JKAOH Journal of Korean Academy of Oral Health J Korean Acad Oral Health 1225-388X 2093-7784 Journal of Korean Academy of Oral Health 10.11149/jkaoh.2020.44.1.34 jkaoh-44-34 Original Article Molecular epidemiology and characterization of Streptococcus mutans strains in Korea KimSe-Yeon1 BaeIl Kown2 LeeJung-Ha1 ShinJeong Hwan3 KimJin-Bom1 Department of Preventive and Community Dentistry, School of Dentistry, Pusan National University, Yangsan, Korea Department of Dental Hygiene, College of Health and Welfare, Silla University, Busan, Korea Department of Laboratory Medicine, Inje University College of Medicine, Busan, Korea Corresponding Author: Jin-Bom Kim Department of Preventive and Community Dentistry, School of Dentistry, Pusan National University, 49 Busandaehak-ro, Mulgeum-eup, Yangsan 50612, Korea Tel: +82-51-510-8223 Fax: +82-51-510-8221 E-mail: jbomkim@pusan.ac.kr https://orcid.org/0000-0001-8619-2741 032020 15032020 441 3440 16122019 12022020 25022020 Copyright © 2020 by Journal of Korean Academy of Oral Health 2020 This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Objectives

We investigated the characteristics of Streptococcus mutans in the national culture collection from Korea. Twenty-nine (dental plaque, n=27; endodontic infections, n=1; blood, n=1) isolates were included in this study.

 Methods

Antimicrobial susceptibilities were tested using the disk diffusion test. Multilocus sequence typing (MLST), serotyping, and collagen-binding genes were used for polymerase chain reaction (PCR) and direct sequencing. A collagen-binding (to assess the adhesion properties) assay was performed. S. mutans demonstrated high susceptibility to antimicrobial agents. Differences in collagen-binding abilities of the cnm-positive and -negative groups were compared using the Mann-Whitney U test (P<0.05).

 Results

MLST analyses revealed 25 sequence types (STs), 17 of which (ST213-ST229) contained new alleles. The strains were classified into four serotypes with the c type encompassing 79.3% of all strains, while the e, f, and k types representing 6.9% each. Analysis of the cnm and cbm genes, which encode the two surface adhesin components of S. mutans, revealed three cnm-positive strains, each displaying greater adhesion ability than those of the cnm-negative strains.

 Conclusions

This study highlights the presence of a wide variety of S. mutans genotypes in Korea. These findings may provide useful information regarding the pathogenesis of infectious diseases, such as dental caries.

