﻿<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.3 20210610//EN" "JATS-journalpublishing1-3.dtd">
<article xml:lang="en" article-type="research-article" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink">
<?release-delay 0|0?>
<front>
<journal-meta>
<journal-id journal-id-type="nlm-ta">Korean J Physiol Pharmacol</journal-id>
<journal-title-group>
<journal-title>The Korean Journal of Physiology &#38; Pharmacology : Official Journal of the Korean Physiological Society and the Korean Society of Pharmacology</journal-title>
<abbrev-journal-title abbrev-type="publisher">Korean J. Physiol. Pharmacol.</abbrev-journal-title>
</journal-title-group>
<issn pub-type="ppub">1226-4512</issn>
<issn pub-type="epub">2093-3827</issn>
<publisher>
<publisher-name>The Korean Physiological Society and The Korean Society of Pharmacology</publisher-name>
</publisher>
</journal-meta>
<article-meta>
<article-id pub-id-type="doi">10.4196/kjpp.2022.26.3.183</article-id>
<article-id pub-id-type="publisher-id">kjpp-26-3-183</article-id>
<article-categories>
<subj-group subj-group-type="heading">
<subject>Original Article</subject>
</subj-group>
</article-categories>
<title-group>
<article-title>Differentially expressed mRNAs and their upstream miR-491-5p in patients with coronary atherosclerosis as well as the function of miR-491-5p in vascular smooth muscle cells</article-title>
</title-group>
<contrib-group>
<contrib contrib-type="author">
<name><surname>Ding</surname><given-names>Hui</given-names></name>
<xref rid="aff1" ref-type="aff"/>
</contrib>
<contrib contrib-type="author">
<name><surname>Pan</surname><given-names>Quanhua</given-names></name>
<xref rid="aff1" ref-type="aff"/>
</contrib>
<contrib contrib-type="author">
<name><surname>Qian</surname><given-names>Long</given-names></name>
<xref rid="aff1" ref-type="aff"/>
</contrib>
<contrib contrib-type="author" corresp="yes">
<name><surname>Hu</surname><given-names>Chuanxian</given-names></name>
<xref rid="aff1" ref-type="aff"/>
<xref rid="cor1" ref-type="corresp">*</xref>
</contrib>
</contrib-group>
<aff id="aff1">Department of Cardiovascular Surgery, The Affiliated Huaian No. 1 People&#8217;s Hospital of Nanjing Medical University, Huaian, Jiangsu 223300, <country>China</country></aff>
<author-notes>
<corresp id="cor1"><label>*</label><bold>Correspondence</bold> Chuanxian Hu, E-mail: <email xlink:href="huchuanxh@hotmail.com">huchuanxh@hotmail.com</email></corresp>
<fn fn-type="con">
<p><bold>Author contributions:</bold> H.D. and C.H. were the main designers of this study. H.D., Q.P., and L.Q. performed the experiments. C.H. analyzed the data. H.D. drafted the manuscript. All authors read and approved the final manuscript.</p>
</fn>
</author-notes>
<pub-date pub-type="ppub">
<day>1</day>
<month>5</month>
<year>2022</year>
</pub-date>
<pub-date pub-type="epub">
<day>1</day>
<month>5</month>
<year>2022</year>
</pub-date>
<volume>26</volume>
<issue>3</issue>
<fpage>183</fpage>
<lpage>193</lpage>
<history>
<date date-type="received">
<day>10</day>
<month>9</month>
<year>2021</year>
</date>
<date date-type="rev-recd">
<day>1</day>
<month>11</month>
<year>2021</year>
</date>
<date date-type="accepted">
<day>16</day>
<month>11</month>
<year>2021</year>
</date>
</history>
<permissions>
<copyright-statement>Copyright &#169; Korean J Physiol Pharmacol</copyright-statement>
<copyright-year>2022</copyright-year>
<license license-type="open-access">
<license-p>This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (<ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by-nc/4.0">http://creativecommons.org/licenses/by-nc/4.0</ext-link>) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
</license>
</permissions>
<abstract>
<p>MicroRNAs (miRNAs) regulate gene expression and are biomarkers for coronary atherosclerosis (AS). A novel miRNA-mRNA regulation network of coronary AS still needs to be disclosed. The aim of this study was to analyze potential mRNAs in coronary AS patients and the role of their upstream miR-491-5p in vascular smooth muscle cells (VSMCs). We first confirmed top ten mRNAs according to the analysis from Gene Expression Omnibus database (GSE132651) and examined the expression levels of them in the plaques and serum from AS patients. Five mRNAs (UBE2G2, SLC16A3, POLR2C, PNO1, and AMDHD2) presented significantly abnormal expression in both plaques and serum from AS patients, compared with that in the control groups. Subsequently, they were predicted to be targeted by 11 miRNAs by bioinformatics analysis. Among all the potential upstream miRNAs, only miR-491-5p was abnormally expressed in the plaques and serum from AS patients. Notably, miR-491-5p overexpression inhibited viability and migration, and significantly increased the expression of contractile markers (&#945;-SMA, calponin, SM22&#945;, and smoothelin) in VSMCs. While silencing miR-491-5p promoted viability and migration, and significantly suppressed the expression of &#945;-SMA, calponin, SM22&#945;, and smoothelin. Overall, miR-491-5p targeted UBE2G2, SLC16A3, and PNO1 and regulated the dysfunctions in VSMCs.</p>
</abstract>
<kwd-group>
<kwd>Coronary artery disease</kwd>
<kwd>miR-491-5p</kwd>
<kwd>PNO1</kwd>
<kwd>SLC16A3</kwd>
<kwd>UBE2G2</kwd>
</kwd-group>
</article-meta>
</front>
<body>
<sec sec-type="intro">
<title>INTRODUCTION</title>
<p>Coronary Atherosclerosis (AS) is a multifactorial chronic disease characterized by accumulation of lipids and fibrous components in the aorta [<xref rid="ref1" ref-type="bibr">1</xref>,<xref rid="ref2" ref-type="bibr">2</xref>]. In the aortic tunica media, vascular smooth muscle cells (VSMCs) are the main cell type [<xref rid="ref3" ref-type="bibr">3</xref>,<xref rid="ref4" ref-type="bibr">4</xref>], and the proliferation and migration of VSMCs in intima are associated with the formation of atherosclerotic plaques [<xref rid="ref5" ref-type="bibr">5</xref>,<xref rid="ref6" ref-type="bibr">6</xref>]. Due to the long clinical treatment cycle, poor prognosis, and frequent relapse of coronary AS, it is urgent to explore a novel therapeutic target for Coronary AS from the molecular level.</p>
<p>MicroRNAs (miRNAs) are small non-coding RNA molecules that can regulate gene expression at the post-transcriptional level [<xref rid="ref7" ref-type="bibr">7</xref><xref rid="ref8" ref-type="bibr"/>-<xref rid="ref9" ref-type="bibr">9</xref>]. MiRNAs can directly or indirectly modulate plaque formation, which involves the regulation of VCMCs, so that to affect the pathophysiology of coronary AS and cardiovascular disease [<xref rid="ref8" ref-type="bibr">8</xref>,<xref rid="ref10" ref-type="bibr">10</xref>]. Numerous miRNAs have been reported to participate in functionally regulating VSMCs during AS. For examples, miR-499a-3p and miR-135b-5p promote AS development by targeting <italic>MEF2C</italic> [<xref rid="ref11" ref-type="bibr">11</xref>]. Overexpression of miR-448 promotes VSMC proliferation and migration <italic>via</italic> <italic>MEF2C</italic> [<xref rid="ref12" ref-type="bibr">12</xref>]. MiR-365 participates in coronary AS through regulating IL-6 expression [<xref rid="ref13" ref-type="bibr">13</xref>]. MiR-491-5p is abnormally expressed in cancers [<xref rid="ref14" ref-type="bibr">14</xref><xref rid="ref15" ref-type="bibr"/>-<xref rid="ref16" ref-type="bibr">16</xref>]. Notably, a previous study revealed that miR-491-5p is lowly expressed in the atherosclerotic plaque tissues and plasma samples of AS patients, and inhibited the growth and migration of VSMCs by targeting <italic>MMP-9</italic> [<xref rid="ref17" ref-type="bibr">17</xref>], suggesting its meaningful role in the AS development. Moreover, miR-491-5p also increases the risk of atherosclerotic cerebral infarction through modulation of <italic>MMP-9</italic> gene, as reported in another study [<xref rid="ref18" ref-type="bibr">18</xref>].</p>
<p>In this study, we examined the expression of ten potential mRNAs in plaque tissues and serum from coronary AS patients and identified miR-491-5p as an upstream regulator. We hypothesized that miR-491-5p regulated the dysfunctions of VSMCs, which may contribute to novel research strategies for the coronary AS.</p>
</sec>
<sec sec-type="methods">
<title>METHODS</title>
<sec>
<title>Clinical specimens</title>
