Distribution of TT Virus Genotypes and Genogroups in 69 Healthy and 59 Hepatitis B Virus Infected Korean Individuals

Han-Sung Kim; Jae-Seok Kim; Min Jung Park; Wonkeun Song; Hee Jung Kang; Kyu Man Lee

doi:10.3343/kjlm.2007.27.4.257

Journal List > Korean J Lab Med > v.27(4) > 1011404

Go to TopGo to Top Go to BottomGo to Bottom

TOOLS

Kim, Kim, Park, Song, Kang, and Lee: Distribution of TT Virus Genotypes and Genogroups in 69 Healthy and 59 Hepatitis B Virus Infected Korean Individuals

Original Article

Korean J Lab Med 2007;27(4):257-264.

Published online: 10 February 2007

DOI: https://doi.org/10.3343/kjlm.2007.27.4.257

Distribution of TT Virus Genotypes and Genogroups in 69 Healthy and 59 Hepatitis B Virus Infected Korean Individuals

Han-Sung Kim, M.D., Jae-Seok Kim, M.D., Min Jung Park, M.D., Wonkeun Song, M.D., Hee Jung Kang, M.D., Kyu Man Lee, M.D.

Department of Laboratory Medicine, Hallym University College of Medicine, Anyang, Korea

Received 22 February 2007 Revised 6 July 2007 Accepted 7 July 2007

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Background

TT virus (TTV) infection is highly prevalent in general population and patients with hepatitis B virus (HBV) infection. The aim of the present study was to determine the distribution of the genotypes and genogroups of TTV in healthy and HBV-infected individuals in Korea.

Methods

Distribution of TTV genotypes and genogroups was investigated in the serum samples of 69 healthy and 59 HBV-infected individuals. PCR products of N22 region were genotyped by sequence analysis. TTV genogroups were determined by 5 different genogroup-specific PCR assays.

Results

Among the 20 sequenced isolates, 9 (45%) were genotype 2, 8 (40%) were genotype 1, 2 (10%) were genotype 3, and 1 (5%) was genotype 4. TTV genogroup 4 was found most frequently (52/128), followed by genogroup 3 (42/128), genogroup 1 (35/128), genogroup 5 (32/128), and genogroup 2 (1/128). Mixed infections with different genogroups were frequent.

Conclusions

TTV genotype 2 and 1 are predominant genotypes. TTV genotype 3 was detected for the first time in Korea. TTV genogroups 4 and 3 were predominant genogroups. No significant difference was observed in the distribution of TTV genogroups between healthy and HBV-infected individuals.

Keywords: TT virus (TTV), Genotype, Genogroup

References

1. Nishizawa T, Okamoto H, Konishi K, Yoshizawa H, Miyakawa Y, Mayumi M. A novel DNA virus (TTV) associated with elevated transaminase levels in posttransfusion hepatitis of unknown etiology. Biochem Biophys Res Commun. 1997; 241:92–7.

2. Hino S. TTV, a new human virus with single stranded circular DNA genome. Rev Med Virol. 2002; 12:151–8.

3. Springfeld C, Bugert JJ, Schnitzler P, Tobiasch E, Kehm R, Darai G. TT virus as a human pathogen: significance and problems. Virus Genes. 2000; 20:35–45.

4. Leary TP, Erker JC, Chalmers ML, Desai SM, Mushahwar IK. Improved detection systems for TT virus reveal high prevalence in humans, non-human primates and farm animals. J Gen Virol. 1999; 80:2115–20.

5. Biagini P, Gallian P, Attoui H, Cantaloube JF, Touinssi M, de Micco P, et al. Comparison of systems performance for TT virus detection using PCR primer sets located in non-coding and coding regions of the viral genome. J Clin Virol. 2001; 22:91–9.

6. Kim HS, Kim JS, Song W, Kang HJ, Lee KM. TT virus detection using different PCR primer sets in healthy and infected individuals with hepatitis B or C viruses. Korean J Clin Microbiol. 2007; 10:14–8.

7. Okamoto H, Nishizawa T, Kato N, Ukita M, Ikeda H, Iizuka H, et al. Molecular cloning and characterization of a novel DNA virus (TTV) associated with posttransfusion hepatitis of unknown etiology. Hepatol Res. 1998; 10:1–16.

8. Charlton M, Adjei P, Poterucha J, Zein N, Moore B, Therneau T, et al. TT-virus infection in North American blood donors, patients with fulminant hepatic failure, and cryptogenic cirrhosis. Hepatology. 1998; 28:839–42.

9. Takahashi K, Hoshino H, Ohta Y, Yoshida N, Mishiro S. Very high prevalence of TT virus (TTV) infection in general population of Japan revealed by a new set of PCR primers. Hepatol Res. 1998; 12:233–9.

10. Simmonds P, Davidson F, Lycett C, Prescott LE, MacDonald DM, Ellender J, et al. Detection of a novel DNA virus (TTV) in blood donors and blood products. Lancet. 1998; 352:191–5.

