Ann Lab Med Annals of Laboratory Medicine Ann Lab Med 2234-3806 2234-3814 Korean Society for Laboratory Medicine 10.3343/alm.2021.41.2.181 ALM-41-181 Original Article Diagnostic Immunology Relationship Between Rotavirus P[6] Infection in Korean Neonates and Histo-Blood Group Antigen: a Single-Center Study https://orcid.org/0000-0002-2536-413X LeeSu-Kyung M.S. 1 https://orcid.org/0000-0002-8650-7296 OhSu Jin M.S. 1 https://orcid.org/0000-0001-7515-0554 ChoiSeoheui M.D. 2 https://orcid.org/0000-0003-2449-3025 ChoiSoo Han M.D. 2 https://orcid.org/0000-0003-3324-4282 ShinSeon-Hee M.D. 2 https://orcid.org/0000-0002-4011-2782 LeeEun Jin M.D. 1 https://orcid.org/0000-0003-1907-9639 ChoEun-Jung M.D. 1 https://orcid.org/0000-0003-1040-1302 HyunJungwon M.D. 1 https://orcid.org/0000-0002-7026-6715 KimHyun Soo M.D. 1 Department of Laboratory Medicine, Hallym University Dongtan Sacred Heart Hospital, Hallym University College of Medicine, Hwaseong, Korea Department of Pediatrics, Hallym University Dongtan Sacred Heart Hospital, Hallym University College of Medicine, Hwaseong, Korea Corresponding author: Hyun Soo Kim, M.D., Ph.D., Department of Laboratory Medicine, Hallym University Dongtan Sacred Heart Hospital, Hallym University College of Medicine, 7 Keunjaebong-gil, Hwaseong, Gyeonggi-do 18450, Korea, Tel: +82-31-8086-2775, Fax: +82-31-8086-2789, E-mail: hskim0901@empas.com 1 3 2021 1 3 2021 41 2 181 189 18 2 2020 5 5 2020 24 9 2020 © Korean Society for Laboratory Medicine 2021 This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Background

Rotaviruses are a major cause of pediatric gastroenteritis. The rotavirus P[6] genotype is the most prevalent genotype isolated from Korean neonates but has rarely been reported in other countries. Histo-blood group antigen (HBGA) is known to play an important role in rotavirus infection. We investigated the relationship between rotavirus genotype and HBGA-Lewis blood type in Korean children and explored the reasons for the predominance of rotavirus P[6] strain in Korean neonates.

 Methods

Blood and stool samples were collected from 16 rotavirus-infected patients. Rotavirus G (VP7) and P (VP4) genotyping was performed using reverse transcription-PCR and sequencing. Lewis antigen phenotypes (Lea/Leb) were tested, and HBGA-Lewis genotype was determined by sequencing the secretor (FUT2) and Lewis (FUT3) genes. Deduced amino acid sequences and three-dimensional structures of the VP8* portion of the rotavirus VP4 protein were analyzed.

 Results

All P[6] rotaviruses were isolated from neonates under one month of age, who were negative or weakly positive for the Leb antigen. However, 10 of the 11 non-P[6] rotaviruses were isolated from older children who were Leb antigen-positive. The VP8* amino acid sequences differed among P[6], P[4], and P[8] genotypes. Korean P[6] strains showed a unique VP8* sequence with amino acid substitutions, including Y169 > L169, which differed from the sequences of P[6] strains from other countries.

 Conclusions

The predominance of the rotavirus P[6] genotype in Korean neonates may be related to the interaction between HBGA-Lewis antigen and the VP8* portion of the VP4 protein, and this information will be helpful in future neonatal vaccine development.

 Rotavirus Neonate Genotype Lewis Histo-blood group antigen Korean; VP4 protein INTRODUCTION

Rotaviruses are one of the major causes of pediatric gastroenteritis worldwide. Rotaviruses cause 5–10% of all cases of acute gastroenteritis in young children of < 5 years of age, and 30% of rotavirus infections are severe enough to require treatment [1]. Rotavirus is a non-enveloped, double-stranded RNA (dsRNA) virus with a triple-layered capsid surrounding a genome of 11 dsRNA segments [1]. The outer capsid layer comprises two structural proteins, VP7 and VP4; based on these, rotaviruses are classified into at least 36 G and 51 P genotypes [2]. G1–G4 and G9 and P[4], P[6], and P[8] are the most prevelent G and P genotypes, respectively [1, 3], and the genotypic distribution of rotavirus strains shows temporal and geographical fluctuations [1, 4].

In Korea, G1P[8] is the most prevalent genotype in children, whereas G4P[6] is the most prevalent genotype in neonates [3, 5-8]. The predominance of the G4P[6] and the G8P[6] genotype in Korean neonates has been reported from 1999 to 2019 [5-8]. Notably, the predominance of G4P[6] in neonates has not been reported in other countries. The rotavirus P[6] genotype is mainly isolated from Korean neonates, but is rarely isolated in older children [5-8].

Recently, rotavirus infection mediated by the attachment of the VP8* domain of the VP4 spike protein to specific histoblood group antigens (HBGAs) in the gut epithelium has been reported [9-11]. HBGAs are blood-type determinants determined by an individual’s secretor gene (FUT2, fucosyltransferase 2) and Lewis gene (FUT3, fucosyltransferase 3) [12].

We investigated the relationship between rotavirus genotype and HBGA-Lewis type in Korean children and explored the reasons for the predominance of rotavirus P[6] infection in Korean neonates.