<p>This studied included 22 coronary AS patients (16 males and 6 females; 9 cases aged &#8804; 50; 13 cases aged &#62; 50) with coronary endarterectomy at our hospital. Clinical characteristics of patients with coronary AS were provided in <xref rid="T1" ref-type="table">Table 1</xref>. The healthy control group included 13 patients (6 males and 7 females; 5 cases aged &#8804; 50; 8 cases aged &#62; 50) who underwent physical examinations in the same period at our hospital. The patients with complications or infections of liver or kidney, diabetes, or tumors were excluded. The Gensini scoring system was applied to evaluate the degree of AS. Written informed consent was obtained from all participants. The study complied with the Declaration of Helsinki and was approved by the Ethics Committee of The Affiliated Huaian No. 1 People&#8217;s Hospital of Nanjing Medical University (IRB: 2016-045, Jiangsu, China).</p>
<p>Plaque tissues and adjacent intimal tissues were taken by coronary endarterectomy and then stored in liquid nitrogen. Peripheral blood was collected, and serum was separated by centrifugation at 400 g for 10 min.</p>
</sec><sec>
<title>Cell culture and transfection</title>
<p>VSMCs were dissected from perioperative aortic punch samples of participating patients as previous study described [<xref rid="ref19" ref-type="bibr">19</xref>]. The dissected VSMCs were then cultured in Dulbecco&#39;s modified Eagle&#39;s medium (DMEM; Sigma-Aldrich, St. Louis, MO, USA) supplemented with 10% Gibco fetal bovine serum (FBS; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and 100 &#181;g/ml penicillin-streptomycin (Sigma-Aldrich) at 37&#176;C and 5% CO<sub>2</sub>. The 10 nM miR-491-5p mimics were used for miR-491-5p overexpression and an equal quantity of miR-491-5p antagomir was used for miR-370 downregulation. Simultaneously, NC mimics and NC antagomir was used in the present study. To downregulate UBE2G2, SLC16A3, and PNO1 expression, short hairpin RNAs targeting UBE2G2, SLC16A3, and PNO1 (sh-UBE2G2, sh-SLC16A3, and sh-PNO1) were used. The miR-491-5p mimic, miR-491-5p antagomir, sh-UBE2G2, sh-SLC16A3, sh-PNO1, and their relevant controls were all synthesized by GenePharma (Shanghai, China). Cell transfections were conducted for 48 h using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA).</p>
</sec><sec>
<title>Reverse transcription quantitative polymerase chain reaction</title>
<p>Total RNA was extracted using TRIzol reagent (Invitrogen). Synthetic spike-in miRNAs (MiRXES, Singapore) was prepared for miRNAs to obtain RNA samples, which was then reverse transcribed into cDNA. Reverse transcription quantitative polymerase chain reaction (RT-qPCR) analysis was performed using mSMRT-qPCR miRNA assay platform (MiRXES, Singapore). The relative expression levels of miRNAs were normalized to U6, and the relative expression levels of mRNAs were normalized to GAPDH, which were all quantified using the 2<sup>&#8722;&#916;&#916;Cq</sup> method. Sequences of primers are provided in <xref rid="T2" ref-type="table">Table 2</xref>.</p>
</sec><sec>
<title>Western blot analysis</title>
<p>Total protein extraction was performed, and the protein concentration was measured. Proteins (25 &#181;g) were then loaded on 10% SDS-PAGE and transferred onto PVDF membranes. After blocking with non-fat milk (5%) at room temperature for 1 h, the membranes were then incubated with the primary antibodies below at 4&#176;C overnight: UBE2G2 (ab174296; 1:1,000; Abcam, Shanghai, China), SLC16A3 (ab244385; 1:1,000; Abcam), POLR2C (ab182150; 1:100; Abcam), PNO1 (ab227978; 1:1,000; Abcam), AMDHD2 (ab133306; 1:1,000; Abcam), &#945;-SMA (ab5831; 1:1,000; Abcam), calponin (ab46794; 1:5,000; Abcam), SM22&#945; (ab14106; 1:1,000; Abcam), smoothelin (ab8969; 1:100; Abcam), GAPDH (as a loading control; ab8245; 1:500; Abcam). Subsequently, the secondary antibody of HRP-conjugated goat anti-rabbit IgG (1:3,000) was added and incubated at room temperature for 1 h. Finally, the protein bands were detected by the ECL Plus Kit (Pierce, Rockford, IL, USA), The relative protein expression was analyzed using ImageJ software 1.4.</p>
</sec><sec>
<title>RNA pull down assay</title>
<p>Bio miR-491-5p and Bio NC were co&#8208;transfected to VSMCs for 2 days. VSMCs (1 &#215; 10<sup>7</sup>) were dissolved in the soft lysis buffer plus RNasin (80 U/ml; Promega, Madison, WI, USA). Subsequently, streptavidin agarose beads (Life Technologies, Rockville, MD, USA) were incubated with the reaction mixture for 1 h at room temperature. RT-qPCR was prepared to evaluate the co-precipitated RNAs.</p>
</sec><sec>
<title>Cell counting kit-8 assay</title>
<p>VSMCs were seeded in 96-well plates (5 &#215; 10<sup>3</sup> cells/well) for 24 h at 37&#176;C and then used to assess cell proliferation. After the transfection, the cell proliferation value was measured by a cell counting kit 8 (CCK-8 kit; Thermo Fisher Scientific, Inc.) at 24, 48, and 72 h. CCK-8 reagent (10 &#181;l) was then added and incubated at 37&#176;C for 1 h. Subsequently, the optical density was measured at 450 nm.</p>
</sec><sec>
<title>Wound healing assay</title>
<p>VSMCs were cultured in 6-well plates and cultured for 24 h. Subsequently, the parallel lines were scratched on the cell culture plate with a 200 &#181;l pipette tip. Following washing with PBS three times, cells were cultured in serum-free DMEM for an additional 48 h. The wounded gaps were photographed at different time points (0 and 24 h).</p>
</sec><sec>
<title>Statistical analyses</title>
<p>Data are shown as the mean &#177; standard deviation. The Student&#8217;s t-test was used to assess the differences between two groups. Two-way ANOVA was conducted for difference comparison in groups with two independent variables. All data were statistically analyzed by the SPSS 21.0 (IBM Co., Armonk, NY, USA) statistical software. p-values of less than 0.05 was defined as significant.</p>
</sec></sec>
<sec sec-type="results">
<title>RESULTS</title>
<sec>
<title>Expression of 10 mRNAs in plaques and adjacent intimal tissues from AS patients</title>
<p>According to the gene profiling by array results of GSE132651 which determined differences in blood outgrowth endothelial cells from subjects with normal or abnormal coronary endothelial function, top ten genes were differentially expressed (<xref rid="T3" ref-type="table">Table 3</xref>). Subsequently, we measured the expression levels of UBE2G2, SNORD45C, SNORD45A, SNORD45B, RABGGTB, SLC16A3, POLR2C, PNO1, CEMP1, AMDHD2 using RT-qPCR. The levels of UBE2G2, SNORD45C, SNORD45A, SLC16A3, POLR2C, PNO1, AMDHD2 in plaques from coronary AS patients were significantly higher than those in adjacent intima. On the contrary, CEMP1 expression was downregulated in plaques from coronary AS patients, compared with that in adjacent intima. However, the expression levels of SNORD45B and RABGGTB had no significant difference in plaques and adjacent intima from coronary AS patients (<xref rid="F1" ref-type="fig">Fig. 1A</xref>). Only mRNAs (UBE2G2, SNORD45C, SNORD45A, SLC16A3, POLR2C, PNO1, CEMP1, AMDHD2) with significant difference were listed in <xref rid="F1" ref-type="fig">Fig. 1B</xref>.</p>
</sec><sec>
<title>Expression of 10 mRNAs in serum from AS patients and healthy controls</title>
<p>The levels of UBE2G2, SNORD45B, RABGGTB, SLC16A3, POLR2C, PNO1, and AMDHD2 in the serum of coronary AS patients were significantly higher than those in the serums of healthy patients. While the expression levels of SNORD45C, SNORD45A, and CEMP1 had no significant difference in the serum of coronary AS patients and healthy patients (<xref rid="F2" ref-type="fig">Fig. 2A</xref>). In <xref rid="F2" ref-type="fig">Fig. 2B</xref>, mRNAs (UBE2G2, SNORD45B, RABGGTB, SLC16A3, POLR2C, PNO1, and AMDHD2) with significant difference were listed.</p>
</sec><sec>
<title>Potential upstream miRNAs for the abnormally expressed mRNAs</title>
<p>We found that five mRNAs (UBE2G2, SLC16A3, POLR2C, PNO1, and AMDHD2) were significantly abnormally expressed in both plaques and serums from subjects with coronary AS. TargetScan was used to predict the potential upstream miRNAs of these five genes, and 11 common miRNAs (hsa-miR-491-5p, hsa-miR-4645-5p, hsa-miR-4673, hsa-miR-6791-5p, hsa-miR-6727-3p, hsa-miR-6747-3p, hsa-miR-4308, hsa-miR-4722-3p, hsa-miR-4292, hsa-miR-6852-5p, and hsa-miR-7160-5p) were identified (<xref rid="F3" ref-type="fig">Fig. 3A</xref>). We them examined the expression levels of these miRNAs using RT-qPCR. Only miR-491-5p showed significantly downregulated expression in plaques from coronary AS patients, compared with that in adjacent intima (<xref rid="F3" ref-type="fig">Fig. 3B</xref>). MiR-491-5p expression was also decreased in the serum of coronary AS patients, compared with that in the serums of healthy patients (<xref rid="F3" ref-type="fig">Fig. 3C</xref>). Collectively, miR-491-5p was a potential upstream miRNA for abnormally expressed UBE2G2, SLC16A3, POLR2C, PNO1, and AMDHD2.</p>
