jvs Journal of Veterinary Science J Vet Sci 1229-845X 1976-555X Korean Society of Veterinary Science 10.4142/jvs.2020.21.e22 jvs-21-e22 Original Article Establishment of multiplex RT-PCR for differentiation between rabies virus with and that without mutation at position 333 of glycoprotein YangDong-Kun * KimHa-Hyun LeeSiu YooJae-Young Viral Disease Research Division, Animal and Plant Quarantine Agency, Ministry of Agriculture, Food and Rural Affairs, Gimcheon 39660, Korea Corresponding author: Dong-Kun Yang OIE Reference Laboratory for Rabies, Viral Disease Research Division, Animal and Plant Quarantine Agency, 177 Hyeoksin 8-ro, Gimcheon 39660, Korea. E-mail: yangdk@korea.kr

Conflict of Interest The authors declare no conflicts of interest.

 03 2020 04 03 2020 21 2 e22 03052019 19082019 30122019 Copyright © 2020 The Korean Society of Veterinary Science 2020 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract

Rabid raccoon dogs (Nyctereutes procyonoides koreensis) have been responsible for animal rabies in South Korea since the 1990s. A recombinant rabies vaccine strain, designated as ERAGS, was constructed for use as a bait vaccine. Therefore, new means of differentiating ERAGS from other rabies virus (RABV) strains will be required in biological manufacturing and diagnostic service centers. In this study, we designed two specific primer sets for differentiation between ERAGS and other RABVs based on mutation in the RABV glycoprotein gene. Polymerase chain reaction analysis of the glycoprotein gene revealed two DNA bands of 383 bp and 583 bp in the ERAGS strain but a single DNA band of 383 bp in the field strains. The detection limits of multiplex reverse transcription polymerase chain reaction (RT-PCR) were 80 and 8 FAID50/reaction for the ERAGS and Evelyn-Rokitnicki-Abelseth strains, respectively. No cross-reactions were detected in the non-RABV reference viruses, including canine distemper virus, parvovirus, canine adenovirus type 1 and 2, and parainfluenza virus. The results of multiplex RT-PCR were 100% consistent with those of the fluorescent antibody test. Therefore, one-step multiplex RT-PCR is likely useful for differentiation between RABVs with and those without mutation at position 333 of the RABV glycoprotein gene.

 Rabies virus RT-PCR detection References Walker PJ Blasdell KR Calisher CH Dietzgen RG Kondo H Kurath G Longdon B Stone DM Tesh RB Tordo N Vasilakis N Whitfield AE Ictv Report Consortium ICTV virus taxonomy profile: rhabdoviridade J Gen Virol 2018 99 447448 Knipe DM Howley PM Griffin DE Lamb RA Martin MA Roizman B Straus SE Field Virology Lippincott Williams & Wilkins Philadelphia 2001 Morimoto K Hooper DC Spitsin S Koprowski H Dietzschold B Pathogenicity of different rabies virus variants inversely correlates with apoptosis and rabies virus glycoprotein expression in infected primary neuron cultures J Virol 1999 73 510518 Seif I Coulon P Rollin PE Flamand A Rabies virulence: effect on pathogenicity and sequence characterization of rabies virus mutations affecting antigenic site III of the glycoprotein J Virol 1985 53 926934 Faber M Faber ML Papaneri A Bette M Weihe E Dietzschold B Schnell MJ A single amino acid change in rabies virus glycoprotein increases virus spread and enhances virus pathogenicity J Virol 2005 79 1414114148 Huang Y Tang Q Rayner S Gong K Song B Liang GD Pathogenicity of rabies viruses isolated in China: two fixed strains and a street strain Biomed Environ Sci 2013 26 552561 Lawson KF Crawley JF The ERA strain of rabies vaccine Can J Comp Med 1972 36 339344 Tao L Ge J Wang X Zhai H Hua T Zhao B Kong D Yang C Chen H Bu Z Molecular basis of neurovirulence of flury rabies virus vaccine strains: importance of the polymerase and the glycoprotein R333Q mutation J Virol 2010 84 89268936 Le Blois H Tuffereau C Blancou J Artois M Aubert A Flamand A Oral immunization of foxes with avirulent rabies virus mutants Vet Microbiol 1990 23 259266 Sato G Kobayashi Y Motizuki N Hirano S Itou T Cunha EM Ito FH Sakai T A unique substitution at position 333 on the glycoprotein of rabies virus street strains isolated from non-hematophagous bats in Brazil Virus Genes 2009 38 7479 Madhusudana SN Tripathi KK Oral infectivity of street and fixed rabies virus strains in laboratory animals Indian J Exp Biol 1990 28 497499 Yang DK Kim HH Lee KW Song JY The present and future of rabies vaccine in animals Clin Exp Vaccine Res 2013 2 1925 World Organization for Animal Health (OIE) Manual of Diagnostic Tests and Vaccines for Terrestrial Animals 7th ed. OIE Paris 2012 Yang DK Kim HH Choi SS Kim JT Lee KB Lee SH Cho IS Safety and immunogenicity of recombinant rabies virus (ERAGS) in mice and raccoon dogs Clin Exp Vaccine Res 2016 5 159168 Franka R Wallace R Rabies diagnosis and surveillance in animals in the era of rabies elimination Rev Sci Tech 2018 37 359370 Nakagawa K Nakagawa K Omatsu T Katayama Y Oba M Mitake H Okada K Yamaoka S Takashima Y Masatani T Okadera K Ito N Mizutani T Sugiyama M Generation of a novel live rabies vaccine strain with a high level of safety by introducing attenuating mutations in the nucleoprotein and glycoprotein Vaccine 2017 35 56225628 Tian Q Wang Y Zhang Q Luo J Mei M Luo Y Guo X Rescue of a wild-type rabies virus from cloned cDNA and assessment of the proliferative capacity of recombinant viruses Virus Genes 2017 53 573583 Deubellbeiss A Zahno ML Zanoni M Bruegger D Zanoni R Real-time RT-PCR for the detection of Lyssavirus species J Vet Med 2014 2014 476091 Picard-Meyer E Peytavin de Garam C Schereffer JL Robardet E Cliquet F Evaluation of six TaqMan RT-rtPCR kits on two thermocyclers for the reliable detection of rabies virus RNA J Vet Diagn Invest 2019 31 4757 Wittwer CT Herrmann MG Gundry CN Elenitoba-Johnson KS Real-time multiplex PCR assays Methods 2001 25 430442 Figures and Tables