11. Huang LY, Oystein Jonassen T, Hungnes O, Grinde B. High prevalence of TT virus-related DNA (90%) and diverse viral genotypes in Norwegian blood donors. J Med Virol. 2001; 64:381–6.

12. Das K, Kar P, Gupta RK, Das BC. Role of transfusion-transmitted virus in acute viral hepatitis and fulminant hepatic failure of unknown etiology. J Gastroenterol Hepatol. 2004; 19:406–12.

13. Nakano T, Park YM, Mizokami M, Choi JY, Orito E, Ohno T, et al. TT virus infection among blood donors and patients with non-B, non-C liver diseases in Korea. J Hepatol. 1999; 30:389–93.

14. Kim EH, Cho HS, Lee CH, Kim KD. Prevalence of the TT virus viremia in patients on hemodialysis and general populations. Korean J Lab Med. 2003; 23:113–8.

15. Park SH, Byun KS, Song JW, Yeon JE, Park CK, Lee CH. Transfusion-transmitted virus infection in Korean patients with acute and chronic liver disease of unknown etiology and healthy controls: influence of PCR primers on the detection of transfusion-transmitted virus. Korean J Gastroenterol. 2003; 41:119–25.

16. Chung JY, Han TH, Seong HK, Paik IK, Kim MJ. Transfusion-transmitted virus and TTV-like mini virus Infection in blood products. Korean J Lab Med. 2004; 24:250–4.

17. Peng YH, Nishizawa T, Takahashi M, Ishikawa T, Yoshikawa A, Okamoto H. Analysis of the entire genomes of thirteen TT virus variants classifiable into the fourth and fifth genetic groups, isolated from viremic infants. Arch Virol. 2002; 147:21–41.

18. Devalle S, Niel C. Distribution of TT virus genomic groups 1–5 in Brazilian blood donors, HBV carriers, and HIV-1-infected patients. J Med Virol. 2004; 72:166–73.

19. Chung JY, Seong HK, Han TH. Distribution of transfusion-transmitted virus genomic groups in blood products. Korean J Lab Med. 2005; 25:116–22.

20. Miyata H, Tsunoda H, Kazi A, Yamada A, Khan MA, Murakami J, et al. Identification of a novel GC-rich 113-nucleotide region to complete the circular, single-stranded DNA genome of TT virus, the first human circovirus. J Virol. 1999; 73:3582–6.

21. Mushahwar IK, Erker JC, Muerhoff AS, Leary TP, Simons JN, Chalmers ML, et al. Molecular and biophysical characterization of TT virus: evidence for a new virus family infecting humans. Proc Natl Acad Sci USA. 1999; 96:3177–82.

22. Takahashi K, Iwasa Y, Hijikata M, Mishiro S. Identification of a new human DNA virus (TTV-like mini virus, TLMV) intermediately related to TT virus and chicken anemia virus. Arch Virol. 2000; 145:979–93.

23. Okamoto H, Nishizawa T, Ukita M, Takahashi M, Fukuda M, Iizuka H, et al. The entire nucleotide sequence of a TT virus isolate from the United States (TUS01): comparison with reported isolates and phylogenetic analysis. Virology. 1999; 259:437–48.

24. Khudyakov YE, Cong ME, Nichols B, Reed D, Dou XG, Viazov SO, et al. Sequence heterogeneity of TT virus and closely related viruses. J Virol. 2000; 74:2990–3000.

25. Al-Moslih MI, Abuodeh RO, Hu YW. Detection and genotyping of TT virus in healthy and subjects with HBV or HCV in different populations in the United Arab Emirates. J Med Virol. 2004; 72:502–8.

26. Desai MM, Pal RB, Banker DD. Molecular epidemiology and clinical implications of TT virus (TTV) infection in Indian subjects. J Clin Gastroenterol. 2005; 39:422–9.

27. Gallian P, Biagini P, Zhong S, Touinssi M, Yeo W, Cantaloube JF, et al. TT virus: a study of molecular epidemiology and transmission of genotypes 1, 2 and 3. J Clin Virol. 2000; 17:43–9.

28. Katsoulidou A, Paraskevis D, Anastassopoulou CG, Chryssou SE, Sypsa V, Boletis J, et al. Prevalence and genotypic distribution of TT virus in Athens, Greece. J Med Virol. 2001; 65:423–9.

29. Tanaka Y, Mizokami M, Orito E, Ohno T, Nakano T, Kato T, et al. New genotypes of TT virus (TTV) and a genotyping assay based on restriction fragment length polymorphism. FEBS Lett. 1998; 437:201–6.

30. Okamoto H, Takahashi M, Nishizawa T, Ukita M, Fukuda M, Tsuda F, et al. Marked genomic heterogeneity and frequent mixed infection of TT virus demonstrated by PCR with primers from coding and noncoding regions. Virology. 1999; 259:428–36.