</sec><sec>
<title>MiR-491-5p negatively regulates UBE2G2, SLC16A3, PNO1 expression in VSMCs</title>
<p>To confirm the predicted regulatory role of miR-491-5p on target genes, we conducted the subsequent experiments in VSMCs separated from the aortic wall sections of coronary AS patients. According to the results of RT-qPCR, miR-491-5p expression was higher in the VSMCs transfected with miR-491-5p mimics than that in the control group (<xref rid="F4" ref-type="fig">Fig. 4A</xref>). mRNA expression and protein levels of UBE2G2, SLC16A3 and PNO1 were significant downregulated in the cells transfected with miR-491-5p mimics, compared with those in the control group, as evaluated by RT-qPCR and western blotting, respectively (<xref rid="F4" ref-type="fig">Fig. 4B, C</xref>). However, the mRNA expression and protein levels of POLR2C and AMDHD2 had no significant difference in the cells transfected with miR-491-5p mimics and NC mimics. Similarly, RNA pull down assay revealed that the expression levels of UBE2G2, SLC16A3 and PNO1 were upregulated in VSMCs transfected with Bio miR-491-5p, compared with those in control groups (<xref rid="F4" ref-type="fig">Fig. 4D</xref>). These results indicated that the expression levels of UBE2G2, SLC16A3 and PNO1 were negatively regulated by miR-491-5p.</p>
</sec><sec>
<title>MiR-491-5p inhibits viability, migration, and increased expression of contractile markers in VSMCs</title>
<p>The function of miR-491-5p in VSMCs was then explored. CCK-8 revealed that the viability was suppressed in VSMCs transfected with miR-491-5p mimics, compared with that in control group (<xref rid="F5" ref-type="fig">Fig. 5A</xref>). According to the results of the wound healing assay, the migration capacity was decreased in VSMCs transfected with miR-491-5p mimics, compared with that in control group (<xref rid="F5" ref-type="fig">Fig. 5B</xref>). Importantly, the protein levels of contractile markers in VSMCs were elevated by miR-491-5p mimics (<xref rid="F5" ref-type="fig">Fig. 5C</xref>). These results suggested that miR-491-5p inhibited viability, migration, and increased expression of contractile markers in VSMCs.</p>
</sec><sec>
<title>MiR-491-5p antagomir promotes viability, migration, and increased expression of contractile markers in VSMCs</title>
<p>To further confirm the function of miR-491-5p and its target genes UBE2G2, SLC16A3, and PNO1 in VSMCs, miR-491-5p antagomir, sh-UBE2G2, sh-SLC16A3, and sh-PNO1 were transfected in VSMCs and NC antagomir and sh-NC were used as negative control. A CCK-8 assay revealed that silencing miR-491-5p in VSMCs significantly promoted cell proliferation when compared with the control group at 24, 48, and 72 h, while UBE2G2, SLC16A3 and PNO1 knockdown partially reversed the changes (<xref rid="F6" ref-type="fig">Fig. 6A</xref>). Wound healing assay was performed to assess cell migration. The results indicated that the inhibition of miR-491-5p significantly upregulated VSMCs migration. However, the upregulation was then alleviated by UBE2G2, SLC16A3, and PNO1 knockdown (<xref rid="F6" ref-type="fig">Fig. 6B</xref>). Moreover, the protein levels of &#945;-SMA, calponin, SM22&#945;, and smoothelin were suppressed by miR-491-5p antagomir, While UBE2G2, SLC16A3, and PNO1 knockdown partially restored the changes, as shown by western blotting (<xref rid="F6" ref-type="fig">Fig. 6C</xref>). Taken together, these results suggested that miR-491-5p silencing promotes VSMCs proliferation and migration but inhibits the expression of contractile markers. However, UBE2G2, SLC16A3, and PNO1 knockdown reversed the changes induced by miR-491-5p silencing.</p>
</sec></sec>
<sec sec-type="discussion">
<title>DISCUSSION</title>
<p>In our study, we first confirmed ten potential mRNAs that were differentially expressed in blood outgrowth endothelial cells from subjects with normal or abnormal coronary endothelial function, according to the gene profiling by array results of GSE132651. After evaluating their expression levels, we found that expression of five mRNAs (UBE2G2, SLC16A3, POLR2C, PNO1, and AMDHD2) had significant difference in both plaques and serum from coronary AS patients, compared with those in adjacent intimal tissues from coronary AS patients or serum from healthy controls. TargetScan then predicted 11 common upstream miRNAs of these mRNAs. Notably, only miR-491-5p showed significantly downregulated expression levels in plaques and serum from coronary AS patients, compared with those in adjacent intimal tissues from coronary AS patients or serum from healthy controls.</p>
<p>MiRNAs are short (approximately 24 nucleotides), noncoding RNAs that bind to the 3&#8217; untranslated region of targeted mRNAs and induce degradation or translational inhibition [<xref rid="ref20" ref-type="bibr">20</xref>]. To date, numerous studies have shown that miRNAs are effective regulators of VSMC differentiation [<xref rid="ref21" ref-type="bibr">21</xref><xref rid="ref22" ref-type="bibr"/><xref rid="ref23" ref-type="bibr"/>-<xref rid="ref24" ref-type="bibr">24</xref>]. These miRNAs regulate the VSMC differentiation and coronary AS mainly through the modulation of target gene expression [<xref rid="ref3" ref-type="bibr">3</xref>,<xref rid="ref25" ref-type="bibr">25</xref>,<xref rid="ref26" ref-type="bibr">26</xref>]. Previous studies have reported several miRNA-mRNA regulatory networks in AS [<xref rid="ref27" ref-type="bibr">27</xref><xref rid="ref28" ref-type="bibr"/>-<xref rid="ref29" ref-type="bibr">29</xref>]. For instance, upregulated miR-93 contributes to coronary AS pathogenesis through targeting ABCA1 [<xref rid="ref30" ref-type="bibr">30</xref>]. MiR-126 represses the progression of coronary AS in the mice by binding to S1PR2 [<xref rid="ref31" ref-type="bibr">31</xref>]. MiR-491-5p has been once explored in VSMCs in a previous study, which demonstrates its inhibitory role on the growth and migration of VSMCs by binding with <italic>MMP-9</italic> gene, indicating the involvement of miR-491-5p in AS development [<xref rid="ref17" ref-type="bibr">17</xref>]. Particularly, we found three mRNAs UBE2G2, SLC16A3, and PNO1 that were negatively regulated by miR-491-5p, which were not mentioned in any previous research. Mechanically, UBE2G2, SLC16A3, and PNO1 were validated as the targets downstream miR-491-5p, indicating that the upregulation of UBE2G2, SLC16A3, and PNO1 in plaques and serum from AS patients was induced by the downregulation of miR-491-5p. Furthermore, the functions of miR-491-5p, UBE2G2, SLC16A3, and PNO1 in smooth muscle cells were assessed. Notably, we found that miR-491-5p overexpression inhibited viability, migration, and increased the expression of contractile markers &#945;-SMA, calponin, SM22&#945;, and smoothelin in VSMCs. The increase of these contraction markers suggests that miR-491-5p overexpression promoted the differentiation of phenotypic proteins, which is a key element in AS development because the synthetic phenotype of VSMCs can migrate, proliferate, and generate extracellular matrix proteins [<xref rid="ref5" ref-type="bibr">5</xref>]. Inversely, silencing miR-491-5p significantly promoted VSMCs viability and migration, and inhibited the expression of &#945;-SMA, calponin, SM22&#945;, and smoothelin in VSMCs. However, UBE2G2, SLC16A3, and PNO1 knockdown reversed the changes induced by miR-491-5p antagomir.</p>
<p>In conclusion, this study revealed the differentially expressed mRNAs and their upstream miR-491-5p in patients with coronary atherosclerosis. We also found that miR-491-5p inhibited viability, migration, and increased expression of contractile markers via regulating target genes UBE2G2, SLC16A3, and PNO1 in VSMCs. These results might provide a novel insight into the molecular mechanisms underlying the miRNA-controlled VSMCs dysfunctions in diagnostic and therapeutic approaches against coronary AS.</p>
</sec>
</body>
<back>
<ack>
<title>ACKNOWLEDGEMENTS</title>
<p>None.</p>
</ack>
<fn-group>
<fn fn-type="supported-by">
<p><bold>FUNDING</bold></p>
<p>None to declare.</p>
</fn>
<fn fn-type="conflict">
<p><bold>CONFLICTS OF INTEREST</bold></p>
<p>The authors declare no conflicts of interest.</p>
</fn>
</fn-group>