RABV G gene sites targeted by the primers used for differential RT-PCR. The first three nucleotides (TCC) of the ERAGS reverse primer, corresponding to codon 333 of the G gene, were not identical to those (AAT) of the Evelyn-Rokitnicki-Abelseth strain or KRVB1206 isolate.

Sensitivity of the specific primer sets used for differential detection of ERAGS and ERA strains. M, 100 bp DNA ladder; lanes 1–8, ERAGS strain 100–10-7 (A). M, 100 bp DNA ladder; lanes 9–16, ERA strain 100–10-7 (B). ERA, Evelyn-Rokitnicki-Abelseth.

Specificity of differential RABV RT-PCR using two primer sets. RT-PCR detected only RABVs, and no positive signals were obtained for the five canine viral pathogens. M, 100 bp DNA ladder; lane 1, canine distemper virus; lane 2, canine parainfluenza virus; lane 3, canine adenovirus type 1; lane 4, canine adenovirus type 2; lane 5, canine parvovirus; lane 6, CVS11; lane 7, Evelyn-Rokitnicki-Abelseth strain; lane 8, ERAGS strain; lane N, negative control (water only). RT-PCR, reverse transcription polymerase chain reaction.

Application of multiplex reverse transcription polymerase chain reaction to positive (A) and negative (B) samples. M, 100 bp DNA ladder; lanes 1–6, FAT-positive samples; lane P1, CVS11; lane P2, Evelyn-Rokitnicki-Abelseth strain; lane P3, ERAGS strain; lanes 7–12, FAT-negative samples; lane N, negative control (water only). FAT, fluorescent antibody test.

Two specific primer sets for differentiation between ERAGS and fixed strains by multiplex reverse transcription polymerase chain reaction

Designation Oligonucleotide Expected size (bp) Target gene Remarks
RABVcomF CCCTCCTY* CAGCAACATATGGAG 383 G All RABV
RABVcomR TCACAGTCTGGTCTCACCR* CC      
ERAGS-F ACCAGACAAGCTTGGTCCCTGG 583 G ERAGS only
ERAGS-R GGA† TGCTCTCTTCCCTCTACTGGA      

Y: C or T; R: A or G;

GGA: nucleotide sequence of glutamine at position 333 of the G protein.

Infectivity titer equivalent of multiplex RT-PCR for detection of rabies virus

Virus dilution Infectivity titer equivalent* Multiplex RT-PCR result
ERAGS/ERA (583/383 bp) ERA (583/383 bp)
100 80,000 +/+ −/+
10−1 8,000 +/+ −/+
10−2 800 +/+ −/+
10−3 80 +/+ −/+
10−4 8 −/+ −/+
10−5 0.8 −/− −/−
10−6 0.08 −/− −/−
10−7 0.008 −/− −/−

RT-PCR, reverse transcription polymerase chain reaction; ERA, Evelyn-Rokitnicki-Abelseth.

FAID50/2 µL one-step multiplex RT-PCR reaction. Aliquots of 200 µL of the ERAGS and ERA strains with a viral titer of 107.0 FAID50/mL were used for RNA extraction.