 MATERIALS AND METHODS Patient samples

We used rotavirus-positive stool samples and corresponding blood samples, which were remnants to be discarded after rotavirus test and complete blood count test, collected from acute gastroenteritis patients at Hallym University Dongtan Sacred Heart Hospital, Hwaseong-si, Korea, between February 2019 and January 2020. The rotavirus antigen test was conducted using SD BIOLINE Rotavirus (SD BIOLINE Rotavirus; Abbott Diagnostic Korea, Yongin, Korea) or RIDASCREEN Rotavirus test kits (RIDASCREEN Rotavirus; R-Biopharm, Darmstadt, Germany), according to the manufacturer’s protocol. The Lewis phenotyping test and DNA extraction were performed on day of sample collection; extracted DNA and remnant diluted stool samples were stored at −70°C until use. During this period, 66 of the 726 stool samples (9.1%) were rotavirus-positive; adequate stool and corresponding blood samples for sequencing the four genes (the rotavirus VP4/VP7 genes and FUT2/FUT3 genes) and Lewis antigen phenotyping were available for 16 patients. Median patient age was 3.4 years (range, 8 days−10 years), and six patients (37.5%) were under 30 days of age. The Institutional Review Board (IRB) of Hallym University Dongtan Sacred Heart Hospital (IRB No. 2017-08-007) approved the study protocol and waived the need for informed consent.

 Rotavirus G and P genotyping

Rotavirus G (VP7) and P (VP4) genotyping was performed using reverse transcription-PCR and sequencing. Viral RNA was extracted from diluted stool samples using the QIAamp Viral RNA Mini kit (Qiagen, Hilden, Germany) and the QIAcube platform (Qiagen). The RNA was denatured and reverse-transcribed using the SuperScript III First-Strand Synthesis System (Invitrogen, Carlsbad, CA, USA). The VP7 and VP4 genes were amplified from the dsRNA genome using specific primer sets, VP7-F/VP7-R and VP4-F/VP4-R, respectively [7,8,13]. PCR products were visualized by electrophoresis on agarose gels and analyzed by DNA sequencing using ABI BigDye Terminator v3.1 Cycle Sequencing kits (Applied Biosystems, Foster City, CA, USA) and an ABI 3500 XL DNA Analyzer (Applied Biosystems). Genotypes were confirmed using the Basic Local Alignment Search Tool on the National Center for Biotechnology Information (https://blast.ncbi.nlm.nih.gov/)

 Lewis antigen phenotyping

Lewis antigen phenotyping was performed using ID-Antigen Profile I (Bio-Rad, Cressier Switzerland) and gel suspensions containing antibodies for the P, Lea, Leb, Lua, Lub, and ctl antigens, according to the manufacturer’s protocol. A 5% erythrocyte suspension was prepared from each EDTA-anticoagulated blood sample by mixing 50 µL of erythrocytes in 0.5 mL of Diluent 1 solution. The cell suspension was incubated for 10 minutes at room temperature (18–25°C), and 12.5 µL of the cell suspension was added to each phenotype ID-card micro-tube. The ID-cards were then centrifuged for 10 minutes in the ID-centrifuge 12 S II (Bio-Rad) and read in the range between negative to 4+, according to the agglutination strength.

 PCR and sequencing of the secretor and Lewis genes (<italic>FUT2</italic> and <italic>FUT3</italic>)

DNA was extracted from EDTA-anticoagulated blood samples using the QIAamp Blood Mini kit (Qiagen). A 1,153-bp region of the FUT2 gene was amplified using the tk1/tk2 primer set [14], and two segments (917 and 419 bp) of the FUT3 gene were amplified using two primer sets (N-F1/6R and 4F/8R) [15]. The forward primer sequence of N-F1 (TGATGACCGGCTATGCCTTC) was specifically designed for this study. PCR products were analyzed by DNA sequencing using ABI BigDye Terminator v3.1 Cycle Sequencing kits and an ABI 3500 XL DNA Analyzer. Variants of the FUT2 and FUT3 genes were detected by comparison with reference sequences FUT2*01 and FUT3 (http://erythrogene.com). Minor allele variants at the FUT2 c.418, c.461, and c.772 and FUT3 c.59, c.202, c.314, c.508, and c.1067 sites, which are known to be related to Lewis antigen phenotypes, were examined [16, 17].

 Analyses of amino acid sequences and three-dimensional (3D) structure of VP8*

The deduced amino acid sequences of the rotavirus VP8* portion of the VP4 capsid protein were analyzed and compared with the reference VP4 sequence data from GenBank: Wa_G1P[8]_ JX406750, DS-1_G2P[4]_HQ650119, RV3_P[6]_U16299, and P[6] strains detected in other countries (JN129097, LC095922, KF835915, and KF726067) and in Korea (MK953605 and G8P[6] from a previous study [8]).

Multiple sequence alignment and translation to amino acids were conducted using the MEGA version 7 program [18]. The 3D structures of the deduced amino acid sequences of the VP8* portion were obtained using the Swiss-Model program [19], PDB (Protein Data Bank. http://www.rcsb.org/) [20], and UCSF Chimera Program [21]. Briefly, the deduced amino acid sequences of the VP8* portion were converted to PDB format files in the Swiss-Model program, and structure comparison analyses were performed using the UCSF Chimera Program using the converted PDB files.