<ref-list>
<title>REFERENCES</title>
<ref id="ref1">
<label>1</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Ou</surname><given-names>H</given-names></name>
<name><surname>Liu</surname><given-names>C</given-names></name>
<name><surname>Feng</surname><given-names>W</given-names></name>
<name><surname>Xiao</surname><given-names>X</given-names></name>
<name><surname>Tang</surname><given-names>S</given-names></name>
<name><surname>Mo</surname><given-names>Z</given-names></name>
</person-group>
<year>2018</year>
<article-title>Role of AMPK in atherosclerosis via autophagy regulation</article-title>
<source>Sci China Life Sci</source>
<volume>61</volume>
<fpage>1212</fpage>
<lpage>1221</lpage>
<pub-id pub-id-type="doi">10.1007/s11427-017-9240-2</pub-id>
<pub-id pub-id-type="pmid">29656339</pub-id>
</element-citation>
</ref>
<ref id="ref2">
<label>2</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Boudoulas</surname><given-names>KD</given-names></name>
<name><surname>Triposciadis</surname><given-names>F</given-names></name>
<name><surname>Geleris</surname><given-names>P</given-names></name>
<name><surname>Boudoulas</surname><given-names>H</given-names></name>
</person-group>
<year>2016</year>
<article-title>Coronary atherosclerosis: pathophysiologic basis for diagnosis and management</article-title>
<source>Prog Cardiovasc Dis</source>
<volume>58</volume>
<fpage>676</fpage>
<lpage>692</lpage>
<pub-id pub-id-type="doi">10.1016/j.pcad.2016.04.003</pub-id>
<pub-id pub-id-type="pmid">27091673</pub-id>
</element-citation>
</ref>
<ref id="ref3">
<label>3</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Bennett</surname><given-names>MR</given-names></name>
<name><surname>Sinha</surname><given-names>S</given-names></name>
<name><surname>Owens</surname><given-names>GK</given-names></name>
</person-group>
<year>2016</year>
<article-title>Vascular smooth muscle cells in atherosclerosis</article-title>
<source>Circ Res</source>
<volume>118</volume>
<fpage>692</fpage>
<lpage>702</lpage>
<pub-id pub-id-type="doi">10.1161/CIRCRESAHA.115.306361</pub-id>
<pub-id pub-id-type="pmid">26892967</pub-id>
<pub-id pub-id-type="pmcid">PMC4762053</pub-id>
</element-citation>
</ref>
<ref id="ref4">
<label>4</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Wang</surname><given-names>J</given-names></name>
<name><surname>Uryga</surname><given-names>AK</given-names></name>
<name><surname>Reinhold</surname><given-names>J</given-names></name>
<name><surname>Figg</surname><given-names>N</given-names></name>
<name><surname>Baker</surname><given-names>L</given-names></name>
<name><surname>Finigan</surname><given-names>A</given-names></name>
<name><surname>Gray</surname><given-names>K</given-names></name>
<name><surname>Kumar</surname><given-names>S</given-names></name>
<name><surname>Clarke</surname><given-names>M</given-names></name>
<name><surname>Bennett</surname><given-names>M</given-names></name>
</person-group>
<year>2015</year>
<article-title>Vascular smooth muscle cell senescence promotes atherosclerosis and features of plaque vulnerability</article-title>
<source>Circulation</source>
<volume>132</volume>
<fpage>1909</fpage>
<lpage>1919</lpage>
<pub-id pub-id-type="doi">10.1161/CIRCULATIONAHA.115.016457</pub-id>
<pub-id pub-id-type="pmid">26416809</pub-id>
</element-citation>
</ref>
<ref id="ref5">
<label>5</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Johnson</surname><given-names>JL</given-names></name>
</person-group>
<year>2014</year>
<article-title>Emerging regulators of vascular smooth muscle cell function in the development and progression of atherosclerosis</article-title>
<source>Cardiovasc Res</source>
<volume>103</volume>
<fpage>452</fpage>
<lpage>460</lpage>
<pub-id pub-id-type="doi">10.1093/cvr/cvu171</pub-id>
<pub-id pub-id-type="pmid">25053639</pub-id>
</element-citation>
</ref>
<ref id="ref6">
<label>6</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Hutcheson</surname><given-names>JD</given-names></name>
<name><surname>Goettsch</surname><given-names>C</given-names></name>
<name><surname>Bertazzo</surname><given-names>S</given-names></name>
<name><surname>Maldonado</surname><given-names>N</given-names></name>
<name><surname>Ruiz</surname><given-names>JL</given-names></name>
<name><surname>Goh</surname><given-names>W</given-names></name>
<name><surname>Yabusaki</surname><given-names>K</given-names></name>
<name><surname>Faits</surname><given-names>T</given-names></name>
<name><surname>Bouten</surname><given-names>C</given-names></name>
<name><surname>Franck</surname><given-names>G</given-names></name>
<name><surname>Quillard</surname><given-names>T</given-names></name>
<name><surname>Libby</surname><given-names>P</given-names></name>
<name><surname>Aikawa</surname><given-names>M</given-names></name>
<name><surname>Weinbaum</surname><given-names>S</given-names></name>
<name><surname>Aikawa</surname><given-names>E</given-names></name>
</person-group>
<year>2016</year>
<article-title>Genesis and growth of extracellular-vesicle-derived microcalcification in atherosclerotic plaques</article-title>
<source>Nat Mater</source>
<volume>15</volume>
<fpage>335</fpage>
<lpage>343</lpage>
<pub-id pub-id-type="doi">10.1038/nmat4519</pub-id>
<pub-id pub-id-type="pmid">26752654</pub-id>
<pub-id pub-id-type="pmcid">PMC4767675</pub-id>
</element-citation>
</ref>
<ref id="ref7">
<label>7</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Jiang</surname><given-names>XI</given-names></name>
<name><surname>Luo</surname><given-names>Y</given-names></name>
<name><surname>Zhao</surname><given-names>S</given-names></name>
<name><surname>Chen</surname><given-names>Q</given-names></name>
<name><surname>Jiang</surname><given-names>C</given-names></name>
<name><surname>Dai</surname><given-names>Y</given-names></name>
<name><surname>Chen</surname><given-names>Y</given-names></name>
<name><surname>Cao</surname><given-names>Z</given-names></name>
</person-group>
<year>2015</year>
<article-title>Clinical significance and expression of microRNA in diabetic patients with erectile dysfunction</article-title>
<source>Exp Ther Med</source>
<volume>10</volume>
<fpage>213</fpage>
<lpage>218</lpage>
<pub-id pub-id-type="doi">10.3892/etm.2015.2443</pub-id>
<pub-id pub-id-type="pmid">26170937</pub-id>
<pub-id pub-id-type="pmcid">PMC4486873</pub-id>
</element-citation>
</ref>
<ref id="ref8">
<label>8</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Zhu</surname><given-names>N</given-names></name>
<name><surname>Zhang</surname><given-names>D</given-names></name>
<name><surname>Chen</surname><given-names>S</given-names></name>
<name><surname>Liu</surname><given-names>X</given-names></name>
<name><surname>Lin</surname><given-names>L</given-names></name>
<name><surname>Huang</surname><given-names>X</given-names></name>
<name><surname>Guo</surname><given-names>Z</given-names></name>
<name><surname>Liu</surname><given-names>J</given-names></name>
<name><surname>Wang</surname><given-names>Y</given-names></name>
<name><surname>Yuan</surname><given-names>W</given-names></name>
<name><surname>Qin</surname><given-names>Y</given-names></name>
</person-group>
<year>2011</year>
<article-title>Endothelial enriched microRNAs regulate angiotensin II-induced endothelial inflammation and migration</article-title>
<source>Atherosclerosis</source>
<volume>215</volume>
<fpage>286</fpage>
<lpage>293</lpage>
<pub-id pub-id-type="doi">10.1016/j.atherosclerosis.2010.12.024</pub-id>
<pub-id pub-id-type="pmid">21310411</pub-id>
</element-citation>
</ref>
<ref id="ref9">
<label>9</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Ambros</surname><given-names>V</given-names></name>
</person-group>
<year>2004</year>
<article-title>The functions of animal microRNAs</article-title>
<source>Nature</source>
<volume>431</volume>
<fpage>350</fpage>
<lpage>355</lpage>
<pub-id pub-id-type="doi">10.1038/nature02871</pub-id>
<pub-id pub-id-type="pmid">15372042</pub-id>
</element-citation>
</ref>
<ref id="ref10">
<label>10</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Ndrepepa</surname><given-names>G</given-names></name>
<name><surname>Colleran</surname><given-names>R</given-names></name>
<name><surname>Kastrati</surname><given-names>A</given-names></name>
</person-group>
<year>2018</year>
<article-title>Gamma-glutamyl transferase and the risk of atherosclerosis and coronary heart disease</article-title>
<source>Clin Chim Acta</source>
<volume>476</volume>
<fpage>130</fpage>
<lpage>138</lpage>