31. Worobey M. Extensive homologous recombination among widely divergent TT viruses. J Virol. 2000; 74:7666–70.

32. Itoh K, Takahashi M, Ukita M, Nishizawa T, Okamoto H. Influence of primers on the detection of TT virus DNA by polymerase chain reaction. J Infect Dis. 1999; 180:1750–1.

33. Maggi F, Andreoli E, Lanini L, Fornai C, Vatteroni M, Pistello M, et al. Relationships between total plasma load of torquetenovirus (TTV) and TTV genogroups carried. J Clin Microbiol. 2005; 43:4807–10.

34. Maggi F, Pifferi M, Fornai C, Andreoli E, Tempestini E, Vatteroni M, et al. TT virus in the nasal secretions of children with acute respiratory diseases: relations to viremia and disease severity. J Virol. 2003; 77:2418–25.

Fig. 1.

Phylogenetic tree generated by the neighbor-joining method of the nucleotide sequence of the N22 region (nt 1939–2142) of TTV isolates from 15 healthy and 5 HBV-infected individuals. H, healthy individuals; B, HBV-infected individuals; G1a, genotype 1a; G1b, genotype 1b; G2a, genotype 2a; G2b, genotype 2b; G2c, genotype 2c; G2d, genotype 2d; G3, genotype 3; G4, genotype 4; G5, genotype 5; AB008394, AB016942, AB017769, AB017879, AB017770, AB017771, AB016936, AB016952, AB018960, AB-017774, AB017775, AB017887, and AB017776 are the GenBank database-derived isolates.

Fig. 2.

Deduced amino acid sequences of TTV genotype 1 (A) and TTV genotype 2 (B). Amino acid sequences are deduced from the nucleotide sequences of the N22 region (nt 1939–2142). Below the sequences, well-conserved and identical amino acid positions are indicated by colon and asterisk symbols, respectively. H, healthy individuals; B, HBV-infected individuals; AB008394, AB016942, AB017769, AB017879, AB017770, AB017771, AB-016952 and AB016936 are the GenBank database-derived isolates.

Table 1.

Demographic data of healthy and HBV-infected individuals

	N of cases	Sex (M/F)	Age (yr) mean±SD
Healthy individuals	69	50/19	43.3±12.0
HBV carriers	30	23/7	44.8±9.4
HBV liver disease	29	22/7	39.3±9.9
Total	128	95/33	42.7±10.9

Abbreviation: HBV, hepatitis B virus.

Table 2.

Oligonucleotide primers used for N22 region PCR

Primer	Sequence (5′-3′)^*	Position	Product size
Sense (1st)	WCAGACAGAGGMGAAGGMAAYATG	1900–1923
Sense (2nd)	GGMAAYATGYTRTGGATAGACTGG	1915–1938
Antisense (1st, 2nd)	CTGGCATYTTWCCRTTTCCAAART	2162–2185	271 bp

^* W=A or T; M=A or C; Y=C or T; R=A or G.

Table 3.

Oligonucleotide primers used for TTV genogroup-specific PCR

Primer	Sequence (5′-3′)^*	Position	Product size
1st PCR
Sense	CCGDAGGTGAGYTTACACACCG	180–201
Antisense	AGGCCYTATGGCGAAGTCTGG	3372–3352
2nd PCR
Sense	AGTCAAGGGGCAATTCGGGC	203–222
Antisense
Group 1	CCATAGGCCATGGTGCTCKATC	599–578	397 bp
Group 2	GTGGTRCCCGTTCCACAGAT	897–878	700 bp
Group 3	CCTGTATCTGGCCAGGTCTAG	1083–1063	885 bp
Group 4	CGGCGGTCTCCACGGCAT	319–302	111 bp
Group 5	TCYGCGAAGTCKGCCACGGGT	678–658	485 bp

^* D=A, G or T; Y=C or T; K=G or T; R=A or G.

Table 4.

Distribution of TTV genogroups in healthy and HBV-infected individuals

Genogroups	N positive/N tested (%)
Genogroups	Healthy individuals	HBV-infected individuals	Total
1	20/69 (29)	15/59 (25)	35/128 (27)
2	1/69 (1)	0/59 (0)	1/128 (1)
3	26/69 (38)	16/59 (27)	42/128 (33)
4	26/69 (38)	26/59 (44)	52/128 (41)
5	15/69 (22)	17/59 (29)	32/128 (25)
Total	38/69 (55)	33/59 (56)	71/128 (56)

Table 5.

Coinfected TTV genogroups in healthy and HBV-infected individuals

N of genogroup detected	N (%) of subjects
N of genogroup detected	Healthy individuals (N=69)	HBV-infected individuals (N=59)	Total (N=128)
0	31 (45)	26 (44)	57 (45)
1	10 (14)	9 (15)	19 (15)
2	10 (14)	11 (19)	21 (16)
3	14 (20)	10 (17)	24 (19)
4	4 (6)	3 (5)	7 (5)

TOOLS

Similar articles