 Statistical analysis

The relationship between P[6] and Leb antigen negativity is expressed as a 2 × 2 contingency table, and P was calculated by Fisher’s exact test using MedCalc software version 19 (MedCalc Sofware Ltd, Ostend, Belgium). P < 0.05 was considered statistically significant.

 RESULTS Rotavirus genotype, erythrocyte Lewis antigen phenotypes, and <italic>FUT2</italic>/<italic>FUT3</italic> gene variants in rotavirus infected patients

Table 1 shows the rotavirus genotyping, Lewis antigen phenotyping, and FUT2/FUT3 gene results. Of the 16 rotavirus-positive patients, five patients under one month of age were positive for P[6] (all G8P[6]) rotaviruses; these patients were negative (patients 1, 3, 4, and 5) or weakly positive (patient 2) for the Leb antigen. In contrast, non-P[6] rotaviruses (G2P[4]s, G8P[8]s, G9P[8]s, and G1P[8]) were isolated from older children (except patient 12, aged 20 days); these patients were Leb antigen-positive. Table 2 shows the relationship between P[6] rotavirus and Leb antigen negativity. The patients with Leb antigen-negative phenotypes (patients 1, 3, 4, and 5) showed FUT2 c.418A > T homozygosity, FUT3 c.59T > G homozygosity, or FUT3 c.508G > A homozygosity. The patients with Leb antigen-positive phenotypes did not show FUT2 c.418A > T homozygosity, FUT3 c.59T > G homozygosity, or FUT3 c.508G > A homozygosity. Several other variants were also detected in the FUT2 and FUT3 genes; however, we focused on the FUT2 c.418, c.461, and c.772 and FUT3 c.59, c.202, c.314, c.508, and c.1067 sites.

 Amino acid sequence of the VP8* portion of the VP4 capsid protein

The amino acid sequences of the VP8* portion of the P[8], P[4], and P[6] genotypes greatly varied according to the genotype (Table 3). The amino acid sequences of the VP8* portion of Korean P[6] strains (19RP-09_G8P[6], 19RP-26_G8P[6], 19RP-35 G8P[6], 19RP-38 G8P[6], RN-001_KOR_G4P[6], and 27_2017_KOR_G8P[6]) were notably different from those of P[6] strains detected in other countries (P[6] RV3, P[6] Nicaragua, P[6] Vietnam, P[6] Hungary, and P[6] China). The amino acid differences between P[6] strains from other countries and Korean P[6] strains were as follows: N88D, V103I, T125M, K126R, K136T, S145R, S146T, V147A, S148G, R155H, H169L, H178Y, and S188L S189L T198A (yellow shading in Table 3). We omitted the 19RP-11 data in Table 3, because this portion (amino acids 81–230 in Table 3) of the VP4 sequence of 19RP-11 yielded an unclear sequence chromatogram.

 3D structure of the VP8* glycoprotein

Fig. 1 shows the superposition of the P[6] VP8*, P[4] VP8*, and P[8] VP8* structures deduced from the VP4 amino acid sequences of P[6], P[4], and P[8] strains. Rotaviruses with similar genotypes showed nearly the same 3D structures of the VP8* portion, although one or two amino-acid sequence differences were observed. Despite the differences in amino acid sequences at various sites between P[4], P[6], and P[8], only a slight structural difference was observed.

 DISCUSSION

We investigated the relationship between rotavirus genotypes and HBGA-Lewis blood type in Korean children with rotavirus infections, and explored the reason for the P[6] genotype predominance in Korean neonates. Although the number of cases was small, all P[6] rotaviruses were isolated from neonates who were Leb antigen-negative or weakly positive. In contrast, nonP[6] rotaviruses were isolated from older children (except for patient 12, aged 20 days) who were Leb antigen-positive. These results suggest that neonate-specific P[6] rotaviruses easily infect neonates who are negative or weakly positive for Leb antigen, but rarely infect patients who are Leb antigen-positive or older children. Our results are supported by recent studies showing that rotavirus P[6] strains can infect Lewis-negative individuals, regardless of their secretor status [22, 23]. In the neonate gut, modification to the precursor moieties or branching of Lewis HBGA is developmentally regulated, and thus the most abundant type of Lewis HBGA in the neonate gut is the unbranched type I precursor glycan, Le(a-b-) [24]. Only a few studies in Africa have also reported the relationship between P[6] and neonates; however, the proportion of P[6] infection in neonates were at most 25% in those studies [22, 25, 26]. This phenomenon may be related to the higher proportion of Le(a-b-) in Koreans and Africans than in Caucasian or Chinese populations [14, 22, 27, 28]. Contrarily, this may be related to the noted differences in the VP8* amino acid sequences between the Korean rotavirus P[6] strains and those of the P[6] strains detected in other countries (Table 3).

In terms of differences in the 3D structure between the rotavirus VP8* portion and Lewis HBGA, the cleft between the betasheets of rotavirus P[6] has been reported to be wider than that in P[14], and rotavirus P[6] has been suggested to bind to the unbranched type I precursor glycan, Le(a-b-), rather than to the branched HBGA, Le(a-b+) [12]. However, in our study, the cleft between the beta-sheets of the P[6] rotavirus was not markedly wider than that of P[4] or P[8] strains (Fig. 1).