<pub-id pub-id-type="doi">10.1016/j.cca.2017.11.026</pub-id>
<pub-id pub-id-type="pmid">29175647</pub-id>
</element-citation>
</ref>
<ref id="ref11">
<label>11</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Xu</surname><given-names>Z</given-names></name>
<name><surname>Han</surname><given-names>Y</given-names></name>
<name><surname>Liu</surname><given-names>J</given-names></name>
<name><surname>Jiang</surname><given-names>F</given-names></name>
<name><surname>Hu</surname><given-names>H</given-names></name>
<name><surname>Wang</surname><given-names>Y</given-names></name>
<name><surname>Liu</surname><given-names>Q</given-names></name>
<name><surname>Gong</surname><given-names>Y</given-names></name>
<name><surname>Li</surname><given-names>X</given-names></name>
</person-group>
<year>2015</year>
<article-title>miR-135b-5p and miR-499a-3p promote cell proliferation and migration in atherosclerosis by directly targeting MEF2C</article-title>
<source>Sci Rep</source>
<volume>5</volume>
<elocation-id>12276</elocation-id>
<pub-id pub-id-type="doi">10.1038/srep12276</pub-id>
<pub-id pub-id-type="pmid">26184978</pub-id>
<pub-id pub-id-type="pmcid">PMC4505325</pub-id>
</element-citation>
</ref>
<ref id="ref12">
<label>12</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Zhang</surname><given-names>R</given-names></name>
<name><surname>Sui</surname><given-names>L</given-names></name>
<name><surname>Hong</surname><given-names>X</given-names></name>
<name><surname>Yang</surname><given-names>M</given-names></name>
<name><surname>Li</surname><given-names>W</given-names></name>
</person-group>
<year>2017</year>
<article-title>miR-448 promotes vascular smooth muscle cell proliferation and migration in through directly targeting MEF2C</article-title>
<source>Environ Sci Pollut Res Int</source>
<volume>24</volume>
<fpage>22294</fpage>
<lpage>22300</lpage>
<pub-id pub-id-type="doi">10.1007/s11356-017-9771-1</pub-id>
<pub-id pub-id-type="pmid">28799067</pub-id>
</element-citation>
</ref>
<ref id="ref13">
<label>13</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Lin</surname><given-names>B</given-names></name>
<name><surname>Feng</surname><given-names>DG</given-names></name>
<name><surname>Wang</surname><given-names>F</given-names></name>
<name><surname>Wang</surname><given-names>JX</given-names></name>
<name><surname>Xu</surname><given-names>CG</given-names></name>
<name><surname>Zhao</surname><given-names>H</given-names></name>
<name><surname>Cheng</surname><given-names>ZY</given-names></name>
</person-group>
<year>2016</year>
<article-title>miR-365 participates in coronary atherosclerosis through regulating IL-6</article-title>
<source>Eur Rev Med Pharmacol Sci</source>
<volume>20</volume>
<fpage>5186</fpage>
<lpage>5192</lpage>
<pub-id pub-id-type="pmid">28051250</pub-id>
</element-citation>
</ref>
<ref id="ref14">
<label>14</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Lu</surname><given-names>L</given-names></name>
<name><surname>Cai</surname><given-names>M</given-names></name>
<name><surname>Peng</surname><given-names>M</given-names></name>
<name><surname>Wang</surname><given-names>F</given-names></name>
<name><surname>Zhai</surname><given-names>X</given-names></name>
</person-group>
<year>2019</year>
<article-title>miR-491-5p functions as a tumor suppressor by targeting IGF2 in colorectal cancer</article-title>
<source>Cancer Manag Res</source>
<volume>11</volume>
<fpage>1805</fpage>
<lpage>1816</lpage>
<pub-id pub-id-type="doi">10.2147/CMAR.S183085</pub-id>
<pub-id pub-id-type="pmid">30863186</pub-id>
<pub-id pub-id-type="pmcid">PMC6391127</pub-id>
</element-citation>
</ref>
<ref id="ref15">
<label>15</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Guo</surname><given-names>J</given-names></name>
<name><surname>Luo</surname><given-names>C</given-names></name>
<name><surname>Yang</surname><given-names>Y</given-names></name>
<name><surname>Dong</surname><given-names>J</given-names></name>
<name><surname>Guo</surname><given-names>Z</given-names></name>
<name><surname>Yang</surname><given-names>J</given-names></name>
<name><surname>Lian</surname><given-names>H</given-names></name>
<name><surname>Ye</surname><given-names>C</given-names></name>
<name><surname>Liu</surname><given-names>M</given-names></name>
</person-group>
<year>2021</year>
<article-title>miR-491-5p, as a tumor suppressor, prevents migration and invasion of breast cancer by targeting ZNF-703 to regulate AKT/mTOR pathway</article-title>
<source>Cancer Manag Res</source>
<volume>13</volume>
<fpage>403</fpage>
<lpage>413</lpage>
<pub-id pub-id-type="doi">10.2147/CMAR.S279747</pub-id>
<pub-id pub-id-type="pmid">33488122</pub-id>
<pub-id pub-id-type="pmcid">PMC7816048</pub-id>
</element-citation>
</ref>
<ref id="ref16">
<label>16</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Sun</surname><given-names>R</given-names></name>
<name><surname>Liu</surname><given-names>Z</given-names></name>
<name><surname>Tong</surname><given-names>D</given-names></name>
<name><surname>Yang</surname><given-names>Y</given-names></name>
<name><surname>Guo</surname><given-names>B</given-names></name>
<name><surname>Wang</surname><given-names>X</given-names></name>
<name><surname>Zhao</surname><given-names>L</given-names></name>
<name><surname>Huang</surname><given-names>C</given-names></name>
</person-group>
<year>2017</year>
<article-title>miR-491-5p, mediated by Foxi1, functions as a tumor suppressor by targeting Wnt3a/&#946;-catenin signaling in the development of gastric cancer</article-title>
<source>Cell Death Dis</source>
<volume>8</volume>
<elocation-id>e2714</elocation-id>
<pub-id pub-id-type="doi">10.1038/cddis.2017.134</pub-id>
<pub-id pub-id-type="pmid">28358374</pub-id>
<pub-id pub-id-type="pmcid">PMC5386537</pub-id>
</element-citation>
</ref>
<ref id="ref17">
<label>17</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>He</surname><given-names>Z</given-names></name>
<name><surname>Wang</surname><given-names>Y</given-names></name>
<name><surname>He</surname><given-names>Q</given-names></name>
<name><surname>Chen</surname><given-names>M</given-names></name>
</person-group>
<year>2020</year>
<article-title>microRNA-491-5p protects against atherosclerosis by targeting matrix metallopeptidase-9</article-title>
<source>Open Med (Wars)</source>
<volume>15</volume>
<fpage>492</fpage>
<lpage>500</lpage>
<pub-id pub-id-type="doi">10.1515/med-2020-0047</pub-id>
<pub-id pub-id-type="pmid">33313408</pub-id>
<pub-id pub-id-type="pmcid">PMC7706122</pub-id>
</element-citation>
</ref>
<ref id="ref18">
<label>18</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Yuan</surname><given-names>M</given-names></name>
<name><surname>Zhan</surname><given-names>Q</given-names></name>
<name><surname>Duan</surname><given-names>X</given-names></name>
<name><surname>Song</surname><given-names>B</given-names></name>
<name><surname>Zeng</surname><given-names>S</given-names></name>
<name><surname>Chen</surname><given-names>X</given-names></name>
<name><surname>Yang</surname><given-names>Q</given-names></name>
<name><surname>Xia</surname><given-names>J</given-names></name>
</person-group>
<year>2013</year>
<article-title>A functional polymorphism at miR-491-5p binding site in the 3&#39;-UTR of MMP-9 gene confers increased risk for atherosclerotic cerebral infarction in a Chinese population</article-title>
<source>Atherosclerosis</source>
<volume>226</volume>
<fpage>447</fpage>
<lpage>452</lpage>
<pub-id pub-id-type="doi">10.1016/j.atherosclerosis.2012.11.026</pub-id>
<pub-id pub-id-type="pmid">23257658</pub-id>
</element-citation>
</ref>
<ref id="ref19">
<label>19</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Woo</surname><given-names>CC</given-names></name>
<name><surname>Liu</surname><given-names>W</given-names></name>
<name><surname>Lin</surname><given-names>XY</given-names></name>
<name><surname>Dorajoo</surname><given-names>R</given-names></name>
<name><surname>Lee</surname><given-names>KW</given-names></name>
<name><surname>Richards</surname><given-names>AM</given-names></name>
<name><surname>Lee</surname><given-names>CN</given-names></name>
<name><surname>Wongsurawat</surname><given-names>T</given-names></name>
<name><surname>Nookaew</surname><given-names>I</given-names></name>
<name><surname>Sorokin</surname><given-names>V</given-names></name>
</person-group>
<year>2019</year>
<article-title>The interaction between <italic>30b-5p</italic> miRNA and <italic>MBNL1</italic> mRNA is involved in vascular smooth muscle cell differentiation in patients with coronary atherosclerosis</article-title>
