysis, we evaluated the characteristics of our motor cortex-like organoid model against those of both human brain tissue and established tumor-derived cell lines (22). Focusing on key markers representative of excitatory and inhibitory neurons within the cerebral motor cortex, we found that, while our differentiated organoids exhibited higher expression of these markers than traditional neural cell lines, they still fall short of fully emulating the human brain tissue. Nevertheless, we propose that extending the differentiation process beyond the 30-day period utilized in this study to 50 days or more could further enhance the structural and functional resemblance of the organoids to native brain tissue, potentially bringing them closer to physiologically relevant models for research and therapeutic applications. To address the variability commonly seen in organoid size with traditional methods, we devised a high-throughput screening (HTS) approach utilizing uniformly sized 3D organoid cultures (23, 24). This innovation improves the reproducibility and consistency of experimental outcomes. Additionally, we established a reliable platform for toxicity assessment by employing the WST-8 assay, which enables efficient and user-friendly cytotoxicity evaluation. This platform supports precise drug screening and safety testing, thereby broadening the scope and impact of organoid-based research in neurotoxicity and pharmaceutical studies. Moreover, our 3D organoid model demonstrated reduced expression of key autophagy and apoptosis markers (ATG5 and cleaved caspase-3), indicating a stable cellular environment that supports long-term viability and resilience to stressors. This stability was underscored by lower levels of GAP43, a marker of neuronal regeneration, in the 3D model compared to the 2D culture, suggesting enhanced cellular stability within the 3D architecture (25, 26). Unlike 2D models that often fail to replicate complex drug responses, our 3D organoid model provides a more accurate and translationally relevant platform for preclinical drug testing, thus supporting its use in the development of neuroprotective therapies (27-29).
In conclusion, our 3D motor cortex-like organoid model represents a significant advancement in the field of in vitro neuroscience, bridging the gap between conventional 2D cultures and in vivo studies. The model not only allows the study of fundamental aspects of cortical neurobiology and circuitry but also provides a promising platform for HTS, neurotoxicology testing, and personalized medicine applications. By recapitulating the cellular composition and cytoarchitecture of the motor cortex, this model offers new opportunities for exploring the cellular mechanisms underlying conditions, such as ALS, Huntington’s disease, and other disorders affecting motor function.

Acknowledgments

We are grateful for the support provided by Hyupsung University.

Notes

Potential Conflict of Interest

There is no potential conflict of interest to declare.

Authors’ Contribution

Conceptualization: JHK, BOC. Data curation: JHK, BOC, JH. Formal analysis: JH, SHN, KPL. Funding acquisition: JHK, BOC, SHL. Investigation: SP, HK. Methodology: SP, JH, HK, SHN, CHY. Project administration: JHK, BOC. Resources: JHK, BOC. Software: JH, SHN. Supervision: JHK, BOC. Validation: SP, JH, HK, SHN, CHY. Visualization: SP, JH, HK, SHN, CHY. Writing – original draft: JH, SHN, KPL. Writing – review and editing: JHK, BOC, SHN, KPL, CHY, SHL.

Funding

This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Ministry of Science and ICT (NRF-2022R1A2C2007696, JH), a grant from the Korea Health Technology R&D Project through the Korea Health Industry Development Institute, funded by the Ministry of Health & Welfare, Republic of Korea (HR22C1363), the Korean Fund for Regenerative Medicine funded by the Ministry of Science and ICT and the Ministry of Health & Welfare (23C0115L1), and the Future Medicine 2030 Project of Samsung Medical Center (SMO1240041). Additionally, this work was supported by the Ministry of Science and ICT (NRF-2020R1F1A1071489).