A previous study suggested that a single residue of the neonatal P[6] VP8*, specifically H169, which is well conserved in most neonate-specific P[6] genotypes, alters the glycan conformation [12]. However, all neonatal G8P[6] in this study showed a different amino acid residue, L169 instead of H169, which can cause P[6] infection in Korean neonates. Other amino acid substitutions at different sites (N88D, V103I, T125M, K126R, K136T, S145R, S146T, V147A, S148G, R155H, H169L, H178Y, S188L S189L, and T198A) may cause a small change in the 3D structure or hydrogen bond/hydrophobic interaction between the VP8* of the rotavirus VP4 protein and HBGA molecules in patients, which may involve ageor population-related tropism of some P[6] strains [12].

The Lewis histo-blood group system consists of two major antigens, Lea and Leb, and four phenotypes, Le(a-b-), Le(a+b-), Le (a-b+), and Le(a+b+) [29]. Lewis antigen synthesis depends on the interaction of FUT3 and FUT2. Although the number of cases in our study was too small to reveal the relationship between phenotype and genotype, our results are compatible with previous interpretations of Lewis genotypes [16, 17]. In terms of FUT2, patients harboring homozygous G428A (c.461) and G739A (c.772) variants were non-secretors, and those with a homozygous A385T (c.418) variants were weak secretors. Patients who were wild-type or harbored heterozygous variants at these sites were designated as secretors. In terms of FUT3, patients who harbored homozygous variants for at least T202C (c.202), G508A (c.508), or T1067A (c.1067) were designated as Le(a-b-) [16]. In another study, patients with wild-type FUT2 and FUT3 were classified as Leb-positive secretors [Se+, Le(a-b+)]; patients who were homozygous for the minor allele in FUT2 at rs601338 (G428A, c.461) and/or rs602662 (G739A, c.772), with a wild-type FUT3 genotype were classified as Leb-negative non-secretors [Se-, Le(a+b-)]; patients homozygous for the minor allele in FUT3 at rs778986 (C314T, c.314), rs28362459 (T59G, c.59), rs3894326 (T1067A, c.1067), and/or rs3745635 (G508A, c.508), with a wild-type FUT2 genotype were considered to have a secretor Lewis-null phenotype [Se+, Le(a-b-)]; and those homozygous for the minor allele at one or more sites in FUT2 and FUT3 were considered to have a non-secretor Lewis-null phenotype [Se-, Le(a-b-)] [17]. To the best of our knowledge, the relationship between all Lewis gene variants and the Lewis antigen phenotypes has not been clearly established and thus, there were slight differences in interpretation across the studies. Therefore, we focused on the FUT2 c.418, c.461, and c.772 and the FUT3 c.59, c.202, c.314, c.508, and c.1067 sites. Further studies will be needed to elucidate the relationship between all variants of Lewis-related genes and Lewis antigen phenotypes.

In conclusion, we found that the rotavirus P[6] genotype predominance in Korean neonates may be related to the interaction between the patient’s HBGA-Lewis antigen phenotype and the VP8* portion of the rotavirus VP4 capsid protein. Four possible explanations are suggested: (1) P[6] infection may be related to Leb antigen-negative or weakly positive status; (2) Lewis antigens are not fully developed in the neonate gut; (3) the proportion of Le(a-b-) is higher in Korea than in other countries; and (4) the antigenicity of rotavirus P[6] strains isolated in Korea is different from that of P[6] strains isolated in other countries. Although, this study is limited with the small number of patients, the results provide valuable information on future development of neonatal rotavirus vaccine.

 ACKNOWLEDGEMENTS

We thank Jeong Hee Kim for technical assistance.

AUTHOR CONTRIBUTIONS

HSK designed and performed the study and wrote the manuscript; SKL performed the experiment and helped to wrote the manuscript; SJO collected and analyzed the data; SHC and SHS obtained the patients’ samples and clinical information; EJL, EJC, and JH helped to analyze the data; All authors read and approved the final manuscript.

CONFLICTS OF INTEREST

No potential conflicts of interest relevant to this study are reported.

RESEARCH FUNDING

This work was supported by the National Research Foundation of Korea (NRF-2017R1D1A3B03031940) and by the Hallym University Research Fund.