<source>Int J Mol Sci</source>
<volume>21</volume>
<fpage>11</fpage>
<pub-id pub-id-type="doi">10.3390/ijms21010011</pub-id>
<pub-id pub-id-type="pmid">31861407</pub-id>
<pub-id pub-id-type="pmcid">PMC6982107</pub-id>
</element-citation>
</ref>
<ref id="ref20">
<label>20</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Bartel</surname><given-names>DP</given-names></name>
</person-group>
<year>2004</year>
<article-title>MicroRNAs: genomics, biogenesis, mechanism, and function</article-title>
<source>Cell</source>
<volume>116</volume>
<fpage>281</fpage>
<lpage>297</lpage>
<pub-id pub-id-type="doi">10.1016/S0092-8674(04)00045-5</pub-id>
<pub-id pub-id-type="pmid">14744438</pub-id>
</element-citation>
</ref>
<ref id="ref21">
<label>21</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Song</surname><given-names>Z</given-names></name>
<name><surname>Li</surname><given-names>G</given-names></name>
</person-group>
<year>2010</year>
<article-title>Role of specific microRNAs in regulation of vascular smooth muscle cell differentiation and the response to injury</article-title>
<source>J Cardiovasc Transl Res</source>
<volume>3</volume>
<fpage>246</fpage>
<lpage>250</lpage>
<pub-id pub-id-type="doi">10.1007/s12265-010-9163-0</pub-id>
<pub-id pub-id-type="pmid">20543900</pub-id>
<pub-id pub-id-type="pmcid">PMC2883267</pub-id>
</element-citation>
</ref>
<ref id="ref22">
<label>22</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Chen</surname><given-names>Q</given-names></name>
<name><surname>Yang</surname><given-names>F</given-names></name>
<name><surname>Guo</surname><given-names>M</given-names></name>
<name><surname>Wen</surname><given-names>G</given-names></name>
<name><surname>Zhang</surname><given-names>C</given-names></name>
<name><surname>Luong le</surname><given-names>A</given-names></name>
<name><surname>Zhu</surname><given-names>J</given-names></name>
<name><surname>Xiao</surname><given-names>Q</given-names></name>
<name><surname>Zhang</surname><given-names>L</given-names></name>
</person-group>
<year>2015</year>
<article-title>miRNA-34a reduces neointima formation through inhibiting smooth muscle cell proliferation and migration</article-title>
<source>J Mol Cell Cardiol</source>
<volume>89</volume>
<issue>Pt A</issue>
<fpage>75</fpage>
<lpage>86</lpage>
<pub-id pub-id-type="doi">10.1016/j.yjmcc.2015.10.017</pub-id>
<pub-id pub-id-type="pmid">26493107</pub-id>
</element-citation>
</ref>
<ref id="ref23">
<label>23</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Davis-Dusenbery</surname><given-names>BN</given-names></name>
<name><surname>Wu</surname><given-names>C</given-names></name>
<name><surname>Hata</surname><given-names>A</given-names></name>
</person-group>
<year>2011</year>
<article-title>Micromanaging vascular smooth muscle cell differentiation and phenotypic modulation</article-title>
<source>Arterioscler Thromb Vasc Biol</source>
<volume>31</volume>
<fpage>2370</fpage>
<lpage>2377</lpage>
<pub-id pub-id-type="doi">10.1161/ATVBAHA.111.226670</pub-id>
<pub-id pub-id-type="pmid">22011749</pub-id>
<pub-id pub-id-type="pmcid">PMC4429757</pub-id>
</element-citation>
</ref>
<ref id="ref24">
<label>24</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Albinsson</surname><given-names>S</given-names></name>
<name><surname>Sessa</surname><given-names>WC</given-names></name>
</person-group>
<year>2011</year>
<article-title>Can microRNAs control vascular smooth muscle phenotypic modulation and the response to injury?</article-title>
<source>Physiol Genomics</source>
<volume>43</volume>
<fpage>529</fpage>
<lpage>533</lpage>
<pub-id pub-id-type="doi">10.1152/physiolgenomics.00146.2010</pub-id>
<pub-id pub-id-type="pmid">20841497</pub-id>
<pub-id pub-id-type="pmcid">PMC3110893</pub-id>
</element-citation>
</ref>
<ref id="ref25">
<label>25</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Tabas</surname><given-names>I</given-names></name>
</person-group>
<year>2010</year>
<article-title>Macrophage death and defective inflammation resolution in atherosclerosis</article-title>
<source>Nat Rev Immunol</source>
<volume>10</volume>
<fpage>36</fpage>
<lpage>46</lpage>
<pub-id pub-id-type="doi">10.1038/nri2675</pub-id>
<pub-id pub-id-type="pmid">19960040</pub-id>
<pub-id pub-id-type="pmcid">PMC2854623</pub-id>
</element-citation>
</ref>
<ref id="ref26">
<label>26</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Libby</surname><given-names>P</given-names></name>
<name><surname>Ridker</surname><given-names>PM</given-names></name>
<name><surname>Hansson</surname><given-names>GK</given-names></name>
</person-group>
<year>2011</year>
<article-title>Progress and challenges in translating the biology of atherosclerosis</article-title>
<source>Nature</source>
<volume>473</volume>
<fpage>317</fpage>
<lpage>325</lpage>
<pub-id pub-id-type="doi">10.1038/nature10146</pub-id>
<pub-id pub-id-type="pmid">21593864</pub-id>
</element-citation>
</ref>
<ref id="ref27">
<label>27</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Pordzik</surname><given-names>J</given-names></name>
<name><surname>Pisarz</surname><given-names>K</given-names></name>
<name><surname>De Rosa</surname><given-names>S</given-names></name>
<name><surname>Jones</surname><given-names>AD</given-names></name>
<name><surname>Eyileten</surname><given-names>C</given-names></name>
<name><surname>Indolfi</surname><given-names>C</given-names></name>
<name><surname>Malek</surname><given-names>L</given-names></name>
<name><surname>Postula</surname><given-names>M</given-names></name>
</person-group>
<year>2018</year>
<article-title>The potential role of platelet-related microRNAs in the development of cardiovascular events in high-risk populations, including diabetic patients: a review</article-title>
<source>Front Endocrinol (Lausanne)</source>
<volume>9</volume>
<fpage>74</fpage>
<pub-id pub-id-type="doi">10.3389/fendo.2018.00074</pub-id>
<pub-id pub-id-type="pmid">29615970</pub-id>
<pub-id pub-id-type="pmcid">PMC5869202</pub-id>
</element-citation>
</ref>
<ref id="ref28">
<label>28</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Fasolo</surname><given-names>F</given-names></name>
<name><surname>Di Gregoli</surname><given-names>K</given-names></name>
<name><surname>Maegdefessel</surname><given-names>L</given-names></name>
<name><surname>Johnson</surname><given-names>JL</given-names></name>
</person-group>
<year>2019</year>
<article-title>Non-coding RNAs in cardiovascular cell biology and atherosclerosis</article-title>
<source>Cardiovasc Res</source>
<volume>115</volume>
<fpage>1732</fpage>
<lpage>1756</lpage>
<pub-id pub-id-type="doi">10.1093/cvr/cvz203</pub-id>
<pub-id pub-id-type="pmid">31389987</pub-id>
<pub-id pub-id-type="pmcid">PMC7967706</pub-id>
</element-citation>
</ref>
<ref id="ref29">
<label>29</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Hueso</surname><given-names>M</given-names></name>
<name><surname>Mall&#233;n</surname><given-names>A</given-names></name>
<name><surname>Casas</surname><given-names>&#193;</given-names></name>
<name><surname>Guiteras</surname><given-names>J</given-names></name>
<name><surname>Sbraga</surname><given-names>F</given-names></name>
<name><surname>Blasco-Lucas</surname><given-names>A</given-names></name>
<name><surname>Lloberas</surname><given-names>N</given-names></name>
<name><surname>Torras</surname><given-names>J</given-names></name>
<name><surname>Cruzado</surname><given-names>JM</given-names></name>
<name><surname>Navarro</surname><given-names>E</given-names></name>
</person-group>
<year>2020</year>
<article-title>Integrated miRNA/mRNA counter-expression analysis highlights oxidative stress-related genes <italic>CCR7</italic> and <italic>FOXO1</italic> as blood markers of coronary arterial disease</article-title>
<source>Int J Mol Sci</source>
<volume>21</volume>
<fpage>1943</fpage>
<pub-id pub-id-type="doi">10.3390/ijms21061943</pub-id>
<pub-id pub-id-type="pmid">32178422</pub-id>
<pub-id pub-id-type="pmcid">PMC7139611</pub-id>
</element-citation>
</ref>
<ref id="ref30">
<label>30</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>He</surname><given-names>Y</given-names></name>
<name><surname>Lin</surname><given-names>L</given-names></name>
<name><surname>Cao</surname><given-names>J</given-names></name>
<name><surname>Mao</surname><given-names>X</given-names></name>
<name><surname>Qu</surname><given-names>Y</given-names></name>
<name><surname>Xi</surname><given-names>B</given-names></name>