 Adhesion Bacteremia Collagen binding MLST Infection Inflammation Streptococcus mutans References AjdićDMcShanWMMcLaughlinRESavićGChangJCarsonMBGenome sequence of Streptococcus mutans UA159, a cariogenic dental pathogenProc Natl Acad Sci USA2002991443414439 SwitalskiLMButcherWGCaufieldPCLantzMSCollagen mediates adhesion of Streptococcus mutans to human dentinInfect Im-mun19936141194125 MillerJHAvilés-ReyesAScott-AnneKGregoireSWatsonGESampsonEThe collagen binding protein Cnm contributes to oral colonization and cariogenicity of Streptococcus mutans OMZ175Infect Immun20158320012010 BanasJAVirulence properties of Streptococcus mutansFront Biosci2004912671277 NakanoKOoshimaTSerotype classification of Streptococcus mutans and its detection outside the oral cavityFuture Microbiol20094891902 NakanoKNomuraRNemotoHMukaiTYoshiokaHShudoYDetection of novel serotype k Streptococcus mutans in infective endocarditis patientsJ Med Microbiol20075614131415 HirasawaMTakadaKA new selective medium for Streptococcus mutans and the distribution of S. mutans and S. sobrinus and their serotypes in dental plaqueCaries Res200337212217 NakanoKNomuraRNakagawaIHamadaSOoshimaTDemonstration of Streptococcus mutans with a cell wall polysaccharide specific to a new serotype, k, in the human oral cavityJ Clin Micro-biol200442198202 NakanoKNomuraRTaniguchiNLapirattanakulJKojimaANakaSMolecular characterization of Streptococcus mutans strains containing the cnm gene encoding a collagen-binding adhesinArch Oral Biol2010553439 NomuraRNakanoKNakaSNemotoHMasudaKLapirat-tanakulJIdentification and characterization of a collagen-binding protein, Cbm, in Streptococcus mutansMol Oral Microbiol201227308323 SatoYOkamotoKKagamiAYamamotoYIgarashiTKizakiHStreptococcus mutans strains harboring collagen-binding adhesinJ Dent Res200483534539 NomuraRNakanoKTaniguchiNLapirattanakulJNemotoHGrönroosLMolecular and clinical analyses of the gene encoding the collagen-binding adhesin of Streptococcus mutansJ Med Microbiol.200958469475 NakanoKHokamuraKTaniguchiNWadaKKudoCNomuraRThe collagen-binding protein of Streptococcus mutans is involved in haemorrhagic strokeNat Commun20112485 KojimaANakanoKWadaKTakahashiHKatayamaKYonedaMInfection of specific strains of Streptococcus mutans, oral bacteria, confers a risk of ulcerative colitisSci Rep20122332 LapirattanakulJNakanoKNomuraRHamadaSNakagawaIOoshimaTDemonstration of mother-to-child transmission of Streptococcus mutans using multilocus sequence typingCaries Res200842466474 NomuraROgayaYNakanoKContribution of the collagen-binding proteins of Streptococcus mutans to bacterial colonization of inflamed dental pulpPLoS One201611e0159613 Pérez-LosadaMCabezasPCastro-NallarECrandallKAPathogen typing in the genomics era: MLST and the future of molecular epidemiologyInfect Genet Evol2013163853 CaiJNJungJELeeMHChoiHMJeonJGSucrose challenges to Streptococcus mutans biofilms and the curve fitting for the biofilm changesFEMS Microbiol Ecol201894 PatelJCockerillFAlderJBradfordPEliopoulosGHardyDPerformance standards for antimicrobial susceptibility testing; twenty-fourth informational supplementPAClinical and Laboratory Standards Institute2014341266 LapirattanakulJNakanoKNomuraRLeelataweewudPChalerm-sarpNKlaophimaiAMultilocus sequence typing analysis of Streptococcus mutans strains with the cnm gene encoding collagen-binding adhesinJ Med Microbiol20116016771684 MomeniSSWhiddonJCheonKMoserSAChildersNKAssessment of two multilocus sequence typing (MLST) schemes available for Streptococcus mutansArch Oral Biol20156017691776 NakanoKNemotoHNomuraRHommaHYoshiokaHShudoYSerotype distribution of Streptococcus mutans a pathogen of dental caries in cardiovascular specimens from Japanese patientsJ Med Microbiol200756551556 DoTGilbertSCClarkDAliFFatturi ParoloCCMaltzMGeneration of diversity in Streptococcus mutans genes demonstrated by MLSTPLoS One20105e9073 NakanoKLapirattanakulJNomuraRNemotoHAlaluusuaSGrönroosLStreptococcus mutans clonal variation revealed by multilocus sequence typingJ Clin Microbiol20074526162625 LapirattanakulJNomuraRNemotoHNakaSOoshimaTNakanoKMultilocus sequence typing of Streptococcus mutans strains with the cbm gene encoding a novel collagen-binding proteinArch Oral Biol201358989996 AbranchesJMillerJHMartinezARSimpson-HaidarisPJBurneRALemosJAThe collagen-binding protein Cnm is required for Streptococcus mutans adherence to and intracellular invasion of human coronary artery endothelial cellsInfect Immun20117922772284 NomuraRNakaSNemotoHInagakiSTaniguchiKOoshimaTPotential involvement of collagen-binding proteins of Streptococcus mutans in infective endocarditisOral Dis201319387393 García-GodoyFHicksMJMaintaining the integrity of the enamel surface: the role of dental biofilm, saliva and preventive agents in enamel demineralization and remineralizationJ Am Dent Assoc2008139SupplS2534 GoyalDSharmaSMahmoodAInhibition of dextransucrase activity in Streptococcus mutans by plant phenolicsIndian J Biochem Biophys2013504853 ShibataYOzakiKSekiMKawatoTTanakaHNakanoYAnalysis of loci required for determination of serotype antigenicity in Streptococcus mutans and its clinical utilizationJ Clin Microbiol20034141074112 Figures and Tables

Comparison of collagen-binding activities between cnm-positive (cnm+)and cnm-negative (cnm-) strains.