 REFERENCES DesselbergerU 2014 Rotaviruses Virus Res 190 75 96 10.1016/j.virusres.2014.06.016 25016036 Rotavirus Classification Working Group: RCWG-Laboratory of Viral Metagenomics https://rega.kuleuven.be/cev/viralmetagenomics/virusclassification/rcwg Updated on 16 Feb 2020 ThanVT KimW 2013 Prevalence of rotavirus genotypes in South Korea in 1989-2009: implications for a nationwide rotavirus vaccine program Korean J Pediatr 56 465 73 10.3345/kjp.2013.56.11.465 24348658 PMC3859878 KawaiK O'BrienMA GoveiaMG MastTC El KhouryAC 2012 Burden of rotavirus gastroenteritis and distribution of rotavirus strains in Asia: a systematic review Vaccine 30 1244 54 10.1016/j.vaccine.2011.12.092 22212128 KimJS KimHS HyunJ KimHS SongW LeeKM 2014 Analysis of rotavirus genotypes in Korea during 2013: an increase in the G2P[4] genotype after the introduction of rotavirus vaccines Vaccine 32 6396 402 10.1016/j.vaccine.2014.09.067 25312273 KimJS KimSM KimHS 2017 High prevalence of rotavirus G4P[6] genotypes among neonates in two Korean hospitals Ann Clin Microbiol 20 63 6 10.5145/ACM.2017.20.3.63 LeeSK ChoiS KimJS LeeEJ HyunJ KimHS 2019 Whole-genome analysis of rotavirus G4P[6] strains isolated from Korean neonates: association of Korean neonates and rotavirus P[6] genotypes Gut Pathog 11 37 10.1186/s13099-019-0318-5 31333764 PMC6621965 LeeSK ChoiS ShinSH LeeEJ HyunJ KimJS 2018 Emergence of G8P[6] rotavirus strains in Korean neonates Gut Pathog 10 27 10.1186/s13099-018-0255-8 29997697 PMC6031143 Gozalbo-RoviraR Ciges-TomasJR Vila-VicentS BuesaJ Santiso-BellónC MonederoV 2019 Unraveling the role of the secretor antigen in human rotavirus attachment to histo-blood group antigens PLoS Pathog 15 e1007865 10.1371/journal.ppat.1007865 31226167 PMC6609034 HuL CrawfordSE CzakoR Cortes-PenfieldNW SmithDF Le PenduJ 2012 Cell attachment protein VP8* of a human rotavirus specifically interacts with A-type histo-blood group antigen Nature 485 256 9 10.1038/nature10996 22504179 PMC3350622 HuL SankaranB LauciricaDR PatilK SalmenW FerreonACM 2018 Glycan recognition in globally dominant human rotaviruses Nat Commun 9 2631 10.1038/s41467-018-05098-4 29980685 PMC6035239 HongYJ HwangSM KimTS SongEY ParkKU SongJ 2014 Significance of Lewis phenotyping using saliva and gastric tissue: comparison with the Lewis phenotype inferred from Lewis and secretor genotypes Biomed Res Int 2014 573652 10.1155/2014/573652 24783214 PMC3982271 KimJS LeeSK KoDH HyunJ KimHS KimJS 2019 Performance evaluation of the automated fluorescent immunoassay system rotavirus assay in clinical samples Ann Lab Med 39 50 7 10.3343/alm.2019.39.1.50 30215230 PMC6143470 SongSY AnSS RyuSW KimJS SuhIB 2008 Evaluation of the genotypes of the Lewis Blood Group in a Korean population using direct sequencing Korean J Hematol 43 34 42 10.5045/kjh.2008.43.1.34 SerpaJ AlmeidaR OliveiraC SilvaFS SilvaE ReisC 2003 Lewis enzyme (alpha1-3/4 fucosyltransferase) polymorphisms do not explain the Lewis phenotype in the gastric mucosa of a Portuguese population J Hum Genet 48 183 9 10.1007/s10038-003-0007-5 12730721 BonifaceK ByarsSG CowleyD KirkwoodCD BinesJE 2020 Human neonatal rotavirus vaccine (RV3-BB) produces vaccine take irrespective of histo-blood group antigen status J Infect Dis 221 1070 8 10.1093/infdis/jiz333 31763671 PMC7075413 KingJR VaradéJ HammarströmL 2019 Fucosyltransferase gene polymorphisms and Lewisb-negative status are frequent in Swedish newborns, with implications for infectious disease susceptibility and personalized medicine J Pediatric Infect Dis Soc 8 507 18 10.1093/jpids/piy085 30544260 KumarS StecherG TamuraK 2016 MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets Mol Biol Evol 33 1870 4 10.1093/molbev/msw054 27004904 WaterhouseA BertoniM BienertS StuderG TaurielloG GumiennyR 2018 SWISS-MODEL: homology modelling of protein structures and complexes Nucleic Acids Res 46 W296 303 10.1093/nar/gky427 29788355 PMC6030848 BurleySK BermanHM BhikadiyaC BiC ChenL Di CostanzoL 2019 RCSB Protein Data Bank: biological macromolecular structures enabling research and education in fundamental biology, biomedicine, biotechnology and energy Nucleic Acids Res 47 D464 74 10.1093/nar/gky1004 30357411 PMC6324064 PettersenEF GoddardTD HuangCC CouchGS GreenblattDM MengEC 2004 UCSF Chimera-a visualization system for exploratory research and analysis J Comput Chem 25 1605 12 10.1002/jcc.20084 15264254 NordgrenJ SharmaS BucardoF NasirW GünaydınG OuermiD 2014 Both Lewis and secretor status mediate susceptibility to rotavirus infections in a rotavirus genotype-dependent manner Clin Infect Dis 59 1567 73 10.1093/cid/ciu633 25097083 Van TrangN VuHT LeNT HuangP JiangX AnhDD 2014 Association between norovirus and rotavirus infection and histo-blood group antigen types in Vietnamese children J Clin Microbiol 52 1366 74 10.1128/JCM.02927-13 24523471 PMC3993640 AmenoS KimuraH AmenoK ZhangX KinoshitaH KubotaT 2001 Lewis and Secretor gene effects on Lewis antigen and postnatal development of Lewis blood type Biol Neonate 79 91 6 10.1159/000047073 11223649 ToddS PageNA Duncan SteeleA PeenzeI CunliffeNA 2010 Rotavirus strain types circulating in Africa: review of studies published during 1997-2006 J Infect Dis 202 S1 S34 42 10.1086/653555 20684715 PagerCT AlexanderJJ SteeleAD 2000 South African G4P[6] asymptomatic and symptomatic neonatal rotavirus strains differ in their NSP4, VP8*, and VP7 genes J Med Virol 62 208 16 10.1002/1096-9071(200010)62:2<208::AID-JMV12>3.0.CO;2-K 11002250 HeylenE ZellerM CiarletM LawrenceJ SteeleD Van RanstM 2016 Human P[6] Rotaviruses from Sub-Saharan Africa and Southeast Asia are closely related to those of human P[4] and P[8] Rotaviruses circulating worldwide J Infect Dis 214 1039 49 10.1093/infdis/jiw247 27471320 ParkHD ParkKU SongJ KiCS HanKS KimJQ 2010 The relationship between Lewis/Secretor genotypes and serum carbohydrate antigen 19-9 levels in a Korean population Korean J Lab Med 30 51 7 10.3343/kjlm.2010.30.1.51 20197723 FIGURE AND TABLES