References

1. Ojakangas CL, Shaikhouni A, Friehs GM, et al. 2006; Decoding movement intent from human premotor cortex neurons for neural prosthetic applications. J Clin Neurophysiol. 23:577–584. DOI: 10.1097/01.wnp.0000233323.87127.14. PMID: 17143147. PMCID: PMC1785325.
2. Lemon RN. 2021; The cortical "upper motoneuron" in health and disease. Brain Sci. 11:619. DOI: 10.3390/brainsci11050619. PMID: 34066053. PMCID: PMC8151778.
3. Lemieux M, Bretzner F. 2019; Glutamatergic neurons of the gigantocellular reticular nucleus shape locomotor pattern and rhythm in the freely behaving mouse. PLoS Biol. 17:e2003880. DOI: 10.1371/journal.pbio.2003880. PMID: 31017885. PMCID: PMC6502437.
4. Sibilla S, Ballerini L. 2009; GABAergic and glycinergic interneuron expression during spinal cord development: dynamic interplay between inhibition and excitation in the control of ventral network outputs. Prog Neurobiol. 89:46–60. DOI: 10.1016/j.pneurobio.2009.06.001. PMID: 19539686.
5. Ghatak S, Talantova M, McKercher SR, Lipton SA. 2021; Novel therapeutic approach for excitatory/inhibitory imbalance in neurodevelopmental and neurodegenerative diseases. Annu Rev Pharmacol Toxicol. 61:701–721. DOI: 10.1146/annurev-pharmtox-032320-015420. PMID: 32997602.
6. Ghosh I, Liu CS, Swardfager W, Lanctôt KL, Anderson ND. 2021; The potential roles of excitatory-inhibitory imbalances and the repressor element-1 silencing transcription factor in aging and aging-associated diseases. Mol Cell Neurosci. 117:103683. DOI: 10.1016/j.mcn.2021.103683. PMID: 34775008.
7. Laffon B, Fernández-Bertólez N, Costa C, Pásaro E, Valdiglesias V. 2017; Comparative study of human neuronal and glial cell sensitivity for in vitro neurogenotoxicity testing. Food Chem Toxicol. 102:120–128. DOI: 10.1016/j.fct.2017.02.005. PMID: 28174116.
8. Gordon JL, Brown MA, Reynolds MM. 2018; Cell-based methods for determination of efficacy for candidate therapeutics in the clinical management of cancer. Diseases. 6:85. DOI: 10.3390/diseases6040085. PMID: 30249005. PMCID: PMC6313784.
9. Genc B, Gozutok O, Ozdinler PH. 2019; Complexity of generating mouse models to study the upper motor neurons: let us shift focus from mice to neurons. Int J Mol Sci. 20:3848. DOI: 10.3390/ijms20163848. PMID: 31394733. PMCID: PMC6720674.
10. Pomponio G, Zurich MG, Schultz L, et al. 2015; Amiodarone biokinetics, the formation of its major oxidative metabolite and neurotoxicity after acute and repeated exposure of brain cell cultures. Toxicol In Vitro. 30(1 Pt A):192–202. DOI: 10.1016/j.tiv.2015.01.012. PMID: 25659768.
11. Malik N, Efthymiou AG, Mather K, et al. 2014; Compounds with species and cell type specific toxicity identified in a 2000 compound drug screen of neural stem cells and rat mixed cortical neurons. Neurotoxicology. 45:192–200. DOI: 10.1016/j.neuro.2014.10.007. PMID: 25454721. PMCID: PMC4302729.
12. Bolon B. 2000; Comparative and correlative neuroanatomy for the toxicologic pathologist. Toxicol Pathol. 28:6–27. DOI: 10.1177/019262330002800103. PMID: 10668986.
13. Vink R. 2018; Large animal models of traumatic brain injury. J Neurosci Res. 96:527–535. DOI: 10.1002/jnr.24079. PMID: 28500771.
14. Frum T, Spence JR. 2021; hPSC-derived organoids: models of human development and disease. J Mol Med (Berl). 99:463–473. DOI: 10.1007/s00109-020-01969-w. PMID: 32857169. PMCID: PMC7914270.