</person-group>
<year>2015</year>
<article-title>Up-regulated miR-93 contributes to coronary atherosclerosis pathogenesis through targeting ABCA1</article-title>
<source>Int J Clin Exp Med</source>
<volume>8</volume>
<fpage>674</fpage>
<lpage>681</lpage>
<pub-id pub-id-type="pmid">25785043</pub-id>
<pub-id pub-id-type="pmcid">PMC4358498</pub-id>
</element-citation>
</ref>
<ref id="ref31">
<label>31</label>
<element-citation publication-type="journal">
<person-group person-group-type="author">
<name><surname>Fan</surname><given-names>JL</given-names></name>
<name><surname>Zhang</surname><given-names>L</given-names></name>
<name><surname>Bo</surname><given-names>XH</given-names></name>
</person-group>
<year>2020</year>
<article-title>miR-126 on mice with coronary artery disease by targeting S1PR2</article-title>
<source>Eur Rev Med Pharmacol Sci</source>
<volume>24</volume>
<fpage>893</fpage>
<lpage>904</lpage>
<pub-id pub-id-type="doi">10.26355/eurrev_202001_20074</pub-id>
<pub-id pub-id-type="pmid">32016996</pub-id>
</element-citation>
</ref>
</ref-list>
<sec sec-type="display-objects">
<title>Figures and Tables</title>
<fig id="F1" position="float">
<label>Fig. 1</label>
<caption>
<title>Expression of 10 mRNAs in plaques and adjacent intimal tissues from atherosclerosis (AS) patients.</title>
<p>(A) Expression levels of ten mRNAs (UBE2G2, SNORD45C, SNORD45A, SNORD45B, RABGGTB, SLC16A3, POLR2C, PNO1, CEMP1, AMDHD2) in plaques and adjacent intima from coronary AS patients were measured using RT-qPCR with pared t-test, as presented by the scatter diagram. (B) mRNAs (UBE2G2, SNORD45C, SNORD45A, SLC16A3, POLR2C, PNO1, CEMP1, AMDHD2) with significant difference were listed in the bar graph. *p &#60; 0.05, **p &#60; 0.01, NS indicates no significance.</p>
</caption>
<graphic xlink:href="kjpp-26-3-183-f1.tif"/>
</fig>
<fig id="F2" position="float">
<label>Fig. 2</label>
<caption>
<title>Expression of 10 mRNAs in serum from atherosclerosis (AS) patients and healthy controls.</title>
<p>(A) Expression levels of ten mRNAs (UBE2G2, SNORD45C, SNORD45A, SNORD45B, RABGGTB, SLC16A3, POLR2C, PNO1, CEMP1, AMDHD2) in the serum of coronary AS patients and healthy patients were measured using RT-qPCR with unpaired t-test. (B) mRNAs (UBE2G2, SNORD45C, SNORD45A, SLC16A3, POLR2C, PNO1, CEMP1, AMDHD2) with significant difference were listed. *p &#60; 0.05, **p &#60; 0.01, ***p &#60; 0.001, NS indicates no significance.</p>
</caption>
<graphic xlink:href="kjpp-26-3-183-f2.tif"/>
</fig>
<fig id="F3" position="float">
<label>Fig. 3</label>
<caption>
<title>Potential upstream miRNAs for the abnormally expressed mRNAs.</title>
<p>(A) TargetScan predicted the potential upstream miRNAs of UBE2G2, SLC16A3, POLR2C, PNO1, and AMDHD2. (B) Expression levels of 11 miRNAs in plaques and adjacent intima from coronary AS patients were examined using RT-qPCR with pared t-test. (C) Expression levels of 11 miRNAs in the serum of coronary atherosclerosis (AS) patients and healthy patients were examined using RT-qPCR with unpaired t-test. *p &#60; 0.05, **p &#60; 0.01.</p>
</caption>
<graphic xlink:href="kjpp-26-3-183-f3.tif"/>
</fig>
<fig id="F4" position="float">
<label>Fig. 4</label>
<caption>
<title>MiR-491-5p negatively regulates UBE2G2, SLC16A3, PNO1 expression in vascular smooth muscle cells (VSMCs).</title>
<p>(A) Overexpression efficiency of miR-491-5p in VSMCs was evaluated using RT-qPCR. (B) Expression levels of UBE2G2, SLC16A3, POLR2C, PNO1, and AMDHD2 in VSMCs transfected with miR-491-5p mimics and NC mimics were examined by RT-qPCR. (C) Protein levels of UBE2G2, SLC16A3, POLR2C, PNO1, and AMDHD2 in VSMCs transfected with miR-491-5p mimics and NC mimics were examined by Western blot. (D) RNA pull down assay was for detecting whether UBE2G2, SLC16A3, and PNO1 bind with miR-491-5p. *p &#60; 0.05, **p &#60; 0.01, ***p &#60; 0.001.</p>
</caption>
<graphic xlink:href="kjpp-26-3-183-f4a.tif"/>
<graphic xlink:href="kjpp-26-3-183-f4b.tif"/>
<graphic xlink:href="kjpp-26-3-183-f4c.tif"/>
</fig>
<fig id="F5" position="float">
<label>Fig. 5</label>
<caption>
<title>MiR-491-5p inhibited viability, migration, and increased expression of contractile markers in vascular smooth muscle cells (VSMCs).</title>
<p>(A) Cell counting kit 8 (CCK-8) revealed the viability in VSMCs with transfection of miR-491-5p mimics and NC mimics. (B) Wound healing was performed to detect the migration capacity of VSMCs with transfection of miR-491-5p mimics and NC mimics. (C) The protein levels of contractile markers (&#945;-SMA, calponin, SM22&#945;, and smoothelin) in VSMCs with transfection of miR-491-5p mimics and NC mimics were measured by Western blot. *p &#60; 0.05, **p &#60; 0.01.</p>
</caption>
<graphic xlink:href="kjpp-26-3-183-f5a.tif"/>
<graphic xlink:href="kjpp-26-3-183-f5b.tif"/>
</fig>
<fig id="F6" position="float">
<label>Fig. 6</label>
<caption>
<title>MiR-491-5p antagomir promotes viability, migration, and increased expression of contractile markers in vascular smooth muscle cells (VSMCs).</title>
<p>(A) CCK-8 revealed the viability in VSMCs with transfection of NC antagomir, miR-491-5p antagomir, miR-491-5p antagomir+sh-NC, miR-491-5p antagomir+sh-UBE2G2, miR-491-5p antagomir+sh-SLC16A3, and miR-491-5p antagomir+sh PNO1. (B) Wound healing was performed to detect the migration capacity of VSMCs with transfection of NC antagomir, miR-491-5p antagomir, miR-491-5p antagomir+sh-NC, miR-491-5p antagomir+sh-UBE2G2, miR-491-5p antagomir+sh- SLC16A3, and miR-491-5p antagomir+sh PNO1. (C) The protein levels of contractile markers (&#945;-SMA, calponin, SM22&#945;, and smoothelin) in VSMCs with transfection of NC antagomir, miR-491-5p antagomir, miR-491-5p antagomir+sh-NC, miR-491-5p antagomir+sh-UBE2G2, miR-491-5p antagomir+sh- SLC16A3, and miR-491-5p antagomir+sh PNO1. *p &#60; 0.05, **p &#60; 0.01.</p>
</caption>
<graphic xlink:href="kjpp-26-3-183-f6a.tif"/>
<graphic xlink:href="kjpp-26-3-183-f6b.tif"/>
</fig>
<table-wrap id="T1" position="float">
<label>Table 1</label>
<caption>
<p>Clinical characteristics of patients with coronary atherosclerosis</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th valign="middle" align="center">Parameters</th>
<th valign="middle" align="center">Cases (n)</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;" colspan="2">Age</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:20px; text-indent:-10px;">&#8804; 50</td>
<td valign="top" align="center">9</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:20px; text-indent:-10px;">&#62; 50</td>
<td valign="top" align="center">13</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;" colspan="2">Sex</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:20px; text-indent:-10px;">Female</td>
<td valign="top" align="center">6</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:20px; text-indent:-10px;">Male</td>
<td valign="top" align="center">16</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;" colspan="2">Diabetes mellitus</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:20px; text-indent:-10px;">Yes</td>
<td valign="top" align="center">10</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:20px; text-indent:-10px;">No</td>
<td valign="top" align="center">12</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;" colspan="2">Hypertension</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:20px; text-indent:-10px;">Yes</td>
<td valign="top" align="center">11</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:20px; text-indent:-10px;">No</td>
<td valign="top" align="center">11</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;" colspan="2">Hyperlipidemia</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:20px; text-indent:-10px;">Yes</td>
<td valign="top" align="center">16</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:20px; text-indent:-10px;">No</td>
<td valign="top" align="center">6</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;" colspan="2">Smoking</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:20px; text-indent:-10px;">Yes</td>
<td valign="top" align="center">14</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:20px; text-indent:-10px;">No</td>
<td valign="top" align="center">8</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;" colspan="2">Ejection fraction</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:20px; text-indent:-10px;">Good</td>
<td valign="top" align="center">12</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:20px; text-indent:-10px;">Fair</td>