Superposition of P[6] VP8*, P[4] VP8*, and P[8] VP8* structures deduced from the VP4 nucleotide sequences. Sky blue, P[6]; gold, P[8]; and pink, P[4].

Rotavirus genotype, erythrocyte Lewis antigen phenotype, and FUT2/FUT3 gene variants in patients with rotavirus infection

Rotavirus genotype Case number Sex/Age Erythrocyte Lewis phenotype Minor allele homozygosity(FUT2 c.418, c.461, c.772) Minor allele homozygosity(FUT3 c.59, c.202, c.314, c.508, or c.1067)
G8P[6] 119RP-09 M/15 days Lea(3+) Leb(-)* c.418A > T -
219RP-11 M/8 days Lea(1+) Leb(2+) - -
319RP-26 M/20 days Lea(−) Leb(−) - c.508G > A
419RP-35 M/15 days Lea(−) Leb(−) c.418A > T c.59T > G
519RP-38 M/9 days Lea(−) Leb(−) - c.59T > G, c.508G > A
G1P[8] 619RP-23 F/3 yr Lea(−) Leb(4+) - -
G8P[8] 719RP-04 M/6 yr Lea(−) Leb(4+) - -
819RP-07 M/4 yr Lea(−) Leb(4+) - -
919RP-31 F/4 yr Lea(−) Leb(4+) - -
G9P[8] 1019RP-02 F/3 yr Lea(−) Leb(4+) - -
1119RP-15 F/6 yr Lea(−) Leb(3+) - -
1219RP-24 F/ 20 days Lea(3+) Leb(3+) - -
G2P[4] 1319RP-13 M/5 yr Lea(−) Leb(4+) - -
1419RP-17 F/10 yr Lea(−) Leb(3+) - -
1519RP-21 F/1 yr Lea(−) Leb(4+) - -
1619RP-32 M/9 yr Lea(−) Leb(3+) - -

Abbreviations: M, male; F, female.

*Agglutination strength was expressed in the range of - to 4+, according to the manufacturer’s guidelines.

Relationship between rotavirus P[6] genotype and Leb antigen negativity in patients with rotavirus infection

Rotavirus genotype Leb(−) Leb(+) P
P[6]* (N=5) 4 (80%) 1 (20%) 0.0027
Non-P[6]* (N=11) 0 (0%) 11 (100%)

*All P[6] rotaviruses were isolated from neonates under one month of age, and 10 of the 11 non-P[6] rotaviruses were isolated from older children.

Deduced amino acid sequences of the antigenic epitopes of the VP8* portion of the VP4 capsid protein