15. Fujii M, Clevers H, Sato T. 2019; Modeling human digestive diseases with CRISPR-Cas9-modified organoids. Gastroenterology. 156:562–576. DOI: 10.1053/j.gastro.2018.11.048. PMID: 30476497.
16. Smits LM, Magni S, Kinugawa K, et al. 2020; Single-cell transcriptomics reveals multiple neuronal cell types in human midbrain-specific organoids. Cell Tissue Res. 382:463–476. DOI: 10.1007/s00441-020-03249-y. PMID: 32737576. PMCID: PMC7683480.
17. Lancaster MA, Knoblich JA. 2014; Organogenesis in a dish: modeling development and disease using organoid technologies. Science. 345:1247125. DOI: 10.1126/science.1247125. PMID: 25035496.
18. Cao SY, Hu Y, Chen C, et al. 2017; Enhanced derivation of human pluripotent stem cell-derived cortical glutamatergic neurons by a small molecule. Sci Rep. 7:3282. DOI: 10.1038/s41598-017-03519-w. PMID: 28607372. PMCID: PMC5468244.
19. Vazin T, Ashton RS, Conway A, et al. 2014; The effect of multivalent Sonic hedgehog on differentiation of human embryonic stem cells into dopaminergic and GABAergic neurons. Biomaterials. 35:941–948. DOI: 10.1016/j.biomaterials.2013.10.025. PMID: 24172856.
20. Bian J, Zheng J, Li S, Luo L, Ding F. 2016; Sequential differentiation of embryonic stem cells into neural epithelial-like stem cells and oligodendrocyte progenitor cells. PLoS One. 11:e0155227. DOI: 10.1371/journal.pone.0155227. PMID: 27192219. PMCID: PMC4871441.
21. Slembrouck-Brec A, Rodrigues A, Rabesandratana O, et al. 2019; Reprogramming of adult retinal müller glial cells into human-induced pluripotent stem cells as an efficient source of retinal cells. Stem Cells Int. 2019:7858796. DOI: 10.1155/2019/7858796. PMID: 31396286. PMCID: PMC6664555.
22. Chang YH, Ding DC. 2020; A clear cancer cell line (150057) derived from human endometrial carcinoma harbors two novel mutations. BMC Cancer. 20:1058. DOI: 10.1186/s12885-020-07567-w. PMID: 33143664. PMCID: PMC7607743.
23. Hou S, Tiriac H, Sridharan BP, et al. 2018; Advanced development of primary pancreatic organoid tumor models for high-throughput phenotypic drug screening. SLAS Discov. 23:574–584. DOI: 10.1177/2472555218766842. PMID: 29673279. PMCID: PMC6013403.
24. Kakni P, Hueber R, Knoops K, et al. 2020; Intestinal organoid culture in polymer film-based microwell arrays. Adv Biosyst. 4:e2000126. DOI: 10.1002/adbi.202000126. PMID: 32734713.
25. Shroff A, Reddy KVR. 2018; Autophagy gene ATG5 knockdown upregulates apoptotic cell death during Candida albicans infection in human vaginal epithelial cells. Am J Reprod Immunol. 80:e13056. DOI: 10.1111/aji.13056. PMID: 30303264.
26. Liu PF, Hu YC, Kang BH, et al. 2017; Expression levels of cleaved caspase-3 and caspase-3 in tumorigenesis and prognosis of oral tongue squamous cell carcinoma. PLoS One. 12:e0180620. DOI: 10.1371/journal.pone.0180620. PMID: 28700659. PMCID: PMC5503265.
27. Bonaventura G, Iemmolo R, Attaguile GA, et al. 2021; iPSCs: a preclinical drug research tool for neurological disorders. Int J Mol Sci. 22:4596. DOI: 10.3390/ijms22094596. PMID: 33925625. PMCID: PMC8123805.
28. Hung AY, Schwarzschild MA. 2007; Clinical trials for neuroprotection in Parkinson's disease: overcoming angst and futility? Curr Opin Neurol. 20:477–483. DOI: 10.1097/WCO.0b013e32826388d6. PMID: 17620885.
29. Wubben TJ, Besirli CG, Johnson MW, Zacks DN. 2018; Retinal neuroprotection: overcoming the translational roadblocks. Am J Ophthalmol. 192:xv–xxii. DOI: 10.1016/j.ajo.2018.04.012. PMID: 29702074.