<td valign="top" align="center">8</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:20px; text-indent:-10px;">Poor</td>
<td valign="top" align="center">2</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="t1fn1"><p>p-values less than 0.05 indicate statistical significance. Chi-square test was performed.</p></fn>
</table-wrap-foot>
</table-wrap>
<table-wrap id="T2" position="float">
<label>Table 2</label>
<caption>
<p>Primers used for quantitative RT-PCR</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th valign="middle" align="center">Name</th>
<th valign="middle" align="center">Sequence (5&#180;-3&#180;) Forward</th>
<th valign="middle" align="center">Sequence (5&#180;-3&#180;) Reverse</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">UBE2G2</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">GAAGGAATTGTAGCAGGCC</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">CATCAGGGTAGATGTTGGGA</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">SNORD45C</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">GATGAGTTGGCATGTATTCTG</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">GGTCTCAGAGTAATTCTAGAGC</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">SNORD45A</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">GGTCAATGATGTGTTGGCA</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">GGTCTCAGAGTAATTCTAGAGCT</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">SLC16A3</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">CATCATCCAGGTCTACCTCAC</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">GAAGTTGAGTGCCAAACCC</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">POLR2C</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">CACAGGCTTGGATTAATTCCC</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">ACTCCTCACATGTGCAGTC</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">PNO1</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">GAAAGTTCACATCCTTGGCTC</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">GGAGGATTTCCCAAGATTAGGT</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">CEMP1</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">ACCTCTAACACATCGGCTG</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">TAGTGTCATCCTGCCTGTG</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">AMDHD2</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">GAAGCTGTTCTTTGAGGAGC</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">CCAAATCCACCGTTGATCTG</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">miR-491-5p</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">GGAGTGGGGAACCCTTCC</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">GTGCAGGGTCCGAGGT</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">miR-4645-5p</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">GCGACCAGGCAAGAAATATTG</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">AGACAGTAGTTCTTGCCTGGTCCT</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">miR-4673</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">ACACTCCAGCTGGGAGGTC</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">TCGGCACTCAACTGGTCC</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">miR-6791-5p</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">AGGCGGGCAGAGAA</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">GGTCTGGCTCCGTCCG</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">miR-6727-3p</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">GCCTGCCACCUCCUCCGCA</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">CTCGGGGCAGGCGGCTGG</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">miR-6747-3p</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">GTGGAAAGAGGCAGAACA</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">GCCGCCTTCCTCTGCACCA</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">miR-4308</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">AGGTAAGAAGAAACTCCAGGGAA</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">GGGTTCAGAGGGAACTCCATT</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">miR-4722-3p</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">GGCAGGAGGGCTGTGCCAGGTTG</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">CTGCAGGGAGGTGCTGGCAGGT</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">miR-4292</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">TTTAATACGTACTTTAGCTGAATTATTCTATGTCAATG</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">AATAAATTTTGTCTTAACAAGGTAAGTTGTGAAAAG</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">miR-6852-5p</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">CCCTGGGGTTCTGAGGACATG</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">CATGTCCTCAGAACCCCAGGG</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">miR-7160-5p</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">TGCTUGAGGTCCGGGCTGTGCC</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">TGCTGAGGTCCGGGCTGTGCC</td>
</tr>
</tbody>
</table>
</table-wrap>
<table-wrap id="T3" position="float">
<label>Table 3</label>
<caption>
<p>Top 10 genes that are differentially expressed in blood outgrowth endothelial cells from subjects with normal or abnormal coronary endothelial function</p>
</caption>
<table frame="hsides" rules="groups">
<thead>
<tr>
<th valign="middle" align="center">Gene symbol</th>
<th valign="middle" align="center">Chromosome location</th>
<th valign="middle" align="center">Gene title</th>
<th valign="middle" align="center">p-value</th>
</tr>
</thead>
<tbody>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">UBE2G2</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">21q22.3</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">Ubiquitin conjugating enzyme E2 G2</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">0.0000145</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">SNORD45C</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">1p31.1</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">Small nucleolar RNA, C/D box 45C</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">0.0000151</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">SNORD45A</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">1p31.1</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">Small nucleolar RNA, C/D box 45A</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">0.0000151</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">SNORD45B</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">1p31.1</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">Small nucleolar RNA, C/D box 45B</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">0.0000151</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">RABGGTB</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">1p31</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">Rab geranylgeranyltransferase beta subunit</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">0.0000151</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">SLC16A3</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">17q25</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">Solute carrier family 16 member 3</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">0.0000213</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">POLR2C</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">16q13-q21</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">RNA polymerase II subunit C</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">0.0000223</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">PNO1</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">2p14</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">Partner of NOB1 homolog</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">0.0000265</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">CEMP1</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">16p13.3</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">Cementum protein 1</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">0.0000299</td>
</tr>
<tr>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">AMDHD2</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">16p13.3</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">Amidohydrolase domain containing 2</td>
<td valign="top" align="left" style="padding-left:10px; text-indent:-10px;">0.0000299</td>
</tr>
</tbody>
</table>
<table-wrap-foot>
<fn id="t3fn1"><p>Data were downloaded from GSE132651.</p></fn>
</table-wrap-foot>
</table-wrap>
</sec>
</back>
</article>