Amino acid 81 91 101 111 121 130
Wa_G1P[8]_JX406750* W I L I N S N T N G V V Y E S T N N S D F W T A V V A I E P H V N P V D R Q Y T I F G E S K Q F N V
19RP-23_G1P[8] W I L I N S N T N G V V Y E S T N N S D F W T A V I A V E P H V D P V D R Q Y N V F G E N K Q F N V
19RP-04_G8P[8] W I L I N S N T N G V V Y E S T N N S D F W T A V I A V E P H V D P V D R Q Y N V F G E N K Q F N V
19RP-07_G8P[8] W I L I N S N T N G V V Y E S T N N S D F W T A V I A V E P H V D P V D R Q Y N V F G E N K Q F N V
19RP-31_G8P[8] W I L I N S N T N G V V Y E S T N N S D F W T A V I A V E P H V D P V D R Q Y N V F G E N K Q F N V
19RP-02_G9P[8] W I L I N S N T N G V V Y E S T N N S D F W T A V I A V E P H V D P V D R Q Y N V F G E N K Q F N V
19RP-15_G9P[8] W I L I N S N T N G V V Y E S T N N S D F W T A V I A V E P H V D P V D R Q Y N V F G E N K Q F N V
19RP-24_G9P[8] W I L I N S N T N G V V Y E S T N N S D F W T A V I A V E P H V D P V D R Q Y N V F G E N K Q F N V
DS-1_G2P[4]_HQ650119* W L L I S S N T N G V V Y E S T N N N D F W T A V I A V E P H V S Q T N R Q Y I L F G E N K Q F N V
19RP-13_G2P[4] W L L I S S N T D G V V Y E S T N N S D F W T A V I A V E P H V S P T N R Q Y V L F G E N K Q F N V
19RP-17_G2P[4] W L L I S S N T D G V V Y E S T N N S D F W T A V I A V E P H V S P T N R Q Y V L F G E N K Q F N V
19RP-21_G2P[4] W L L I S S N T D G V V Y E S T N N S D F W T A V I A V E P H V S Q T N R Q Y V L F G E N K Q F N I
19RP-32_G2P[4] W L L I S S N T D G V V Y E S T N N S D F W T A V I A V E P H V S P T N R Q Y V L F G E N K Q F N V
RV3_P[6]_U16299* W I L L N P T N Q Q V V L E G T N K T D I W V A L L L V E P N V T N Q S R Q Y T L F G E T K Q I T V
19RP-09_G8P[6] W I L L N P T D Q Q V V L E S T N K T D I W I A L L L V E P N V T N Q S R Q Y T L F G E M R Q I T I
19RP-26_G8P[6] W I L L N P T D Q Q V V L E S T N K T D I W I A L L L V E P N V T N Q S R Q Y T L F G E M R Q I T I
19RP-35_G8P[6] W I L L N P T D Q Q V V L E S T N K T D I W I A L L L V E P N V T N Q S R Q Y T L F G E M R Q I T I
19RP-38_G8P[6] W I L L N P T D Q Q V V L E S T N K T D I W I A L L L V E P N V T N Q S R Q Y T L F G E M R Q I T I
RN-001_KOR_G4P[6]_MK953605 W I L L N P T D Q Q V V L E S T N K T D I W I A L L L V E P N V T N Q S R Q Y T L F G E M R Q I T I
27_ 2017_KOR_G8P[6] [8] W I L L N P T D Q Q V V L E S T N K T D I W I A L L L V E P N V T N Q S R Q Y T L F G E M R Q I T I
P[6] RV3_U16299* W I L L N P T N Q Q V V L E G T N R T D I W V A L L L V E P N V T N Q S R Q Y T L F G E T K Q I T V
P[6] Nicaragua_JN129097* W I L L N P T N Q A V V L E G T N R T D V W V A L L L I E P N T P S Q S R Q Y T L F G E I K Q I S V
P[6] Vietnam 2007_LC095922* W I L L S P T N Q Q V V L E G T N R T D V W V A L L L I E P N V T N Q S R Q Y T L F G E T K Q I T V
P[6] Hungary 2002_KF835915* W I L L N P T N Q K V V L E G T N R A D V W V A I L L I E P N T I N Q S R Q Y T L F G E T K Q I T I
P[6] China 2013_KF726067* W I L L S P T N Q Q V V L E G T N R T D V W V A L L L V E P N V T N Q S R Q Y T L F G E T K NI I T V
Amino acid 131 141 151 161 171 180
Wa_G1P[8]_JX406750* S N D - - I W K F L E M F R S S S Q N E F Y N R R T L T S D T R L V G I L K Y G G R V W T F H G E T
19RP-23_G1P[8] R N D - - I W K F L E M F R G S S Q S D F Y N R R T L T S D T K L V G I L K Y G G R I W T F H G E T
19RP-04_G8P[8] R N D - - I W K F L E M F R G G S Q S D F Y N R R T L T S D T K L V G I L K Y G G R I W T F H G E T
19RP-07_G8P[8] R N D - - I W K F L E M F R G G S Q S D F Y N R R T L T S D T K L V G I L K Y G G R I W T F H G E T
19RP-31_G8P[8] R N D - - I W K F L E M F R G S S Q S D F Y N R R T L T S D T K L V G I L K Y G G R I W T F H G E T
19RP-02_G9P[8] R N D - - I W K F L E M F R G S S Q S D F Y N R R T L T S D T K L V G I L K Y G G R I W T F H G E T
19RP-15_G9P[8] R N D - - I W K F L E M F R G S S Q S D F Y N R R T L T S D T K L V G I L K Y G G R I W T F H G E T
19RP-24_G9P[8] R N D - - I W K F L E M F R G S S Q S D F Y N R R T L T S D T K L V G I L K Y G G R I W T F H G E T
DS-1_G2P[4]_HQ650119* E N N - - I W K F F E M F K G S S Q G D F S N R R T L T S S N R L V G M L K Y G G R V W T F H G E T
19RP-13_G2P[4] E N S - - I W K F F E M F K G S S Q S D F S N R R T L T S D N R L V G M L K Y G G R V W T F H G E T
19RP-17_G2P[4] E N S - - I W K F F E M F K G S S Q S D F S N R R T L T S D N R L V G M L K Y G G R V W T F H G E T
19RP-21_G2P[4] E N S - - T W K F F E M F K G S S Q S D F S N R R T L T S N N R L V G M L K Y G G R V W T F H G E T
19RP-32_G2P[4] E N S - - I W K F F E M F K G S S Q S D F S N R R T L T S D N R L V G M L K Y G G R V W T F H G E T