Fig. 1
Construction of organoid formation and characterization of differentiated cells. (A) Schematic diagram for generating 3D motor cortex-like organoid from induced pluripotent stem cells (iPSCs). (B) Phase-contrast images and immunostaining confirm progressive differentiation into mature glutamatergic neurons (vGlut1, Map2b). (B, C) Phase-contrast images and immunostaining show that the iPSCs were differentiated into glutamatergic neurons or GABAergic neurons for 30 days. Insets provide high-magnification images highlighting the morphological details of differentiated neural cells. On day 30, the 3D organoids were stained with specific antibodies such as anti- vGlut1 (green), Map2b (red), GABA (green), TuJ1 (red), and DAPI (blue). Scale bars=100 μm.
ijsc-18-3-275-f1.tif
Fig. 2
Characterization of cell lines-indued organoid, induced pluripotent stem cells (iPSCs) differentiation-induced organoid and brain tissues. (A) Representative images of the SK-N-SH cells and iPSC induced 3D models. Scale bars=100 μm. (B) Quantitative polymerase chain reaction analysis of gene expression levels for vGlut1, vGlut2, ARPP21, and GABA in various models in cell line induced organoid, human neuroblastoma cell line (3D model), 2D iPSC-derived model, and human brain tissue. (C) Comparison of mRNA expression analysis of neuronal markers such as GAP43, ATG5, and caspase 3 in the 2D and 3D iPSC-derived models and human brain tissue. *p<0.01.
ijsc-18-3-275-f2.tif
Fig. 3
Characterization of motor cortex-like organoids. (A) Immunofluorescence staining of neural progenitor markers PAX6 (green) and Nestin (red) in induced pluripotent stem cell (iPSC)-derived neuroepithelial cells on day 15. Nuclei stain with DAPI (blue). Right: quantification of PAX6- and Nestin-positive cells per field and relative gene expression levels normalized to GAPDH. Scale bar=100 μm. (B) Bright-field image of day 30 organoids with an average diameter of 550±10 μm. Scale bar indicates measured diameter. (C) Immunofluorescence staining of organoids on day 30 showing glutamatergic markers vGlut1 (red) and Map2b (green) (top) and GABAergic markers GABA (red) and TuJ1 (green) (bottom), confirming neuronal subtype differentiation. Right: Quantification of vGlut1/Map2b and GABA/TuJ1 cells relative to DAPI-stained nuclei. Scale bars=50 μm. (D) Comparison of mRNA expression analysis of glutamatergic (vGlut1) and GABAergic (GAD1) markers in undifferentiated iPSCs, differentiated glutamatergic and GABAergic neurons, and organoids.
ijsc-18-3-275-f3.tif
Fig. 4
3D organoid-based drug toxicity assessment analysis. (A, B) Cell viability assay of organoids exposed to aspirin (non-toxic) and amitriptyline (toxic), with amitriptyline showing dose-dependent toxicity. (C) Cell viability assay of organoids exposed to GABA and NMDA (non-toxic) and methanol (toxic), with amitriptyline showing dose-dependent toxicity. (D) Western blot analysis of cleaved caspase-3 in organoids treated with amitriptyline, normalized to α-tubulin. Quantification indicates increased apoptosis with higher amitriptyline concentrations.
ijsc-18-3-275-f4.tif
Table 1
Primer sequence for quantitative polymerase chain reaction
Gene product Primer sequences
vGlut1 Forward: 5’GCTGTGTCATCTTCGTGAGG3’
Reverse: 5’CAGCGGACTCCGTTCTAAGG3’
vGlut2 Forward: 5’AACAAAGGATTTTGGCCCCA3’
Reverse: 5’CAGCACCCTGTAGATCTGGCC3’
GAD1 Forward: 5’AGGCAATCCTCCAAGAACC3’
Reverse: 5’TGAAAGTCCAGCACCTTGG3’
ARPP21 Forward: 5’CCTACCTCAACCACGCAACAGT3’
Reverse: 5’CCTGTTGACCAGACAAGACTGG3’
GABA Forward: 5’GGAGGGGTAATGGTGGAGTT3’
Reverse: 5’GGCAGTCAGAAAGGGAACAG3’
GAP43 Forward: 5’GGCCGCAACCAAAATTCAGG3’
Reverse: 5’CGGCAGTAGTGGTGCCTTC3’
ATG5 Forward: 5’GCAGATGGACAGTTGCACACAC3’
Reverse: 5’GAGGTGTTTCCAACATTGGCTCA3’
Caspase 3 Forward: 5’CATGGAAGCGAATCAATGGACT3’
Reverse: 5’CTGTACCAGACCGAGATGTCA3’
GAPDH Forward: 5’TGCACCACCAACTGCTTAGC3’
Reverse: 5’GGCATGGACTGTGGTCATGAG3’
TOOLS
DB Error: no database selected