PCR primers for S. mutans used in this study

Name Purpose Sequence (5' to 3') Product size (bp) Reference
cnm-F Collagen-binding TGCTGTTGATGGTAAGGAATTTAAC 717 This study
cnm-R detection CTTTCTTCGCCTGTGCTTG
cbm-F CGCGGACAAAGTGGTATCAG 847
cbm-R TGTTTGAACTTGAGCCTGCC
SC-F Serotyping CGGAGTGCTTTTTACAAGTGCTGG 727 Shibata et al. (2003)
SC-R AACCACGGCCAGCAAACCCTTTAT
SE-F CCTGCTTTTCAAGTACCTTTCGCC 517
SE-R CTGCTTGCCAAGCCCTACTAGAAA
SF-F CCCACAATTGGCTTCAAGAGGAGA 316
SF-R TGCGAAACCATAAGCATAGCGAGG
CEFK-F ATTCCCGCCGTTGGACCATTCC 294 Nakano et al. (2004)
CEFK-R CCAATGTGATTCATCCCATACC
tkt-F* MLST analysis ACCCGGGTGTTGTCATGGGCGCTGC 432 Nakano et al. (2007)
tkt-R* CATAGGATGACGCTTCGCCAGAAAC
glnA-F* CCTTGGGGAGATGAAAACGGAGCCG 462
glnA-R* TGGCCATAAAGGTTGCATACAAACC
gltA-F* TGCCTTAACGATGTTAGAGAGAATG 387
gltA-R* AAAGACTATCTTCAAAAGCACACCC
glk-F* GACAAGTTCAGGAGAAATGGGCTAT 402
glk-R* CAGCAACTCCATGAATAAGATTGCC
aroE-F* GATGAAGTAACGAAAGCAGCAGATT 396
aroE-R* TGCCATCCATACCAACATTGGTCGC
murI-F* TCCGGAGTGGGCGGTTTAACGGTCG 432
murI-R* TCAACAATAGGAACAAATTTGGGGC
lepC-F* CCGCGTCTCTTTATCTGGTTTCTTG 423
lepC-R* GACAATGCGATCATCACCTAAAAGC
gyrA-F* TACAGGTGATGTCATGGGTAAATAC 417
gyrA-R* CCGGGTAGTACTTCCATTAGGTCAC

*The asterisks indicate 8 housekeeping genes, tkt (transketolase), glnA (glutamine synthetase subunit 1a), gltA (glutamate synthase), glk (glucose kinase), aroE (shikimate-5 dehydrogenase), murI (glutamate racemase), lepC (signal peptidase 1) and gyrA (DNA gyrase subunit A).

Characteristics of S. mutans strains analyzed by PCR and sequencing

Species cnm cbm Allelic profiles
 ST Serotype
tkt glnA gltA glk aroE murI lepC gyrA
KCOM2966 ― ― 6 5 9 3 17 4 1 3 221 e
KCOM2084 ― ― 2 2 15 1 14 3 1 10 213 c
KCOM1225 + ― 1 3 8 1 25 3 1 1 123 f
KCOM1223 ― ― 2 5 9 1 4 3 3 1 93 c
KCOM1220 ― ― 2 5 9 1 4 3 3 1 93 c
KCOM1219 + ― 25 2 1 1 9 10 3 1 222 k
KCOM1216 ― ― 1 14 36 3 32 2 11 1 223 c
KCOM1212 ― ― 1 2 8 1 14 18 22 15 214 c
KCOM1209 ― ― 1 14 15 4 4 3 11 1 215 c
KCOM1203 ― ― 1 14 15 4 4 3 11 1 215 c
KCOM1201 ― ― 2 3 15 3 4 5 35 1 224 c
KCOM1200 ― ― 1 14 15 4 4 3 11 1 215 c
KCOM1195 + ― 1 1 1 1 18 5 3 1 216 e
KCOM1194 ― ― 1 1 1 1 17 17 1 9 217 c
KCOM1188 ― ― 1 14 15 4 4 3 1 1 225 c
KCOM1187 ― ― 1 14 5 3 7 19 11 1 218 c
KCOM1186 ― ― 2 2 4 3 4 25 1 4 209 c
KCOM1183 ― ― 1 1 1 13 1 1 1 1 2 c
KCOM1179 ― ― 3 2 37 3 4 3 1 1 226 k
KCOM1178 ― ― 2 3 15 3 4 5 35 1 224 c
KCOM1147 ― ― 1 5 5 1 23 2 1 1 121 f
KCOM1146 ― ― 3 8 38 1 7 3 11 1 227 c
KCOM1145 ― ― 1 14 15 1 2 19 11 9 219 c
KCOM1143 ― ― 2 2 4 5 4 22 30 1 181 c
KCOM1142 ― ― 1 1 1 13 1 1 1 1 2 c
KCOM1141 ― ― 6 1 1 3 2 4 1 3 72 c
KCOM1140 ― ― 6 1 1 3 2 4 1 3 72 c
KCOM1139 ― ― 2 2 15 8 4 3 30 1 220 c
PO1463 ― ― 4 1 1 2 2 5 1 1 228 c
ATCC25175 ― ― 1 1 1 8 11 3 19 1 229 c
UA159 ― ― 1 1 1 1 1 1 1 1 1 c

Bold letters indicate new alleles and sequence type (ST) registered with PubMLST for S. mutans MLST scheme in this study. tkt (#25), GenBank accession no. AB281747; gltA (#36), GenBank accession no. AB281970; gltA (#37), Genbank accession no. AB281943; gltA (#38), GenBank accession no. AB282001; aroE (#32), GenBank accession no. AB282285; lepC (#35), GenBank accession no. AB282484.