RV3_P[6]_U16299* E N N T N K W K F F E M F R S S V S A E F Q H K R T L T S D T K L A G F L K H Y N S V W T F H G E T
19RP-09_G8P[6] E N N - - T W K F F E V F R R T A G A E F Q H K H T L T S D T K L A G F L K L Y N S V W T F Y G E T
19RP-26_G8P[6] E N N - - T W K F F E V F R R T A G A E F Q H K H T L T S D T K L A G F L K L Y N S V W T F Y G E T
19RP-35_G8P[6] E N N - - T W K F F E V F R R T A G A E F Q H K H T L T S D T K L A G F L K L Y N S V W T F Y G E T
19RP-38_G8P[6] E N N - - T W K F F E V F R R T A G A E F Q H K H T L T S D T K L A G F L K L Y N S V W T F Y G E T
RN-001_KOR_G4P[6]_MK953605 E N N - - T W K F F E V F R R T A G A E F Q H K H T L T S D T K L A G F L K L Y N S V W T F Y G E T
27_ 2017_KOR_G8P[6] [8] E N N - - T W K F F E V F R R T A G A E F Q H K H T L T S D T K L A G F L K L Y N S V W T F Y G E T
P[6] RV3_U16299* E N N T N K W K F F E M F R S S V S A E F Q H K R T L T S D T K L A G F L K H Y N S V W T F H G E T
P[6] Nicaragua_JN129097* E N N T N K W K F F E M F R N N I N S E F Q H K R T L T S D T K L A G F L K H G G R V W T F H G E T
P[6] Vietnam 2007_LC095922* E N N T N E W K F Y E M F R N S A N V E F Q H K R T L T S D T K L A G F L K H G G R V W T F H G E T
P[6] Hungary 2002_KF835915* E N N S S K W K F F E M F R N N A S A E F Q H K R T L T S D T K L A G F L K H G G R V W T F H G E T
P[6] China 2013_KF726067* E N N T N K W K F Y E M F R N N A S A E F Q P K R T L T S D T K L A G F L K H G G R V W T F H G E T
Amino acid 181 191 201 211 221 229
Wa_G1P[8]_JX406750* P R A T T D S S S T A N L N N I S I T I H S E F Y I I P R S Q E S K C N E Y I N N G L P P I Q N T
19RP-23_G1P[8] P R A T T D S S N T A N L N G I S I T I H S E F Y I I P R S Q E S K C N E Y I N N G L P P I Q N T
19RP-04_G8P[8] P R A T T D S S N T A N L N G I S I T I H S E F Y I I P R S Q E S K C N E Y I N N G L P P I Q N T
19RP-07_G8P[8] P R A T T D S S N T A N L N G I S I T I H S E F Y I I P R S Q E S K C N E Y I N N G L P P I Q N T
19RP-31_G8P[8] P R A T T D S S N T A N L N D I S I T I H S E F Y I I P R S Q E S K C N E Y I N N G L P P I Q N T
19RP-02_G9P[8] P R A T T D S S N T A N L N G I S I T I H S E F Y I I P R S Q E S K C N E Y I N N G L P P I Q N T
19RP-15_G9P[8] P R A T T D S S N T A N L N G I S I T I H S E F Y I I P R S Q E S K C N E Y I N N G L P P I Q N T
19RP-24_G9P[8] P R A T T D S S N T A N L N G I S I T I H S E F Y I I P R S Q E S K C N E Y I N N G L P P I Q N T
DS-1_G2P[4]_HQ650119* P R A T T D S S N T A D L N N I S I I I H S E F Y I I P R S Q E S K C N E Y I N N G L P P I Q N T
19RP-13_G2P[4] P R A T T D S S S T A D L N N I S I I I H S E F Y I I P R S Q E S K C N E Y I N N G L P P I Q N T
19RP-17_G2P[4] P R A T T D S S S T A D L N N I S I I I H S E F Y I I P R S Q E S K C N E Y I N N G L P P I Q N T
19RP-21_G2P[4] P R A T T D S S N T A D L N N I S I I I H S E F Y I I P R S Q E S K C N E Y I N N G L P P I Q N T
19RP-32_G2P[4] P R A T T D S S S T A D L N N I S I I I H S E F Y I I P R S Q E S K C N E Y I N N G L P P I Q N T
RV3_P[6]_U16299* P H A T T D Y S S T S N L S E V E T T I H V E F Y I I P R S Q E S K C V E Y I N T G L
19RP-09_G8P[6] P H A T T D Y L L T S N L S E V E A V I H V E F Y I I P R S Q E S K C V E Y I N N G L P P I Q N T
19RP-26_G8P[6] P H A T T D Y L L T S N L S E V E A V I H V E F Y I I P R S Q E S K C V D Y I N N G L P P M Q N T
19RP-35_G8P[6] P H A T T D Y L L T S N L S E V E A V I L V E F Y I I P R S Q E S K C V E Y I N N G L P P M Q N T
19RP-38_G8P[6] P H A T T D Y L L T S N L S E V E A V I L V E F Y I I P R S Q E S K C V E Y I N N G L P P M Q N T
RN-001_KOR_G4P[6]_MK953605 P H A T T D Y L L T S N L S E V E A V I H V E F Y I I P R S Q E S K C V E Y I N T G L P P M Q N T
27_2017_KOR_G8P[6] [8] P H A T T D Y L L T S N L S E V E A V I H V E F Y I I P R S Q E S K C V E Y I N N G L P P M Q N T
P[6] RV3_U16299* P H A T T D Y S S T S N L S E V E T T I H V E F Y I I P R S Q E S K C V E Y I N T G L
P[6] Nicaragua_JN129097* P H A T T D Y S T S N L S E V I E T V I H A E F Y I I P R S Q E S K C N E Y I N T G L
P[6] Vietnam 2007_LC095922* P H A T T D Y S S S N L S E V I E T V I H T E F Y I I P R S Q E S K C N E Y I N T G L
P[6] Hungary 2002_KF835915* P N A T T D Y S T S N L S P D I E T V I H T D F Y I I P R S Q E S K C K E Y I N T G L
P[6] China 2013_KF726067* P H A T T D Y S S S N L S E V V E T V I H T E F Y I I P R S Q E S K C N E Y I N T G L

*These sequences were obtained from GenBank.

Brown shading indicates amino acids that differ from USA-Wa_G1P[8], and yellow shading indicates amino acids that differ from 19RP-09 G8P[6] strains detected in Korean neonates.